OBJECTIVE: To investigate the detection patterns, clinical phenotypic characteristics, and differences in diagnostic timeliness of Klinefelter syndrome (KS) across prenatal and postnatal stages, with an aim to provide a basis for optimizing strategies for early screening, diagnosis, and intervention. METHODS: A retrospective study was conducted to analyze data from two phases. The prenatal diagnosis group included 33,302 pregnant women who underwent amniocytic karyotyping due to advanced maternal age, abnormal ultrasound findings, or high-risk non-invasive prenatal testing (NIPT). The postnatal diagnosis group included 52,101 patients who underwent peripheral blood karyotyping due to primary infertility, abnormal external genitalia, or growth and developmental abnormalities. Additionally, medical histories of adult diagnosed patients were reviewed retrospectively to identify early occult symptoms. This study was approved by the Medical Ethics Committee of Chengdu Women's and Children's Central Hospital (Ethics No.: LCYJ-2025-030). RESULTS: In the prenatal group, 96 cases of KS were detected (detection rate 0.29%). The primary indications for referral were NIPT indicating sex chromosome abnormalities (45.83%), advanced maternal age (16.66%), and ultrasound abnormalities (17.70%). In the postnatal group, 128 cases of KS were detected (detection rate 0.25%). Clinical presentations were primarily primary infertility/azoospermia (77.34%), and the patients were predominantly adults (84.40%). Retrospective analysis revealed that adult patients presented with specific physical signs that had been overlooked during childhood. CONCLUSION As KS lacks typical early clinical manifestations, diagnosis is often delayed until adulthood when reproductive needs arise, showing a pattern of "passive detection" and resulting in missed opportunities for optimal intervention. By conducting a comparative analysis of prenatal diagnostic data and postnatal retrospective data, a risk association model linking prenatal screening indications with childhood-specific signs was developed. This study has provided empirical evidence for establishing a multidisciplinary, full life-cycle management system of "screening ~ diagnosis ~ monitoring ~ intervention" helping to shift from "passive detection in adulthood" to "proactive management across the entire life course," and laid a foundation for improving early diagnosis rate and long-term quality of life for patients.
Humans ; Klinefelter Syndrome/genetics* ; Female ; Adult ; Pregnancy ; Retrospective Studies ; Prenatal Diagnosis/methods* ; Male ; Phenotype ; Karyotyping ; Young Adult ; Adolescent ; Middle Aged

Puerariae Lobatae Radix and Puerariae Thomsonii Radix are the dried roots of Pueraria lobata and Pueraria thomsonii of the Leguminosae family， respectively. Since their separate inclusion in the 2005 edition of Pharmacopoeia of the People's Republic of China， the two herbs have been individually recorded. Although they share the same functions and indications， the required content of puerarin differs by a factor of up to eightfold between them. The current quality standard relies solely on a single indicator， puerarin， which fails to reflect the correlation between chemical constituents and core therapeutic effects. This has resulted in prominent issues of mixed use in clinical practice and production， thereby constraining the high-quality development of the industry. Modern research has demonstrated that Puerariae Lobatae Radix contains a comprehensive range and higher content of isoflavonoid constituents， while Puerariae Thomsonii Radix is rich in starch and polysaccharides. Puerariae Lobatae Radix exhibits stronger effects in antipyresis， cardiovascular and cerebrovascular protection， and central analgesia， while Puerariae Thomsonii Radix demonstrates greater advantages in anti-inflammation， hypoglycemia， and peripheral analgesia. Based on this， the chemical material bases of Puerariae Lobatae Radix and Puerariae Thomsonii Radix at both the macromolecule and micromolecule levels were systematically reviewed and compared. The pharmacodynamic material bases and mechanisms of action underlying their three core therapeutic effects， namely "relieving exterior syndrome and clearing heat"， "promoting fluid production to quench thirst"， and "dredging channels and activating collaterals"， were summarized. The most highly correlated common metabolic pathway shared by both herbs for these three therapeutic effects is the arachidonic acid metabolic pathway， and their common core target is prostaglandin-endoperoxide synthase 2 （PTGS2）. This review provided clinical application recommendations based on the therapeutic differences between the two herbs， elucidated the scientific connotation of their "same origin but different effects"， and， grounded in the quality marker （Q-Marker）， proposed the concept of efficacy-related Q-Marker based on "substance-efficacy-syndrome" association， as well as a novel strategy for efficacy-oriented quality evaluation. Preliminary screening of quality markers associated with different therapeutic effects was also conducted. This study aims to provide critical scientific evidence for the precise clinical application of Puerariae Lobatae Radix and Puerariae Thomsonii Radix， the improvement of quality standards， and the high-quality development of the industry.

