1.Effect of wogonin on nerve injury in rats with diabetic cerebral infarction
Huanhuan WANG ; Panpan LIANG ; Jinshui YANG ; Shuxian JIA ; Jiajia ZHAO ; Yuanyuan CHEN ; Qian XUE ; Aixia SONG
Chinese Journal of Tissue Engineering Research 2025;29(11):2327-2333
BACKGROUND:Wogonin is a flavonoid extracted from the root of Scutellaria baicalensis.Previous studies have shown that baicalein has protective effects against cerebral ischemia-reperfusion injury,and can also reduce blood sugar and complications in diabetic mice,but its role and mechanism in diabetic cerebral infarction remain unclear. OBJECTIVE:To explore the effect of wogonin on nerve injury in rats with diabetic cerebral infarction and its mechanism. METHODS:Sprague-Dawley rats were randomly divided into six groups:control group,model group,low-dose wogonin group,medium-dose wogonin group,high-dose wogonin group,and high-dose wogonin+Ras homolog gene family member A(RhoA)activator group.Except for the control group,the other rats were established with diabetes and cerebral ischemia models using intraperitoneal injection of streptozotocin and middle cerebral artery occlusion.Low,medium-and high-dose wogonin groups were intragastrically given 10,20,40 mg/kg wogonin,respectively;high-dose wogonin+RhoA activator group was intragastrically given 40 mg/kg wogonin and intraperitoneally injected 10 mg/kg lysophosphatidic acid;control group and model group were given the same amount of normal saline once a day for 7 consecutive days.Rats in each group were evaluated for neurological deficits and their blood glucose levels were measured after the last dose.TTC staining was applied to detect the volume of cerebral infarction.Hematoxylin-eosin staining was applied to observe pathological changes in brain tissue.ELISA kit was applied to detect tumor necrosis factor-α,interleukin-6,malondialdehyde,and superoxide dismutase levels in brain tissue.Western blot was applied to detect the protein expression of RhoA and Rho-associated protein kinase(ROCK)2 in brain tissue. RESULTS AND CONCLUSION:Compared with the control group,the neuronal structure of rats in the model group was severely damaged,with cell necrosis and degeneration,the neurological deficit score,blood glucose level,and infarct volume were significantly elevated(P<0.05),the levels of tumor necrosis factor-α,interleukin-6,and malondialdehyde,and the protein expression of RhoA and ROCK2 in brain tissue were significantly increased(P<0.05),and the superoxide dismutase level was decreased(P<0.05).Compared with the model group,the low-,medium-,and high-dose wogonin groups showed improved neuronal damage,reduced cell degeneration and necrosis,a significant reduction in neurological deficit score,blood glucose level,infarct volume,and the levels of tumor necrosis factor-α,interleukin-6,and malondialdehyde,and the protein expression of RhoA and ROCK2 in brain tissue,and an increase in the superoxide dismutase level(P<0.05).Compared with the high-dose wogonin group,the high-dose wogonin+RhoA activator group significantly weakened the improvement in the above indexes of rats with diabetic cerebral infarction(P<0.05).To conclude,wogonin can improve the blood glucose level in rats with diabetic cerebral infarction,reduce cerebral infarction and nerve injury,and its mechanism may be related to the inhibition of RhoA/ROCK signaling pathway.
