ObjectiveTo investigate microbial contamination status and distribution characteristics in laboratory animal barrier facilities, so as to provide a scientific basis for environmental quality control in barrier facilities. MethodsIn accordance with the national standard "Laboratory Animals—Environment and Housing Facilities" and the "Standard Operating Procedures" of the barrier facility, bacterial monitoring was performed on samples of air-settling bacteria, materials, and personnel gloves in the single-corridor barrier facility of the Animal Core Facility, Center for Excellence in Molecular Cell Science, Chinese Academy of Sciences (CEMCS). The monitoring data from January 2020 to December 2024 were collected, organized and statistically analyzed, and partial samples were subjected to species identification using PCR and sequencing methods. ResultsA total of 7 898 samples were collected from 2020 to 2024, including 3 175 air-settling bacteria samples, 3 353 material samples, and 1 370 glove samples. The overall compliance rate was 95.7% (7 559/7 898), among which the compliance rate of air-settling bacteria was 97.1% (3 084/3 175), that of materials was 93.2% (3 125/3 353), and that of personnel gloves was 98.5% (1 350/1 370). Over the five years, the compliance rates of all three types of monitored samples were above 90%. There were statistically significant differences in the compliance rates of air-settling bacteria and material samples among different quarters (P<0.05). Further investigation was conducted on samples collected from January to March 2024, and 190 bacterial strains were obtained through isolation and culture, including 126 strains from air-settling bacteria, 52 strains from materials, and 12 strains from personnel gloves. The strains were identified by PCR amplification and sequencing, and the 190 bacterial strains belonged to 9 genera and 20 species. Gram-positive bacteria accounted for the majority, with Staphylococcus as the dominant genus, accounting for 77.9% (148/190). ConclusionMicroorganisms carried by air, materials, and personnel gloves in barrier facilities are mainly Gram-positive bacteria. Regular monitoring of air-settling bacteria, materials, and personnel gloves in barrier facilities enables timely detection and control of potential risks during husbandry management and facility operation, which is of great significance for maintaining the sound operation of the barrier facility system and ensuring the quality of animal experiments.

This paper introduces a real-world cohort research model for community-acquired pneumonia （CAP） based on the Jiangsu Traditional Chinese Medicine （TCM） Dominant Diseases Diagnosis and Treatment Data Platform. Firstly， data cleaning is performed by standardizing diagnosis， symptoms， treatment and imaging， intelligently extracting unstructured information， and cleaning and constructing a standardized database. Secondly， for cohort establishment， CAP patients across the province are screened in accordance with CAP diagnostic criteria to build a high-quality disease-specific cohort. Lastly， in terms of protocol design， the characteristics of TCM research and the CAP disease profile are considered to determine appropriate inclusion and exclusion criteria， estimate sample size， define interventions， outcomes and economic evaluations， providing a reference for real-world TCM research on CAP.

ObjectiveTo evaluate the clinical efficacy and economic value of the Jiangsu Traditional Chinese Medicine （TCM） Diagnosis and Treatment Protocol for Dominant Diseases （abbreviated as the Diagnosis and Treatment Protocol） in adult patients with non-severe community-acquired pneumonia （CAP） based on real-world clinical data. MethodsA retrospective real-world cohort study was conducted using electronic medical records of adult patients hospitalized for non-severe CAP from September 1st， 2023 to December 31st， 2024 across 10 TCM hospitals in Jiangsu province. Patients were classified into an exposure group and a non-exposure group based on whether they received Chinese herbal medicine （CHM） according to the Diagnosis and Treatment Protocol. The non-exposure group received only conventional western medicine， while the exposure group additionally received differentiated CHM for at least five consecutive days. Outcomes were compared between two patient groups， including cough resolution rate， sputum resolution rate （assessed by volume， color， and consistency）， incidence of abnormal C-reactive protein （CRP）， incidence of abnormal white blood cell （WBC） count， and radiographic resolution rate of pulmonary infiltrates on chest imaging. Multivariable logistic regression was performed to identify factors influencing clinical efficacy. Subgroup analyses were conducted according to age， gender， smoking status， history of hypertension， and pneumonia severity score （CURB-65）， and the efficacy of treatment for cough and sputum was analyzed within each subgroup. Cost-effectiveness analysis was conducted using cough resolution rate as the outcome measure， evaluating the pharmacoeconomics of the two groups. ResultsA total of 1688 patients were included with 1293 in the exposure group and 395 in the non-exposure group. Compared to the non-exposure group， the exposure group demonstrated significantly higher resolution rates of cough， sputum volume， color， and consistency， as well as a significantly lower incidence of abnormal CRP （P＜0.05）. No statistically significant difference was