Chaihu Guizhi Ganjiangtang was first recorded in the Treatise on Cold Damage （Shang Han Lun）. This prescription is composed of Bupleuri Radix， Scutellariae Radix， Cinnamomi Ramulus， Zingiberis Rhizoma， Trichosanthis Radix， Ostreae Concha， and Glycyrrhizae Radix et Rhizoma. It has the effects of soothing Lesser Yang， warming the spleen， and stimulating the generation of body fluid. It is mainly used to treat digestive tract diseases such as chronic cholecystitis （CC）， irritable bowel syndrome， and non-alcoholic fatty liver disease. Dyspepsia caused by CC presents a variety of gastrointestinal symptoms such as abdominal pain， poor appetite， postprandial fullness， aversion to greasy food， soft stool， and bitter mouth， being a type of biliary dyspepsia. In modern medicine， dyspepsia caused by CC is mainly managed by medical treatment and surgical treatment. Internal medicine mainly focuses on reducing inflammation， promoting the function of gallbladder， resolving stones， alleviating spasms， and relieving the pain for CC， demonstrating definite short-term efficacy but suffering from single effects， high recurrence rate， and poor compliance. Although surgical treatment can cure cholecystitis， it is accompanied by the increased incidence of adverse events such as abdominal pain， diarrhea， and dyspepsia. Modern clinical studies have confirmed that Chaihu Guizhi Ganjiangtang can significantly alleviate the symptoms such as abdominal pain and dyspepsia of CC patients. Pharmacological studies have found that Chaihu Guizhi Ganjiangtang mainly contains active ingredients such as Bupleuri Radix saponins， baicalin， cinnamaldehyde， gingerol， Trichosanthis Radix polysaccharide， Ostreae Concha polysaccharide， and Glycyrrhizae Radix et Rhizoma total flavonoids. Chaihu Guizhi Ganjiangtang can ameliorate the symptoms of dyspepsia caused by CC by inhibiting inflammatory responses， improving gallbladder contraction and gastrointestinal motility， regulating the bile acid-intestinal flora axis and the brain-gut axis， and modulating blood lipids through multiple targets. By reviewing the previous literature， this article summarizes the research progress in the treatment of dyspepsia caused by CC with Chaihu Guizhi Ganjiangtang and its main active ingredients as well as the pathogenesis of this disease and puts forward the shortcomings and improvement strategies for the current research. The review aims to provide a reference for the further research on Chaihu Guizhi Ganjiangtang in the treatment of dyspepsia caused by CC.

OBJECTIVE To develope a predictive model for medication deviation risks during the hospital-to-home transition period in coronary heart disease （CHD） patients with initial treatment， aiming to assist medical staff in rapidly identifying high-risk groups for medication deviation. METHODS A total of 462 CHD patients with initial treatment from the Affiliated Hospital of North China University of Science and Technology （hereinafter referred to as “our hospital”） between January and July 2024 were enrolled. The patients were randomly divided into a modeling group and an internal validation group. The modeling group was further categorized into a medication deviation group and a non-medication deviation group based on whether medication deviations occurred. Similarly， 57 CHD patients with initial treatment from the cardiology department of our hospital between June and September 2025 were collected as an external validation group. Univariate analysis was used to screen predictive factors， followed by multivariate Logistic regression to construct the predictive model. Internal validation methods were employed to evaluate model performance， while external validation methods were used to test the model’s generalizability. RESULTS The 462 patients were divided into a modeling group （319 cases） and an internal validation group （143 cases）. In the modeling group， the medication deviation group （192 cases， 60.19%） and the non-medication deviation group （127 cases， 39.81%） were identified. Multivariate Logistic regression analysis revealed that age， medication type， medication adherence， and self-efficacy in rational medication use were predictive factors for medication deviations in CHD patients with initial treatment （ P ＜0.05）. The predictive model equation was logit P ＝ln[ P /（1－ P ） ] ＝1.321+1.732×age+4.091×medication type －4.360×medication adherence －3.081×self-efficacy in rational medication use. The model demonstrated good discrimination， with a Hosmer-Lemeshow goodness-of-fit test P -value of 0.439， an area under the receiver operating characteristic curve （AUC） of 0.870， sensitivity of 0.970， and specificity of 0.607. A risk nomogram with a total score of 350 points and a cutoff value of 110 points was plotted. The internal validation group showed an AUC o f 0.787 and a prediction accuracy of 77.6%， while the external validation group exhibited an AUC of 0.802 and a prediction accuracy of 73.7%. CONCLUSIONS This study successfully developed a predictive model for medication deviation risks during the hospital-to-home transition period in CHD patients with initial treatment. The model demonstrates excellent discrimination and predictive accuracy， effectively identifying high-risk populations for medication deviations. Age （＞70 years）， number of drug types≥5， poor medication adherence， and poor self-efficacy in rational medication use are independent risk factors for medication deviations.