2.Association between near work, screen time, outdoor time and myopia in children
Huanhuan HUO ; Suyun LI ; Tingting QIU ; Yizhuo GONG ; Xianwei YAO ; Qian XU ; Guoyong LIU ; Yuanyuan HU ; Hongsheng BI
Chinese Journal of Experimental Ophthalmology 2025;43(6):548-555
Objective:To analyze the correlation between near work, screen time, outdoor time and myopia in children based on objective monitoring technology and to explore the influencing factors related to myopia in children.Methods:A cross-sectional study was conducted.From October 2022 to March 2023, the purposive sampling method was used to select 596 children in Grade 2 and Grade 3 from two primary schools in Shandong Province as study subjects.Eye-Monitor technology of eye-use behavior based on artificial intelligence was used to quantify parameters of near work, screen time and outdoor time.The eye-use behavior parameters were compared within each subject and between non-myopic and myopic children on weekdays and weekends.A multivariate binary logistic regression model was constructed to analyze the influencing factors related to myopia.The study protocol was approved by the Medical Ethics Committee of the Affiliated Eye Hospital of Shandong University of Traditional Chinese Medicine (No.HEC-HY-2022023KY).Written informed consent was obtained from the legal guardian of each subject.Results:For each subject, the proportion of near work time on weekdays was greater than on weekends, the proportion of time spent looking at cell phones, computer screens, and outdoor activities was smaller, the duration of single continuous near eye use was longer, the tilt angle of the head in sitting position was greater, and the light intensity was stronger, showing statistically significant differences ( t=19.427, -9.964, -5.916, -10.470, 2.211, 2.898, 15.061; all P<0.05).During weekdays, compared with the non-myopia group, the myopia group had longer total near work duration, longer single continuous near eye use duration, shorter outdoor activity duration, closer eye use distance, larger proportion of near work time, and smaller proportion of outdoor activity time, showing statistically significant differences (all P<0.05).During weekends, compared with the non-myopia group, the myopia group had longer time spent looking at cell phones and computer screens, shorter outdoor activity time, greater proportion of time spent looking at cell phones and computer screens, and smaller proportion of outdoor activity time, with statistically significant differences (all P<0.05).During weekdays, after adjusting for confounding factors, longer single continuous near eye use duration ( OR=1.138, 95% CI: 1.086-1.192, P<0.001) was the risk factor for myopia, and longer working distance ( OR=0.906, 95% CI: 0.847-0.970, P=0.004) and longer outdoor activity time ( OR=0.127, 95% CI: 0.023-0.703, P=0.018) were protective factors for myopia.During weekends, after adjusting for confounding factors, longer time spent on looking at cell phone screens ( OR=2.437, 95% CI: 1.460-4.068, P<0.001) and longer time spent on looking at computer screens ( OR=2.260, 95% CI: 1.283-3.979, P=0.005) were risk factors for myopia, and longer outdoor activity time ( OR=0.624, 95% CI: 0.416-0.934, P=0.022) was the protective factor for myopia. Conclusions:The eyes with continuous near work, prolonged use of smartphone and computer screens, closer eye use distance, and less time spent outdoors have been confirmed to be significantly correlated with myopia based on objective monitoring data.When formulating intervention measures for myopia prevention and control in children, it is advocated to further pay attention to control the distance and duration of near work on weekdays and strengthen screen time management on weekends.
3.Association between near work, screen time, outdoor time and myopia in children
Huanhuan HUO ; Suyun LI ; Tingting QIU ; Yizhuo GONG ; Xianwei YAO ; Qian XU ; Guoyong LIU ; Yuanyuan HU ; Hongsheng BI
Chinese Journal of Experimental Ophthalmology 2025;43(6):548-555
Objective:To analyze the correlation between near work, screen time, outdoor time and myopia in children based on objective monitoring technology and to explore the influencing factors related to myopia in children.Methods:A cross-sectional study was conducted.From October 2022 to March 2023, the purposive sampling method was used to select 596 children in Grade 2 and Grade 3 from two primary schools in Shandong Province as study subjects.Eye-Monitor technology of eye-use behavior based on artificial intelligence was used to quantify parameters of near work, screen time and outdoor time.The eye-use behavior parameters were compared within each subject and between non-myopic and myopic children on weekdays and weekends.A multivariate binary logistic regression model was constructed to analyze the influencing factors related to myopia.The study protocol was approved by the Medical Ethics Committee of the Affiliated Eye Hospital of Shandong University of Traditional Chinese Medicine (No.HEC-HY-2022023KY).Written informed consent was obtained from the legal guardian of each subject.Results:For each subject, the proportion of near work time on weekdays was greater than on weekends, the proportion of time spent