observed between the groups in terms of abnormal WBC count and radiographic resolution rate of pulmonary infiltrates （P＞0.05）. Logistic regression analysis showed that the cough resolution rate in the exposure group was 1.83 times that of the non-exposure group， while the probabilities of resolution in sputum volume， color， and consistency were 1.37， 2.09， and 1.56 times those of the non-exposure group， respectively （P＜0.05）. Subgroup analyses showed that the exposure group achieved significantly higher cough resolution rates across most subgroups except for populations with a CURB-65 score ≥2 or those with a history of hypertension （P＜0.05）. Specifically， among females， patients aged ≥18 and ＜65 years， non-smokers， those without hypertension， and those with a CURB-65 score of 0， the exposure group showed a higher cough resolution rate than the non-exposure group （P＜0.05）. From an economic perspective， total hospitalization cost， length of stay， antibiotic cost， and CHM cost all differed significantly between groups （P＜0.05）. The cost-effectiveness ratio （CER） was 10,788.80 CNY/case in the exposure group， while 22,513.80 CNY/case in the non-exposure group. This implies that， compared with the exposure group， the non-exposure group incurred an additional 17,302.27 CNY to achieve one case of cough resolution. When the willingness-to-pay threshold ranged from 0 to 50,000 CNY， the probability of economic advantage was consistently higher in the exposure group than in the non-exposure group. ConclusionOn the basis of conventional western medicine， the addition of CHM in accordance with the Diagnosis and Treatment Protocol can effectively improve clinical symptoms， reduce inflammatory markers， promote clinical recovery， and is more cost-effective in treating adults with non-severe CAP.

ObjectiveTo observe the real‑world effectiveness and economic outcomes of Weishi Qingjin Formula （苇石清金方， WQF） in the treatment of adult community‑acquired pneumonia （CAP） with phlegm‑heat obstructing the lung syndrome. MethodsBased on a multicenter， real-world retrospective cohort study， clinical data were collected from hospitalized adult patients diagnosed with non‑severe CAP and phlegm‑heat obstructing the lung syndrome in 10 traditional Chinese medicine （TCM） hospitals in Jiangsu province. Patients were divided into an exposure group （those who received oral WQF） and a non‑exposure group （those who did not）. The following outcomes were compared between the two groups before and after treatment， which were remission rates of clinical symptoms including cough， expectoration （sputum volume， color， consistency）， and chest pain， levels of inflammatory markers including C‑reactive protein （CRP） and white blood cell count （WBC）， and the rate of pulmonary inflammatory absorption on chest CT. Subgroup analyses were performed based on age， gender， smoking status， presence of hypertension， and the severity of community-acquired pneumonia （CURB‑65） score， comparing the two groups in terms of cough remission rate， chest pain remission rate， and chest CT absorption rate. For health economic evaluation， cost‑effectiveness analysis was used to calculate the cost‑effectiveness ratio （CER） and incremental cost‑effectiveness ratio （ICER）. Univariate sensitivity analysis and probabilistic sensitivity analysis were performed to test the robustness of the results. ResultsA total of 647 patients in the exposure group and 1491 patients in the non-exposure group were included in the final statistical analysis. There was no statistically significant difference in length of hospital stay， gender， marital status， smoking history， bronchoscopy history， and comorbidities between the groups （P＞0.05）， but age， CURB-65 score， and antibiotic use. The exposure group had significantly higher remission rates of cough and sputum consistency than the non-exposure group （P＜0.05）. After adjusting for confounders using propensity score matching and logistic regression， the cough remission rate in the exposure group was 1.49 times that of the non-exposure group （P＜0.01）. No significant difference was observed between groups in the reduction rates of CRP and WBC， and in the rate of pulmonary inflammatory absorption on chest CT （P＞0.05）. Subgroup analyses revealed that the cough remission rate in the exposure group was significantly better than that in the non-exposure group except for patients aged ≥65 years， smokers， hypertensive patients， those using other type antibiotics or not using antibiotics， and those with a CURB-65 score ≥1 （P＜0.05）. Among smokers， the chest pain remission rate in the exposure group was 4.38 times that of the non-exposure group （P＜0.01）. No significant difference in chest CT absorption rate was found between groups across subgroups of gender， age， hypertension status， or antibiotic type （P＞0.05）. In terms of economic evaluation， CER was 10,877.60 CNY/case in the exposure group and 16,773.10 CNY/case in the non-exposure group. Compared to the exposure group， the non-exposure group incurred an additional 15,034.26 CNY to achieve one case of cough resolution， indicating a more favorable cost-effectiveness profile. Probabilistic sensitivity analysis yielded results consistent with the cost-effectiveness analysis， confirming the robustness of the findings. ConclusionWQF demonstrates significant efficacy in improving cough symptoms in the treatment of adult CAP with phlegm-heat obstructing the lung syndrome， and also exhibits favorable economic benefits.