Under the background of the medical model shifting from biomedicine to systems medicine， the traditional Chinese medicine （TCM） concept of "treating different diseases in the same way" demonstrates unique scientific value. From the perspective of systems biology， this study proposes that "treating different diseases in the same way" is essentially "treating the disease with same mechanism in the same way"； that is， different diseases share common pathological links at levels such as neuro-endocrine-immune network homeostasis， inflammatory signaling pathways， or gut microecology. Through the application of the "same formulas" and "same medicinals"， TCM intervenes in these shared network nodes. On this basis， the modern medical value of the "treating different diseases in the same way" concept is elucidated from three dimensions including "network causality" in epistemology， "systemic modulation" in methodology， and "comorbidity management" in practice. It reveals that as a life network regulation concept based on holism， "treating different diseases in the same way" provides novel diagnostic and therapeutic strategies for complex chronic diseases and multimorbidity.

OBJECTIVE To evaluate the influence of pharmaceutical quality control on the efficiency and outcomes of standardized medication therapy management （MTM） services for patients with coronary heart disease by using Economic， Clinical and Humanistic Outcomes （ECHO） model. METHODS This study collected case data of coronary heart disease patients who received MTM services during January-March 2023 （pre-quality control implementation group， n＝96） and June-August 2023 （post-quality control implementation group， n＝164）. Using propensity score matching analysis， 80 patients were selected from each group. The study subsequently compared the economic， clinical， and humanistic outcome indicators of pharmaceutical services between the two matched groups. RESULTS There were no statistically significant differences in baseline data between the two groups after matching （P＞0.05）. Compared with pre-quality control implementation group， the daily treatment cost （16.26 yuan vs. 24.40 yuan， P＜0.001）， cost-effectiveness ratio [23.12 yuan/quality-adjusted life year （QALY） vs. 32.32 yuan/QALY， P＜0.001]， and the incidence of general adverse drug reactions （2.50% vs. 10.00%， P＝0.049） of post-quality control implementation group were decreased significantly； the utility value of the EuroQol Five-Dimensional Questionnaire （0.74± 0.06 vs. 0.71±0.07， P＝0.003）， the reduction in the number of medication related problems （1.0 vs. 0.5， P＜0.001）， the medication adherence score （[ 6.32±0.48） points vs. （6.10±0.37） points， P＝0.001]， and the satisfaction score （[ 92.56±1.52） points vs. （91.95±1.56） points， P＝0.013] all showed significant improvements. Neither group experienced serious adverse drug reactions. There was no statistically significant difference in the incidence of new adverse reactions between the two groups （1.25% vs. 3.75%， P＝0.310）. CONCLUSIONS Pharmaceutical quality control can improve the quality of pharmaceutical care， and the ECHO model can quantitatively evaluate the effect of MTM services， making pharmaceutical care better priced and more adaptable to social needs， thus being worthy of promotion.