looking at cell phones, computer screens, and outdoor activities was smaller, the duration of single continuous near eye use was longer, the tilt angle of the head in sitting position was greater, and the light intensity was stronger, showing statistically significant differences ( t=19.427, -9.964, -5.916, -10.470, 2.211, 2.898, 15.061; all P<0.05).During weekdays, compared with the non-myopia group, the myopia group had longer total near work duration, longer single continuous near eye use duration, shorter outdoor activity duration, closer eye use distance, larger proportion of near work time, and smaller proportion of outdoor activity time, showing statistically significant differences (all P<0.05).During weekends, compared with the non-myopia group, the myopia group had longer time spent looking at cell phones and computer screens, shorter outdoor activity time, greater proportion of time spent looking at cell phones and computer screens, and smaller proportion of outdoor activity time, with statistically significant differences (all P<0.05).During weekdays, after adjusting for confounding factors, longer single continuous near eye use duration ( OR=1.138, 95% CI: 1.086-1.192, P<0.001) was the risk factor for myopia, and longer working distance ( OR=0.906, 95% CI: 0.847-0.970, P=0.004) and longer outdoor activity time ( OR=0.127, 95% CI: 0.023-0.703, P=0.018) were protective factors for myopia.During weekends, after adjusting for confounding factors, longer time spent on looking at cell phone screens ( OR=2.437, 95% CI: 1.460-4.068, P<0.001) and longer time spent on looking at computer screens ( OR=2.260, 95% CI: 1.283-3.979, P=0.005) were risk factors for myopia, and longer outdoor activity time ( OR=0.624, 95% CI: 0.416-0.934, P=0.022) was the protective factor for myopia. Conclusions:The eyes with continuous near work, prolonged use of smartphone and computer screens, closer eye use distance, and less time spent outdoors have been confirmed to be significantly correlated with myopia based on objective monitoring data.When formulating intervention measures for myopia prevention and control in children, it is advocated to further pay attention to control the distance and duration of near work on weekdays and strengthen screen time management on weekends.
4.Two cases of developmental and epileptic encephalopathy related to the EEF1A2 gene and a literature review
Yanyan GAO ; Xinna JI ; Shuo FENG ; Wanting LIU ; Jinxiao CHEN ; Shupin LI ; Huanhuan WU ; Qian CHEN
Chinese Journal of Neurology 2025;58(4):404-413
Objective:To investigate the clinical and genetic characteristics of developmental and epileptic encephalopathy related to the EEF1A2 gene. Methods:The clinical data and whole exome sequencing results of 2 patients who were diagnosed as developmental and epileptic encephalopathy related to the EEF1A2 gene in the Children′s Hospital, Capital Institute of Pediatrics in June 2016 and August 2018 were retrospectively analyzed. Relevant literatures were retrieved using " EEF1A2" and "epileptic encephalopathy" or "epilepsy" as key words in Online Mendelian Inheritance in Man, PubMed, CNKI and Wanfang databases (literatures searching from establishment of these databases to June 2024). The clinical and genetic characteristics of developmental and epileptic encephalopathy related to the EEF1A2 gene were summarized based on literature reports and the data of these 2 patients. Results:Patient 1 was a 9 months old male infant. He presented with global developmental delay. He developed myoclonic seizures at 4 months old. Valproic acid, clonazepam, topiramate and vagus nerve stimulation were all ineffective. Both of his hands had transverse palmar crease. The de novo c.364G>A variant in the EEF1A2 gene (NM_001958.3) was identified and he was diagnosed with developmental and epileptic encephalopathy related to the EEF1A2 gene. Patient 2 was a 2 years and 2 months old boy. He presented with global developmental delay. Myoclonic seizures occurred when he was 2 years and 3 months old, and various anti-epileptic drugs were ineffective. He had left eye esotropia and low muscle tone in the extremities. He died at the age of 4. The de novo c.208G>A variant in the EEF1A2 gene (NM_001958.3) was identified and he was diagnosed with developmental and epileptic encephalopathy related to the EEF1A2 gene. Eight literatures on developmental and epileptic encephalopathy related to the EEF1A2 gene (all in English) were retrieved, reporting 28 cases (totally 30 patients, including 2 cases in this study). The main clinical manifestations were psychomotor developmental delay (30/30, 100.0%), facial dysmorphism (15/30, 50.0%), refractory epilepsy (14/26, 53.8%), myoclonic seizures (19/26, 73.1%), and movement disorders (8/16). A total of 15 mutation sites in the EEF1A2 gene were reported, all of which were missense mutations. Conclusions:Developmental and epileptic encephalopathy related to the EEF1A2 gene is primarily characterized by delayed psychomotor development, distinctive facial features, drug-resistant epilepsy, myoclonic seizures, and movement disorders. Variants in the EEF1A2 gene are predominantly missense mutations, and identifying these variants plays a crucial role in accurate diagnosis of the disease.