This paper introduces a real-world cohort research model for community-acquired pneumonia （CAP） based on the Jiangsu Traditional Chinese Medicine （TCM） Dominant Diseases Diagnosis and Treatment Data Platform. Firstly， data cleaning is performed by standardizing diagnosis， symptoms， treatment and imaging， intelligently extracting unstructured information， and cleaning and constructing a standardized database. Secondly， for cohort establishment， CAP patients across the province are screened in accordance with CAP diagnostic criteria to build a high-quality disease-specific cohort. Lastly， in terms of protocol design， the characteristics of TCM research and the CAP disease profile are considered to determine appropriate inclusion and exclusion criteria， estimate sample size， define interventions， outcomes and economic evaluations， providing a reference for real-world TCM research on CAP.

ObjectiveTo evaluate the clinical efficacy and economic value of the Jiangsu Traditional Chinese Medicine （TCM） Diagnosis and Treatment Protocol for Dominant Diseases （abbreviated as the Diagnosis and Treatment Protocol） in adult patients with non-severe community-acquired pneumonia （CAP） based on real-world clinical data. MethodsA retrospective real-world cohort study was conducted using electronic medical records of adult patients hospitalized for non-severe CAP from September 1st， 2023 to December 31st， 2024 across 10 TCM hospitals in Jiangsu province. Patients were classified into an exposure group and a non-exposure group based on whether they received Chinese herbal medicine （CHM） according to the Diagnosis and Treatment Protocol. The non-exposure group received only conventional western medicine， while the exposure group additionally received differentiated CHM for at least five consecutive days. Outcomes were compared between two patient groups， including cough resolution rate， sputum resolution rate （assessed by volume， color， and consistency）， incidence of abnormal C-reactive protein （CRP）， incidence of abnormal white blood cell （WBC） count， and radiographic resolution rate of pulmonary infiltrates on chest imaging. Multivariable logistic regression was performed to identify factors influencing clinical efficacy. Subgroup analyses were conducted according to age， gender， smoking status， history of hypertension， and pneumonia severity score （CURB-65）， and the efficacy of treatment for cough and sputum was analyzed within each subgroup. Cost-effectiveness analysis was conducted using cough resolution rate as the outcome measure， evaluating the pharmacoeconomics of the two groups. ResultsA total of 1688 patients were included with 1293 in the exposure group and 395 in the non-exposure group. Compared to the non-exposure group， the exposure group demonstrated significantly higher resolution rates of cough， sputum volume， color， and consistency， as well as a significantly lower incidence of abnormal CRP （P＜0.05）. No statistically significant difference was observed between the groups in terms of abnormal WBC count and radiographic resolution rate of pulmonary infiltrates （P＞0.05）. Logistic regression analysis showed that the cough resolution rate in the exposure group was 1.83 times that of the non-exposure group， while the probabilities of resolution in sputum volume， color， and consistency were 1.37， 2.09， and 1.56 times those of the non-exposure group， respectively （P＜0.05）. Subgroup analyses showed that the exposure group achieved significantly higher cough resolution rates across most subgroups except for populations with a CURB-65 score ≥2 or those with a history of hypertension （P＜0.05）. Specifically， among females， patients aged ≥18 and ＜65 years， non-smokers， those without hypertension， and those with a CURB-65 score of 0， the exposure group showed a higher cough resolution rate than the non-exposure group （P＜0.05）. From an economic perspective， total hospitalization cost， length of stay， antibiotic cost， and CHM cost all differed significantly between groups （P＜0.05）. The cost-effectiveness ratio （CER） was 10,788.80 CNY/case in the exposure group， while 22,513.80 CNY/case in the non-exposure group. This implies that， compared with the exposure group， the non-exposure group incurred an additional 17,302.27 CNY to achieve one case of cough resolution. When the willingness-to-pay threshold ranged from 0 to 50,000 CNY， the probability of economic advantage was consistently higher in the exposure group than in the non-exposure group. ConclusionOn the basis of conventional western medicine， the addition of CHM in accordance with the Diagnosis and Treatment Protocol can effectively improve clinical symptoms， reduce inflammatory markers， promote clinical recovery， and is more cost-effective in treating adults with non-severe CAP.