Objective To explore the expression of pepsinogen Ⅰ/Ⅱ(PG Ⅰ/PG Ⅱ),nucleosome assembly protein 1 like protein 1(NAP1L1),and SERPINB5 in the serum of gastric cancer patients and their correlation with prognosis.Methods From February 2019 to February 2022,200 gastric cancer patients admitted to Zhuozhou Hospital were served as the gastric cancer group and another 100 patients with benign gastric lesions who received the treatment at Zhuozhou Hospital during the same period were served as the benign group,with 200 healthy adults as the control group.Chemiluminescence and ELISA methods were used to detect the serum PG Ⅰ/PG Ⅱ,NAP1L1,and SERPINB5.ROC curve was used to explore the diagnostic value.Kaplan-Meier method was used to explore the survival curve.Moreover,multivariate Cox method was used to analyze the factors that affected the prognosis.Results Compared with the control group,the benign group and gastric cancer group had the lower serum PGⅠ/PG Ⅱ and higher serum NAP1L1 and SERPINB5,and the difference was statistically significant(P<0.05).Compared with the benign group,the gastric cancer group had the lower serum PG Ⅰ/PG Ⅱ and higher serum NAP1L1 and SERPINB5,and the difference was statistically significant(P<0.05).PG Ⅰ/PG Ⅱ,NAP1L1,and SERPINB5 were all influential factors in gastric carcinogenesis(P<0.05).The AUC values of serum PG Ⅰ/PG Ⅱ,NAP1L1,and SERPINB5 alone in the diagnosis of gastric cancer were 0.821,0.808,and 0.833,respectively.The AUC of the combination of the three was 0.916,indicating that their combined diagnostic value was superior(Z=3.142,3.896,3.114,P<0.05).During the 3-year follow-up period of gastric cancer patients,57 cases died,accounting for 28.50%(57/200),and 143 cases survived.Patients with the high expression of PG Ⅰ/PG Ⅱ had a higher 3-year overall survival rate after the surgery compared to those with low expression,and the difference was statistically significant(χ2=7.830,P<0.05);and patients with the low expression of NAP1L1 and SERPINB5 had a higher 3-year overall survival rate after the surgery compared to those with high expression,and the difference was statistically significant(χ2=8.612,13.321,P<0.05).The serum PG Ⅰ/PG Ⅱ levels in the death group were lower than those in the survival group,and the serum NAP1L1,SERPINB5 levels were higher in patients with preoperative lymph node metastasis and TNM stage Ⅲ-Ⅳ than those in the survival group,and the difference was statistically significant(P<0.05).Elevated level of PG Ⅰ/PG Ⅱ was a protective factor for the prognosis of gastric cancer patients,while preoperative lymph node metastasis,elevated levels of NAP1L1 and SERPINB5 were risk factors affecting the prognosis of gastric cancer patients(P<0.05).Conclusion Serum PG Ⅰ/PG Ⅱ levels are decreased and NAP1L1 and SERPINB5 levels are increased in gastric cancer patients,and NAP1L1 and SERPINB5 are risk factors affecting the prognosis of gastric cancer patients,while PG Ⅰ/PG Ⅱ is a protective factor.