5.The impact and potential mechanisms of Sorbs2 on the progression of ventricular arrhythmias in mice
Xiaolu ZHANG ; Fan YANG ; Huanhuan LIU ; Tianpeng WEI ; Yufei DAI ; Lei ZHANG ; Lingling QIAN ; Ruxing WANG
Chinese Journal of Cardiology 2025;53(8):922-930
Objective:To investigate the impact and potential mechanisms of Sorbin and SH3 domain-containing protein 2 (Sorbs2) on ventricular arrhythmias in mice.Methods:In the animal experiments, mating was performed using six 8-week-old Sorbs2 +/- mice (3 males and 3 females) weighing 20-22 g. Wild-type (Sorbs2 +/+, n=8) and homozygous (Sorbs2 -/-, n=6) offspring were selected as experimental subjects through genotyping. Echocardiography was performed at 16 weeks of age to record cardiac function parameters in both groups. Resting-state and caffeine-dobutamine-induced electrocardiograms were also conducted. Real-time quantitative reverse transcription polymerase chain reaction was used to detect Sorbs2 messenger RNA expression in the heart, liver, spleen, lung, kidney, brain, small intestine, and skeletal muscle tissues of wild-type mice. Western blotting was employed to measure the protein expression levels of Sorbs2 and voltage-dependent sodium channel alpha subunit 1.5 (Na v1.5) in myocardial tissues from both groups. In the cell experiments, H9C2 cells were transfected with Sorbs2 small interfering RNA as the si-Sorbs2 group, with a corresponding si-negative control group established. Western blot was performed to detect the protein expression levels of Sorbs2 and Na v1.5 in both groups. Results:Sorbs2 was abundantly expressed in cardiac tissue. Compared with wild-type mice, homozygous mice exhibited larger left ventricular end-systolic diameter, along with lower left ventricular ejection fraction and fractional shortening ( P all<0.05). Resting-state electrocardiograms revealed no spontaneous arrhythmias in either group; however, homozygous mice showed shorter RR intervals but longer QRS and QTc intervals versus wild-type mice ( P all<0.05). Following caffeine and dobutamine induction, homozygous mice demonstrated a higher incidence of ventricular arrhythmias, longer arrhythmia duration, and higher ventricular arrhythmia scores than wild-type mice ( P all<0.05). Western blot analysis revealed that Na v1.5 protein expression was markedly lower in myocardial tissues of homozygous mice compared to wild-type mice. Similarly, si-Sorbs2-transfected H9C2 cells exhibited lower Na v1.5 protein levels compared to the si-negative control group ( P<0.05). Conclusion:Sorbs2 plays a critical role in maintaining normal cardiac electrophysiological function. Deficiency of Sorbs2 may lead to impaired cardiac function and increased susceptibility to ventricular arrhythmias in mice, which could be associated with reduced expression of Na v1.5 protein.
6.Emergency medical response strategy for the 2025 Dingri, Tibet Earthquake
Chenggong HU ; Xiaoyang DONG ; Hai HU ; Hui YAN ; Yaowen JIANG ; Qian HE ; Chang ZOU ; Si ZHANG ; Wei DONG ; Yan LIU ; Huanhuan ZHONG ; Ji DE ; Duoji MIMA ; Jin YANG ; Qiongda DAWA ; Lü ; JI ; La ZHA ; Qiongda JIBA ; Lunxu LIU ; Lei CHEN ; Dong WU
Chinese Journal of Clinical Thoracic and Cardiovascular Surgery 2025;32(04):421-426
This paper systematically summarizes the practical experience of the 2025 Dingri earthquake emergency medical rescue in Tibet. It analyzes the requirements for earthquake medical rescue under conditions of high-altitude hypoxia, low temperature, and low air pressure. The paper provides a detailed discussion on the strategic layout of earthquake medical rescue at the national level, local government level, and through social participation. It covers the construction of rescue organizational systems, technical systems, material support systems, and information systems. The importance of building rescue teams is emphasized. In high-altitude and cold conditions, rapid response, scientific decision-making, and multi-party collaboration are identified as key elements to enhance rescue efficiency. By optimizing rescue organizational structures, strengthening the development of new equipment, and promoting telemedicine technologies, the precision and effectiveness of medical rescue can be significantly improved, providing important references for future similar disaster rescues.