ObjectiveTo observe the real‑world effectiveness and economic outcomes of Weishi Qingjin Formula （苇石清金方， WQF） in the treatment of adult community‑acquired pneumonia （CAP） with phlegm‑heat obstructing the lung syndrome. MethodsBased on a multicenter， real-world retrospective cohort study， clinical data were collected from hospitalized adult patients diagnosed with non‑severe CAP and phlegm‑heat obstructing the lung syndrome in 10 traditional Chinese medicine （TCM） hospitals in Jiangsu province. Patients were divided into an exposure group （those who received oral WQF） and a non‑exposure group （those who did not）. The following outcomes were compared between the two groups before and after treatment， which were remission rates of clinical symptoms including cough， expectoration （sputum volume， color， consistency）， and chest pain， levels of inflammatory markers including C‑reactive protein （CRP） and white blood cell count （WBC）， and the rate of pulmonary inflammatory absorption on chest CT. Subgroup analyses were performed based on age， gender， smoking status， presence of hypertension， and the severity of community-acquired pneumonia （CURB‑65） score， comparing the two groups in terms of cough remission rate， chest pain remission rate， and chest CT absorption rate. For health economic evaluation， cost‑effectiveness analysis was used to calculate the cost‑effectiveness ratio （CER） and incremental cost‑effectiveness ratio （ICER）. Univariate sensitivity analysis and probabilistic sensitivity analysis were performed to test the robustness of the results. ResultsA total of 647 patients in the exposure group and 1491 patients in the non-exposure group were included in the final statistical analysis. There was no statistically significant difference in length of hospital stay， gender， marital status， smoking history， bronchoscopy history， and comorbidities between the groups （P＞0.05）， but age， CURB-65 score， and antibiotic use. The exposure group had significantly higher remission rates of cough and sputum consistency than the non-exposure group （P＜0.05）. After adjusting for confounders using propensity score matching and logistic regression， the cough remission rate in the exposure group was 1.49 times that of the non-exposure group （P＜0.01）. No significant difference was observed between groups in the reduction rates of CRP and WBC， and in the rate of pulmonary inflammatory absorption on chest CT （P＞0.05）. Subgroup analyses revealed that the cough remission rate in the exposure group was significantly better than that in the non-exposure group except for patients aged ≥65 years， smokers， hypertensive patients， those using other type antibiotics or not using antibiotics， and those with a CURB-65 score ≥1 （P＜0.05）. Among smokers， the chest pain remission rate in the exposure group was 4.38 times that of the non-exposure group （P＜0.01）. No significant difference in chest CT absorption rate was found between groups across subgroups of gender， age， hypertension status， or antibiotic type （P＞0.05）. In terms of economic evaluation， CER was 10,877.60 CNY/case in the exposure group and 16,773.10 CNY/case in the non-exposure group. Compared to the exposure group， the non-exposure group incurred an additional 15,034.26 CNY to achieve one case of cough resolution， indicating a more favorable cost-effectiveness profile. Probabilistic sensitivity analysis yielded results consistent with the cost-effectiveness analysis， confirming the robustness of the findings. ConclusionWQF demonstrates significant efficacy in improving cough symptoms in the treatment of adult CAP with phlegm-heat obstructing the lung syndrome， and also exhibits favorable economic benefits.