Objective:To investigate the impact of immunosuppressive therapy on the severity of SARS-CoV-2 infection and cytokine levels in pediatric patients with kidney diseases.Methods:A retrospective analysis was conducted on the clinical data of 40 hospitalized pediatric patients who were diagnosed with SARS-CoV-2 infection at the 900th Hospital of PLA Joint Logistic Support Force from December 2022 to February 2023. Based on their immunosuppressive status prior to SARS-CoV-2 infection, these patients were categorized into immunosuppressive group and non-immunosuppressive group. Independent sample t-tests, Mann-Whitney U tests, and χ2 test were employed to compare the clinical baseline characteristics and laboratory data, the severity of SARS-CoV-2 infection, and the levels of cytokines between the 2 groups. Results:Among the 40 patients, 11 were in the immunosuppressive group (aged 13 (8, 14) years, 9 males and 2 females) and 29 in the non-immunosuppressive group (aged 2 (1, 4) years, 15 males and 14 females). In the immunosuppressive group, 2 were asymptomatic cases, 8 were mild cases, and 1 was moderate case, and there was no severe or critical cases. In the non-immunosuppressive group, 8 were mild cases, 5 were moderate, 15 were severe cases, 1 was critical case, and no asymptomatic cases. The underlying diseases in the immunosuppressive group included nephrotic syndrome (6 cases), IgA vasculitis nephritis (2 cases), lupus nephritis (1 case), post-renal transplantation (1 case), and renal failure (1 case), with a mean total immunosuppression score (TIS) of (3.6±1.4) points. In the non-immunosuppressive group, 2 patients had a history of epilepsy, and the remaining 27 cases had no underlying conditions, all with TIS scores of 0. Compared to the children in the non-immunosuppressive group, those in the immunosuppressive group were more likely to exhibit asymptomatic or mild infection, with lower risks of severe disease, cytokine storm, fever, and cough, but a higher risk of fatigue ( OR=1.22, 2.66, 0.48, 0.12, 0.12, 0.13, 1.22; 95% CI 0.93-1.62, 0.99-7.15, 0.33-0.70, 0.03-0.57, 0.03-0.57, 0.03-0.65, 0.93-1.62; all P<0.05). The levels of cytokine IL-6, interferon-α and interferon-γ in the immunosuppressive group were all lower than those in the non-immunosuppressive group ( Z=2.23, 2.51, 2.92, respectively; all P<0.05). Conclusion:Pediatric patients with kidney diseases receiving appropriate immunosuppressive therapy may mitigate the severity of SARS-CoV-2 infection by suppressing the expression of cytokines.