7.Distribution of pupil diameter and its association with myopia in school age children
Chinese Journal of School Health 2025;46(8):1194-1197
Objective:
To investigate the distribution of pupil diameter and its association with myopia in school age children, providing ideas into the mechanisms of the role of pupil diameter in the onset and development of myopia.
Methods:
Adopting a combination of stratified cluster random sampling and convenience sampling method, 3 839 children from six schools in Shandong Province were included in September 2021. Pupil diameters distribution was analyzed by age, sex, and myopic status. Pearson correlation analysis was used to assess the relationship between pupil diameter and cycloplegic spherical equivalent (SE), as well as axial length (AL) and other variables. Propensity score matching (PSM) was applied to match myopic and non myopic children at a 1∶1 ratio based on age and sex. A generalized linear model (GLM) was constructed with pupil diameter as the dependent variable to identify independent factors influencing pupil size and its association with myopia.
Results:
The mean pupil diameter of school age children was (5.77±0.80)mm. Pupil diameter exhibited a significant increasing trend with age ( F =49.34, P trend < 0.01). Myopic children had a significantly larger mean pupil diameter [(6.10±0.73)mm] compared to non myopic children [(5.62±0.79)mm] with a statistically significant difference( t=18.10, P <0.01). Multivariable GLM analysis, adjusted for age, amplitude of accommodation, and uncorrected visual acuity, revealed a negative correlation between pupil diameter and cycloplegic SE (before PSM: β =-0.089, after PSM: β =-0.063, both P <0.01).
Conclusions
Myopic school age children exhibite larger pupil diameters than their non myopic counterparts. Pupil diameter may serve as a potential indicator for monitoring myopia development in school age children.
8.Role and mechanism of tigecycline in delaying the resistance of Klebsiella pneumoniae to polymyxin B by inhibiting cpxR
Huanhuan ZHANG ; Wei FENG ; Shangjun HUA ; Yan QIAN
Journal of Army Medical University 2025;47(12):1401-1412,封3
Objective To investigate the effect of polymyxin B(PMB)combined with tigecycline(TGC)on delaying Klebsiella pneumoniae(KP)resistance to PMB,and to analyze the possible mechanisms involved in the induction and delay of resistance.Methods Six clinical isolates of KP strains from the Intensive Care Unit of First Affiliated Hospital of Army Medical University were subjected and then induced with PMB at 1/2 minimal inhibitory concentration(MIC)alone or combined with TGC at 1/2 and 1/4 MIC,respectively.The MIC changes of PMB in these strains were monitored over 14 consecutive passages.The strain 686K,which showed the most significant delay in resistance,was selected for further analysis.Differences in gene and protein expression were examined among the wild-type strain 686K,PMB-induced resistant strain(686K·R),and PMB combined with TGC delayed resistant strain(686K·DR)using transcriptome sequencing,qRT-PCR,and proteomics.Relevant target genes during the delay of resistance were analyzed through literature and bioinformatics analyses.Additionally,cpxR gene knockout strain 686K/ΔcpxR∷Apr and its complementation strain 686K/ΔcpxR∷Apr/pRK415-cpxR were constructed using homologous recombination technology to assess the expression levels of resistance-related genes and changes in MIC after induction in vitro.Results Under sub-MIC(1/2)PMB alone,resistance developed in all 6 KP strains within 2 d,while,the combination with TGC significantly delayed the development of resistance.Transcriptomic and proteomic analyses indicated that in strain 686K·R,the expression levels of the PhoP/Q two-component system,lipopolysaccharide(LPS)modification enzymes,and efflux pump systems were significantly up-regulated(|Log2FC|≥2,P<0.0001),while TGC co-administration markedly inhibited these expression changes.The cpxR deletion and complementation strains were successfully constructed.The expression levels of resistance-related genes phoP,pmrD,and acrA were decreased in the cpxR deletion strain(P<0.001),and the resistance was delayed until day 6 under PMB monotherapy,whereas the complementation strain restored the resistance phenotype by day 2.In the absence of cpxR,the effect of PMB when combined with TGC on delaying resistance did not differ from that observed with PMB monotherapy.Conclusion The combination of PMB and TGC can delay KP resistance to PMB.cpxR,as a critical regulatory factor,can impact PMB resistance by modulating LPS modifications and the expression of the AcrAB-TolC efflux pump,and plays an important regulatory role in the process of resistance induction.