ObjectiveThis study aimed to explore the effects of aerobic exercise on cognitive function in aging mice and to elucidate the underlying molecular mechanisms by which aerobic exercise ameliorates cognitive decline through the regulation of gut microbiota-metabolite network. By providing novel insights into the interplay between exercise, gut microbiota, and cognitive health, this research seeks to offer a robust theoretical foundation for developing anti-aging strategies and personalized exercise interventions targeting aging-related cognitive dysfunction. MethodsUsing naturally aged C57BL/6 mice as the experimental model, this study employed a multi-omics approach combining 16S rRNA sequencing and wide-targeted metabolomics analysis. A total of 18 mice were divided into 3 groups: young control (YC, 4-month-old), old control (OC, 21-month-old), and old+exercise (OE, 21-month-old with 12 weeks of moderate-intensity treadmill training) groups. Behavioral assessments, including the Morris water maze (MWM) test, were conducted to evaluate cognitive function. Histopathological examinations of brain tissue sections provided morphological evidence of neuronal changes. Fecal samples were collected for gut microbiota and metabolite profiling via 16S rRNA sequencing and ultra-performance liquid chromatography coupled with quadrupole-time-of-flight mass spectrometry (UPLC-QTOF-MS). Data were analyzed using a combination of statistical and bioinformatics tools to identify differentially abundant microbial taxa and metabolites and to construct interaction networks between them. ResultsBehavioral tests revealed that 12 weeks of aerobic exercise significantly improved spatial learning and memory capacity of aged mice, as evidenced by reduced escape latency and increased target area exploration and platform crossings in the MWM. Histopathological analysis demonstrated that exercise mitigated aging-related neuronal damage in the hippocampus, enhancing neuronal density and morphology. 16S rRNA sequencing indicated that exercise increased gut microbiota α‑diversity and enriched beneficial bacterial genera, including Bifidobacterium, Parabacteroides, and Rikenella. Metabolomics analysis identified 32 differentially regulated metabolites between OC and OE groups, with 94 up-regulated and 30 down-regulated in the OE group when compared with OC group. These metabolites were primarily involved in energy metabolism reprogramming (e.g., L-homocitrulline), antioxidant defense (e.g., L-carnosine), neuroprotection (e.g., lithocholic acid), and DNA repair (e.g., ADP-ribose). Network analysis further revealed strong positive correlations between specific bacteria and metabolites, such as Parabacteroides with ADP-ribose and Bifidobacterium with lithocholic acid, suggesting potential neuroprotective pathways mediated by the gut microbiota-metabolite axis. ConclusionThis study provides comprehensive evidence that aerobic exercise elicits cognitive benefits in aging mice by modulating the gut microbiota-metabolite network. These findings highlight three key mechanisms: (1) the proliferation of beneficial gut bacteria enhances metabolic reprogramming to boost DNA repair pathways; (2) elevated neuroinflammation-inhibiting factors reduce neurodegenerative changes; and (3) enhanced antioxidant defenses maintain neuronal homeostasis. These results underscore the critical role of the “microbiota-metabolite-brain” axis in mediating the cognitive benefits of aerobic exercise. This study not only advances our understanding of the gut-brain axis in aging but also offers a scientific basis for developing personalized exercise and probiotic-based interventions targeting aging-related cognitive decline. Future research should further validate these mechanisms in non-human primates and human clinical trials to establish the translational potential of exercise-induced gut microbiota-metabolite modulation for combating neurodegenerative diseases.

Body weight abnormalities, including overweight, obesity, and underweight, have become a dual public health challenge in Chinese adults: overweight and obesity lead to a variety of chronic complications, while underweight increases the risks of malnutrition, sarcopenia, and organ dysfunction. To systematically address these issues, multidisciplinary experts in endocrinology, sports science, nutrition, and psychiatry from various regions have held multiple weight management seminars. Based on the latest epidemiological data and clinical evidence, they expanded the guideline to include assessment and intervention strategies for underweight, in addition to the core content of obesity management. This guideline outlines the etiological mechanisms, evaluation methods, and multidimensional management strategies for overweight and obesity, covering key areas such as diagnosis and assessment, medical nutrition therapy, exercise prescription, pharmacological intervention, and psychological support. It is intended to provide a scientific and standardized approach to weight management across the adult population, aiming to curb the rising prevalence of obesity, mitigate complications associated with abnormal body weight, and improve nutritional status and overall quality of life.