Objective:To investigate the clinical and genetic characteristics of developmental and epileptic encephalopathy related to the EEF1A2 gene. Methods:The clinical data and whole exome sequencing results of 2 patients who were diagnosed as developmental and epileptic encephalopathy related to the EEF1A2 gene in the Children′s Hospital, Capital Institute of Pediatrics in June 2016 and August 2018 were retrospectively analyzed. Relevant literatures were retrieved using " EEF1A2" and "epileptic encephalopathy" or "epilepsy" as key words in Online Mendelian Inheritance in Man, PubMed, CNKI and Wanfang databases (literatures searching from establishment of these databases to June 2024). The clinical and genetic characteristics of developmental and epileptic encephalopathy related to the EEF1A2 gene were summarized based on literature reports and the data of these 2 patients. Results:Patient 1 was a 9 months old male infant. He presented with global developmental delay. He developed myoclonic seizures at 4 months old. Valproic acid, clonazepam, topiramate and vagus nerve stimulation were all ineffective. Both of his hands had transverse palmar crease. The de novo c.364G>A variant in the EEF1A2 gene (NM_001958.3) was identified and he was diagnosed with developmental and epileptic encephalopathy related to the EEF1A2 gene. Patient 2 was a 2 years and 2 months old boy. He presented with global developmental delay. Myoclonic seizures occurred when he was 2 years and 3 months old, and various anti-epileptic drugs were ineffective. He had left eye esotropia and low muscle tone in the extremities. He died at the age of 4. The de novo c.208G>A variant in the EEF1A2 gene (NM_001958.3) was identified and he was diagnosed with developmental and epileptic encephalopathy related to the EEF1A2 gene. Eight literatures on developmental and epileptic encephalopathy related to the EEF1A2 gene (all in English) were retrieved, reporting 28 cases (totally 30 patients, including 2 cases in this study). The main clinical manifestations were psychomotor developmental delay (30/30, 100.0%), facial dysmorphism (15/30, 50.0%), refractory epilepsy (14/26, 53.8%), myoclonic seizures (19/26, 73.1%), and movement disorders (8/16). A total of 15 mutation sites in the EEF1A2 gene were reported, all of which were missense mutations. Conclusions:Developmental and epileptic encephalopathy related to the EEF1A2 gene is primarily characterized by delayed psychomotor development, distinctive facial features, drug-resistant epilepsy, myoclonic seizures, and movement disorders. Variants in the EEF1A2 gene are predominantly missense mutations, and identifying these variants plays a crucial role in accurate diagnosis of the disease.

Objective:To investigate the clinical features and etiologies of hospitalized patients with spike-and-wave activation in sleep(SWAS).Methods:Case-series study.The clinical features and etiologies of patients diagnosed with SWAS in the Department of Neurology, Capital Center for Children′s Health, Capital Medical University from September 2016 to March 2023 were retrospectively analyzed.The measurement data were analyzed by normality testing, and those conforming to the normal distribution were characterized by Mean± SD deviation.After the homogeneity test of variance, either the independent sample t test or the completely random analysis of variance (ANOVA) was employed for data comparison between groups.If the results of ANOVA were statistically significant, the LSD test was utilized for pairwise comparison. Results:(1)Basic data: a total of 140 patients with SWAS were included, with the onset age of (7.4±2.1) years.There were 134 cases (134/140, 95.7%) complicated by epilepsy, and the age of epilepsy onset was (5.3±2.2) years.Seventy-four cases (74/137, 54.0%) had self-limited epilepsy and centrotemporal spikes.Twenty-one cases (21/137, 15.3%) had epileptic encephalopathy and SWAS.Eight cases (8/137, 5.8%) had developmental and epileptic encephalopathy and SWAS.Pulse Methylprednisolone therapy, Clonazepam or Clobazam, callosotomy, and left temporo-parietal-occipital craniotomy for epileptogenic lesion resection were effective in 20 cases (20/32, 62.5%), 3 cases (3/13, 23.1%), 1 case (1/2, 50.0%) and 1 case, respectively.One patient achieved development improvement and a decrease in discharge index after vagus nerve stimulation.