9.Real-world efficacy and safety of azvudine in hospitalized older patients with COVID-19 during the omicron wave in China: A retrospective cohort study.
Yuanchao ZHU ; Fei ZHAO ; Yubing ZHU ; Xingang LI ; Deshi DONG ; Bolin ZHU ; Jianchun LI ; Xin HU ; Zinan ZHAO ; Wenfeng XU ; Yang JV ; Dandan WANG ; Yingming ZHENG ; Yiwen DONG ; Lu LI ; Shilei YANG ; Zhiyuan TENG ; Ling LU ; Jingwei ZHU ; Linzhe DU ; Yunxin LIU ; Lechuan JIA ; Qiujv ZHANG ; Hui MA ; Ana ZHAO ; Hongliu JIANG ; Xin XU ; Jinli WANG ; Xuping QIAN ; Wei ZHANG ; Tingting ZHENG ; Chunxia YANG ; Xuguang CHEN ; Kun LIU ; Huanhuan JIANG ; Dongxiang QU ; Jia SONG ; Hua CHENG ; Wenfang SUN ; Hanqiu ZHAN ; Xiao LI ; Yafeng WANG ; Aixia WANG ; Li LIU ; Lihua YANG ; Nan ZHANG ; Shumin CHEN ; Jingjing MA ; Wei LIU ; Xiaoxiang DU ; Meiqin ZHENG ; Liyan WAN ; Guangqing DU ; Hangmei LIU ; Pengfei JIN
Acta Pharmaceutica Sinica B 2025;15(1):123-132
Debates persist regarding the efficacy and safety of azvudine, particularly its real-world outcomes. This study involved patients aged ≥60 years who were admitted to 25 hospitals in mainland China with confirmed SARS-CoV-2 infection between December 1, 2022, and February 28, 2023. Efficacy outcomes were all-cause mortality during hospitalization, the proportion of patients discharged with recovery, time to nucleic acid-negative conversion (T NANC), time to symptom improvement (T SI), and time of hospital stay (T HS). Safety was also assessed. Among the 5884 participants identified, 1999 received azvudine, and 1999 matched controls were included after exclusion and propensity score matching. Azvudine recipients exhibited lower all-cause mortality compared with controls in the overall population (13.3% vs. 17.1%, RR, 0.78; 95% CI, 0.67-0.90; P = 0.001) and in the severe subgroup (25.7% vs. 33.7%; RR, 0.76; 95% CI, 0.66-0.88; P < 0.001). A higher proportion of patients discharged with recovery, and a shorter T NANC were associated with azvudine recipients, especially in the severe subgroup. The incidence of adverse events in azvudine recipients was comparable to that in the control group (2.3% vs. 1.7%, P = 0.170). In conclusion, azvudine showed efficacy and safety in older patients hospitalized with COVID-19 during the SARS-CoV-2 omicron wave in China.