Objective:To investigate the clinical features and etiologies of hospitalized patients with spike-and-wave activation in sleep(SWAS).Methods:Case-series study.The clinical features and etiologies of patients diagnosed with SWAS in the Department of Neurology, Capital Center for Children′s Health, Capital Medical University from September 2016 to March 2023 were retrospectively analyzed.The measurement data were analyzed by normality testing, and those conforming to the normal distribution were characterized by Mean± SD deviation.After the homogeneity test of variance, either the independent sample t test or the completely random analysis of variance (ANOVA) was employed for data comparison between groups.If the results of ANOVA were statistically significant, the LSD test was utilized for pairwise comparison. Results:(1)Basic data: a total of 140 patients with SWAS were included, with the onset age of (7.4±2.1) years.There were 134 cases (134/140, 95.7%) complicated by epilepsy, and the age of epilepsy onset was (5.3±2.2) years.Seventy-four cases (74/137, 54.0%) had self-limited epilepsy and centrotemporal spikes.Twenty-one cases (21/137, 15.3%) had epileptic encephalopathy and SWAS.Eight cases (8/137, 5.8%) had developmental and epileptic encephalopathy and SWAS.Pulse Methylprednisolone therapy, Clonazepam or Clobazam, callosotomy, and left temporo-parietal-occipital craniotomy for epileptogenic lesion resection were effective in 20 cases (20/32, 62.5%), 3 cases (3/13, 23.1%), 1 case (1/2, 50.0%) and 1 case, respectively.One patient achieved development improvement and a decrease in discharge index after vagus nerve stimulation.(2) Etiologies: ①Genetic etiology: 6 patients carried pathogenic or suspected pathogenic mutations, including GRIN2A (c.87_106dupGGGTCCCCCCGCGCTAAATA/p.I36Rfs*6), GRIN2A (c.2069C>T/p.T690M), CREBBP (c.4844A>G/p.N1615S), KAT6A(c.2203C>T/p.R735X), GRIN1 (c.2326_2327insACCTCT-GGAAGCAGAACGTCTCCCTGTCCA/p.S775_I776insNLWKQNVSLS) and MECP2 (c.916C>T/p.R306C).Among them, there were no reports on the association of CREBBP and KAT6A with SWAS.②Structural etiology: there were 7 cases with perinatal brain injury and 1 case with bilateral temporo-parietal gyrus.③Metabolic etiology: 1 patient with cerebrotendinous xanthomatosis carried the pathogenic gene CYP27A1 (c.379C>T/p.R127W, c.1415G>C/p.G472A), which was not related to SWAS.④Infectious etiology: 1 case had congenital cytomegalovirus infection.⑤ Immune etiology: 1 case had autoimmune encephalitis.⑥ There were 123 cases with unknown etiologies.(3) Etiologies and clinical characteristics: SWAS occurred earlier in patients with structural etiology than that in patients with unknown etiologies ( F=4.478, P<0.05).The proportions of discharge index ≥85% ( χ2=10.079, P<0.05) and encephalopathy ( χ2=9.385, P<0.05) were higher in patients with genetic etiology than those in patients with unknown etiologies.(4) Discharge index: the patients were divided into a group with a discharge index ≥85% and a group with a discharge index < 85%.Compared with the latter group, the former group had a higher proportion of developmental retardation ( χ2=15.976, P<0.001), suffered epilepsy ( t=-3.498, P<0.05) and SWAS at a younger age ( t=-2.044, P<0.05), and used more types of antiepileptic drugs ( t=2.079, P<0.05).(5) Neurodevelopmental outcomes: 21 patients had neurodevelopmental disorders and 75 had normal neurodevelopment. Conclusions:There are various etiologies for encephalopathy or epilepsy complicated by SWAS.The patients with structural etiology may develop SWAS at a younger age, whereas those with a clearly identified pathogenic gene may exhibit a higher discharge index and a higher rate of encephalopathy.When patients present with encephalopathy or refractory epilepsy, surgical treatment should be considered if structural lesions are found.The proportion of developing encephalopathy in patients with a discharge index ≥85% is the same as that in patients with a discharge index <85%.However, the patients with a higher discharge index develop epilepsy and SWAS at a younger age, and are more difficult to treat.