(2) Etiologies: ①Genetic etiology: 6 patients carried pathogenic or suspected pathogenic mutations, including GRIN2A (c.87_106dupGGGTCCCCCCGCGCTAAATA/p.I36Rfs*6), GRIN2A (c.2069C>T/p.T690M), CREBBP (c.4844A>G/p.N1615S), KAT6A(c.2203C>T/p.R735X), GRIN1 (c.2326_2327insACCTCT-GGAAGCAGAACGTCTCCCTGTCCA/p.S775_I776insNLWKQNVSLS) and MECP2 (c.916C>T/p.R306C).Among them, there were no reports on the association of CREBBP and KAT6A with SWAS.②Structural etiology: there were 7 cases with perinatal brain injury and 1 case with bilateral temporo-parietal gyrus.③Metabolic etiology: 1 patient with cerebrotendinous xanthomatosis carried the pathogenic gene CYP27A1 (c.379C>T/p.R127W, c.1415G>C/p.G472A), which was not related to SWAS.④Infectious etiology: 1 case had congenital cytomegalovirus infection.⑤ Immune etiology: 1 case had autoimmune encephalitis.⑥ There were 123 cases with unknown etiologies.(3) Etiologies and clinical characteristics: SWAS occurred earlier in patients with structural etiology than that in patients with unknown etiologies ( F=4.478, P<0.05).The proportions of discharge index ≥85% ( χ2=10.079, P<0.05) and encephalopathy ( χ2=9.385, P<0.05) were higher in patients with genetic etiology than those in patients with unknown etiologies.(4) Discharge index: the patients were divided into a group with a discharge index ≥85% and a group with a discharge index < 85%.Compared with the latter group, the former group had a higher proportion of developmental retardation ( χ2=15.976, P<0.001), suffered epilepsy ( t=-3.498, P<0.05) and SWAS at a younger age ( t=-2.044, P<0.05), and used more types of antiepileptic drugs ( t=2.079, P<0.05).(5) Neurodevelopmental outcomes: 21 patients had neurodevelopmental disorders and 75 had normal neurodevelopment. Conclusions:There are various etiologies for encephalopathy or epilepsy complicated by SWAS.The patients with structural etiology may develop SWAS at a younger age, whereas those with a clearly identified pathogenic gene may exhibit a higher discharge index and a higher rate of encephalopathy.When patients present with encephalopathy or refractory epilepsy, surgical treatment should be considered if structural lesions are found.The proportion of developing encephalopathy in patients with a discharge index ≥85% is the same as that in patients with a discharge index <85%.However, the patients with a higher discharge index develop epilepsy and SWAS at a younger age, and are more difficult to treat.

Objective:To evaluate the cost-effectiveness of Artificial Intelligence(AI)-assisted physician image interpretation in the screening of early-stage lung cancer(stage Ⅰ)from the perspective of the healthcare system,so as to provide evidence for screening strategy optimization.Methods:Based on community populations,a decision tree model was constructed to simulate the cost-effectiveness of two screening strategies:Al-assisted physician image interpretation and independent physician image interpretation,and the Incremental Cost-Effectiveness Ratio(ICER)was calculated.Results:In the basic analysis,the per capita costs of the AI-assisted group and the physician group were 1 483 yuan and 1 489 yuan,respectively,and the effectiveness was 17.02 Quality-Adjusted Life Years(QALYs)and 16.99 QALYs,respectively.Compared with the physician group,the AI-assisted group saved 6 yuan per case and obtained an additional 0.03 QALY per case.The ICER was negative,indicating that the AI-assisted group had an absolute advantage.Threshold analysis showed that when the inspection cost of Al-assisted physician image interpretation increased to 428 yuan per case,the average cost per case was the same between these two groups,and the ICER was 0.When the inspection cost of Al-assisted physician image interpretation was above 428 yuan,the ICER was positive,still demonstrating economic efficiency.Conclusion:AI-assisted image interpretation is cost-effective in the screening of early-stage lung cancer and can facilitate the"early detection,early diagnosis,and early treatment"of lung cancer based on improving the efficiency and accuracy of screening,so as to provide scientific support for health system resource optimization.