10.Analysis of clinical characteristics and etiologies of hospitalized patients with spike-and-wave activation in sleep
Yanyan GAO ; Xinna JI ; Shuo FENG ; Wanting LIU ; Jinxiao CHEN ; Shupin LI ; Huanhuan WU ; Qian CHEN
Chinese Journal of Applied Clinical Pediatrics 2025;40(6):426-433
Objective:To investigate the clinical features and etiologies of hospitalized patients with spike-and-wave activation in sleep(SWAS).Methods:Case-series study.The clinical features and etiologies of patients diagnosed with SWAS in the Department of Neurology, Capital Center for Children′s Health, Capital Medical University from September 2016 to March 2023 were retrospectively analyzed.The measurement data were analyzed by normality testing, and those conforming to the normal distribution were characterized by Mean± SD deviation.After the homogeneity test of variance, either the independent sample t test or the completely random analysis of variance (ANOVA) was employed for data comparison between groups.If the results of ANOVA were statistically significant, the LSD test was utilized for pairwise comparison. Results:(1)Basic data: a total of 140 patients with SWAS were included, with the onset age of (7.4±2.1) years.There were 134 cases (134/140, 95.7%) complicated by epilepsy, and the age of epilepsy onset was (5.3±2.2) years.Seventy-four cases (74/137, 54.0%) had self-limited epilepsy and centrotemporal spikes.Twenty-one cases (21/137, 15.3%) had epileptic encephalopathy and SWAS.Eight cases (8/137, 5.8%) had developmental and epileptic encephalopathy and SWAS.Pulse Methylprednisolone therapy, Clonazepam or Clobazam, callosotomy, and left temporo-parietal-occipital craniotomy for epileptogenic lesion resection were effective in 20 cases (20/32, 62.5%), 3 cases (3/13, 23.1%), 1 case (1/2, 50.0%) and 1 case, respectively.One patient achieved development improvement and a decrease in discharge index after vagus nerve stimulation.(2) Etiologies: ①Genetic etiology: 6 patients carried pathogenic or suspected pathogenic mutations, including GRIN2A (c.87_106dupGGGTCCCCCCGCGCTAAATA/p.I36Rfs*6), GRIN2A (c.2069C>T/p.T690M), CREBBP (c.4844A>G/p.N1615S), KAT6A(c.2203C>T/p.R735X), GRIN1 (c.2326_2327insACCTCT-GGAAGCAGAACGTCTCCCTGTCCA/p.S775_I776insNLWKQNVSLS) and MECP2 (c.916C>T/p.R306C).Among them, there were no reports on the association of CREBBP and KAT6A with SWAS.②Structural etiology: there were 7 cases with perinatal brain injury and 1 case with bilateral temporo-parietal gyrus.③Metabolic etiology: 1 patient with cerebrotendinous xanthomatosis carried the pathogenic gene CYP27A1 (c.379C>T/p.R127W, c.1415G>C/p.G472A), which was not related to SWAS.④Infectious etiology: 1 case had congenital cytomegalovirus infection.⑤ Immune etiology: 1 case had autoimmune encephalitis.⑥ There were 123 cases with unknown etiologies.(3) Etiologies and clinical characteristics: SWAS occurred earlier in patients with structural etiology than that in patients with unknown etiologies ( F=4.478, P<0.05).The proportions of discharge index ≥85% ( χ2=10.079, P<0.05) and encephalopathy ( χ2=9.385, P<0.05) were higher in patients with genetic etiology than those in patients with unknown etiologies.(4) Discharge index: the patients were divided into a group with a discharge index ≥85% and a group with a discharge index < 85%.Compared with the latter group, the former group had a higher proportion of developmental retardation ( χ2=15.976, P<0.001), suffered epilepsy ( t=-3.498, P<0.05) and SWAS at a younger age ( t=-2.044, P<0.05), and used more types of antiepileptic drugs ( t=2.079, P<0.05).(5) Neurodevelopmental outcomes: 21 patients had neurodevelopmental disorders and 75 had normal neurodevelopment. Conclusions:There are various etiologies for encephalopathy or epilepsy complicated by SWAS.The patients with structural etiology may develop SWAS at a younger age, whereas those with a clearly identified pathogenic gene may exhibit a higher discharge index and a higher rate of encephalopathy.When patients present with encephalopathy or refractory epilepsy, surgical treatment should be considered if structural lesions are found.The proportion of developing encephalopathy in patients with a discharge index ≥85% is the same as that in patients with a discharge index <85%.However, the patients with a higher discharge index develop epilepsy and SWAS at a younger age, and are more difficult to treat.


Result Analysis
Print
Save
E-mail