Objective To investigate the clinical efficacy of oblique lumbar interbody fusion(OLIF)combined with lateral plate fixation in the treatment of single-level adjacent segment disease(ASDis)following lumbar fusion surgery so as to evaluate the safety and effectiveness of this surgical approach.Methods A retrospective analysis was conducted on 46 patients with single-level ASDis after lumbar fusion surgery from August 2022 to October 2024.Twenty-three patients underwent OLIF combined with lateral plate fixation(OLIF group),while 23 patients received posterior lumbar interbody fusion(PLIF)(PLIF group).The following parameters were compared between the two groups:operative time,intraoperative blood loss,visual analogue scale(VAS)for pain,Oswestry disability index(ODI),disc height(DH),intervertebral foramen height(IFH),and interbody fusion status.Results All the 46 patients successfully completed surgery for single-level ASDis and were followed up for(13.7±1.1)months.The OLIF group had significantly shorter operative time[(70.7±4.6)min vs.(128.6±12.0)min]and less intraoperative blood loss[(58.6±5.7)mL vs.(313.3±47.5)mL]compared to the PLIF group(all P＜0.05).Both groups showed significant improvements in postoperative lumbar VAS and ODI scores at all follow-up time points compared to preoperative values(P＜0.05).The OLIF group exhibited significantly lower lumbar VAS scores at 3 days and 3 months postoperatively than those of the PLIF group(P＜0.05),and there was no statistical difference in VAS scores at the other follow-up time points(P＞0.05).There was no significant difference in postoperative ODI between OLIF group and PLIF group at each time point(P＞0.05).Postoperative DH and IFH were significantly improved in both groups compared to preoperative measurements(P＜0.05).In OLIF group,1 case of transient left thigh numbness resolved with conservative treatment within 2 weeks;1 case of cage subsidence was observed at 1 month postoperatively,achieving fusion without further displacement by 13 months.All the OLIF cases achieved complete fusion(fusion rate:100％).In PLIF group,2 cases of cerebrospinal fluid leakage healed with bed rest,1 case of wound exudation resolved with intensive dressing changes,and 1 case failed to achieve fusion(fusion rate:96％).Conclusion OLIF combined with lateral plate fixation demonstrates satisfactory early clinical outcomes for single-level ASDis after lumbar fusion,with significant advantages in operative efficiency(shorter time plus reduced blood loss)and short-term pain relief.Therefore,it is a safe and effective surgical approach.

Objective:To explore the clinical features, histopathological morphology, and differential diagnosis of lymphoepithelioma-like carcinoma with abnormal expression of follicular dendritic cell markers.Methods:From 2020 to 2021, 4 cases of lymphoepithelioma-like carcinoma with abnormal expression of follicular dendritic cell markers diagnosed in Fujian Cancer Hospital (2 cases) and the Second Affiliated Hospital of Fujian Medical University (2 cases) were collected. Different ancillary procedures such as HE, special stains, immunohistochemistry, and in situ hybridization techniques were used to assess the histopathological features and immunophenotypes. The clinical data were collected and literature was reviewed.Results:All 4 cases of lymphoepithelioma-like carcinoma with abnormal expression of follicular dendritic cell markers were male. They were 32, 45, 67 and 39 years old, respectively. The main clinical manifestations were bloody phlegm, abdominal pain, fatigue and anorexia. The clinical stages at diagnosis were stage Ⅳ (3 cases) and stage Ⅱ (1 case). Cases 2 and 3 had two pathological examinations at different sites, with a total of six pathological examinations. The histomorphology showed singly scattered or nests of tumor cells in a background of abundant small lymphocytes. The tumor cells were enlarged and pleomorphic, some appeared polygonal with inconspicuous cell borders, and they were arranged in a syncytial pattern. There were megakaryocytes, multinucleated tumor cells, and a few spindle-shaped cells seen. Atypical mitosis was commonly noted. By immunohistochemistry, the tumor cells were positive for CKpan(5/6), CK8/18(4/4), CAM5.2(2/5), CK-H(0/4), CK-L(3/4), EMA(4/5), CK5/6(3/6), p63(1/6), p40(1/6), E-cadherin (4/6), SSTR2(6/6), PD-L1(5/5), LCA(0/6), vimentin(5/6), CD2 (6/6), CD23(6/6), CD35(5/6), CXCL-13(4/5) and D2-40(1/5). The Ki-67 proliferative index was 60%-95%. In situ hybridization for EBER were all positive (6/6). Special stain for reticulin showed positive staining surrounding nests of tumor cells.Conclusions:The expression of follicular dendritic cell markers in lymphoepithelioma-like carcinoma is very rare, which may be related to EBV infection. Occasionally, it can overlap with follicular dendritic cell sarcoma by morphology and immunophenotype, which can lead to misdiagnosis. Only by combining clinical information, morphological characteristics and immunophenotype can an appropriate diagnosis be made.

Objective:To investigate the impact of immunosuppressive therapy on the severity of SARS-CoV-2 infection and cytokine levels in pediatric patients with kidney diseases.Methods:A retrospective analysis was conducted on the clinical data of 40 hospitalized pediatric patients who were diagnosed with SARS-CoV-2 infection at the 900th Hospital of PLA Joint Logistic Support Force from December 2022 to February 2023. Based on their immunosuppressive status prior to SARS-CoV-2 infection, these patients were categorized into immunosuppressive group and non-immunosuppressive group. Independent sample t-tests, Mann-Whitney U tests, and χ2 test were employed to compare the clinical baseline characteristics and laboratory data, the severity of SARS-CoV-2 infection, and the levels of cytokines between the 2 groups. Results:Among the 40 patients, 11 were in the immunosuppressive group (aged 13 (8, 14) years, 9 males and 2 females) and 29 in the non-immunosuppressive group (aged 2 (1, 4) years, 15 males and 14 females). In the immunosuppressive group, 2 were asymptomatic cases, 8 were mild cases, and 1 was moderate case, and there was no severe or critical cases. In the non-immunosuppressive group, 8 were mild cases, 5 were moderate, 15 were severe cases, 1 was critical case, and no asymptomatic cases. The underlying diseases in the immunosuppressive group included nephrotic syndrome (6 cases), IgA vasculitis nephritis (2 cases), lupus nephritis (1 case), post-renal transplantation (1 case), and renal failure (1 case), with a mean total immunosuppression score (TIS) of (3.6±1.4) points. In the non-immunosuppressive group, 2 patients had a history of epilepsy, and the remaining 27 cases had no underlying conditions, all with TIS scores of 0. Compared to the children in the non-immunosuppressive group, those in the immunosuppressive group were more likely to exhibit asymptomatic or mild infection, with lower risks of severe disease, cytokine storm, fever, and cough, but a higher risk of fatigue ( OR=1.22, 2.66, 0.48, 0.12, 0.12, 0.13, 1.22; 95% CI 0.93-1.62, 0.99-7.15, 0.33-0.70, 0.03-0.57, 0.03-0.57, 0.03-0.65, 0.93-1.62; all P<0.05). The levels of cytokine IL-6, interferon-α and interferon-γ in the immunosuppressive group were all lower than those in the non-immunosuppressive group ( Z=2.23, 2.51, 2.92, respectively; all P<0.05). Conclusion:Pediatric patients with kidney diseases receiving appropriate immunosuppressive therapy may mitigate the severity of SARS-CoV-2 infection by suppressing the expression of cytokines.

This paper systematically summarizes the practical experience of the 2025 Dingri earthquake emergency medical rescue in Tibet. It analyzes the requirements for earthquake medical rescue under conditions of high-altitude hypoxia, low temperature, and low air pressure. The paper provides a detailed discussion on the strategic layout of earthquake medical rescue at the national level, local government level, and through social participation. It covers the construction of rescue organizational systems, technical systems, material support systems, and information systems. The importance of building rescue teams is emphasized. In high-altitude and cold conditions, rapid response, scientific decision-making, and multi-party collaboration are identified as key elements to enhance rescue efficiency. By optimizing rescue organizational structures, strengthening the development of new equipment, and promoting telemedicine technologies, the precision and effectiveness of medical rescue can be significantly improved, providing important references for future similar disaster rescues.