Conventional cancer therapies, such as radiotherapy and chemotherapy, often damage normal cells and may induce new tumors. Oncolytic viruses (OVs) selectively target tumor cells while sparing normal cells. Most OVs used in clinical trials have been genetically engineered to enhance their ability to target tumor cells and activate immune responses. To develop a specific OV-based approach for treating cervical cancer, this study constructed an oncolytic adenovirus that delivered a base editor targeting oncogenes to achieve efficient killing of tumor cells through inhibiting tumor growth and directly lysing tumor cells. We utilized the human telomerase reverse transcriptase (TERT) promoter to drive the expression of adenovirus early region 1A (E1A) and successfully constructed the P-hTERT-E1A-GFP vector, which was validated for its activity in cervical cancer cells. Given the critical role of the MYC oncogene in the research of oncology, identifying efficient editing sites for the MYC oncogene is a key step in this study.Three MYC-targeting gRNAs were engineered and co-delivered with ABE8e base editor plasmids into HEK293T cells. Following puromycin selection, Sanger sequencing demonstrated differential editing efficiencies: MYC-1 (43%), MYC-2 (25%), and MYC-3 (35%), identifying MYC-1 as the most efficient editing locus. By constructing the P-ABEs-hTERT-E1A-GFP and P-MYC gRNA-hTERT-E1A-GFP vectors, we successfully packaged the virus and confirmed its specificity and efficacy. The experimental results demonstrate that this novel oncolytic adenovirus effectively inhibits the growth of HeLa cells in vitro, providing new experimental evidence and potential strategies for treating cervical cancer based on the HeLa cell model.
Humans ; Uterine Cervical Neoplasms/pathology* ; Oncolytic Viruses/genetics* ; Female ; HEK293 Cells ; Oncolytic Virotherapy/methods* ; Adenoviridae/genetics* ; Gene Editing/methods* ; Telomerase/genetics* ; Adenovirus E1A Proteins/genetics* ; Genetic Vectors/genetics* ; HeLa Cells

Objective:To formulate the audit standards of Chinese patent medicine prescriptions, and provide reference for rational prescriptions of Chinese patent medicine.Methods:A three-level evidence system for prescription review of Chinese patent medicine was established according to the national regulatory documents, drug labels, relevant guidelines, and expert consensuses. The catalog of Chinese patent medicines in Army Medical Center of the People′s Liberation Army was integrated and classified, preliminary review criteria including indications, drug selection, usage and dosage, and combination drugs was established and submitted to clinical experts of traditional Chinese medicine for review and revision, and finally the prescription review standard was confirmed.Results:The Chinese patent medicine catalog of the Medical Center contained 218 drugs, which were divided into 23 kinds according to efficacy and 17 kinds according to dosage forms. The prescription review standards of Chinese patent medicine were as follows. (1) Indications: both traditional Chinese medicine and Western medicine diagnosis were required. (2) Drug selection: 37 kinds of Chinese patent medicines were marked as forbidden for pregnant women in the labels, and 16 kinds were not marked but contained forbidden ingredients; 4 kinds were marked with caution for patients with liver dysfunction, and 24 kinds were not marked but contained ingredients with caution; 2 kinds of Chinese patent medicines were marked with caution for patients with renal insufficiency, and 9 kinds were not marked but contained ingredients with caution. (3) Usage and dosage: the usage and dosage rules of Chinese patent medicines for children, the elderly and patients with liver and kidney dysfunction were formulated. (4) Combined medication: 5 and 21 kinds of Chinese patent medicines were marked as "highly toxic" and "toxic" in the labels, respectively, 11 kinds of Chinese patent medicines contained incompatible ingredients of "Shibafan" (eighteen antagonisms) and "Shijiuwei (nineteen incompatibilities), and a new review scale for repeated use of Chinese patent medicine was developed.Conclusions:Based on the existing evidence-based medicine, the evidence system of prescription review of Chinese patent medicine is established, the prescription review standards of Chinese patent medicine prescription based on the pharmaceutical interaction mode is formulated and constructed.

Objective:To analyze the correlation between near work, screen time, outdoor time and myopia in children based on objective monitoring technology and to explore the influencing factors related to myopia in children.Methods:A cross-sectional study was conducted.From October 2022 to March 2023, the purposive sampling method was used to select 596 children in Grade 2 and Grade 3 from two primary schools in Shandong Province as study subjects.Eye-Monitor technology of eye-use behavior based on artificial intelligence was used to quantify parameters of near work, screen time and outdoor time.The eye-use behavior parameters were compared within each subject and between non-myopic and myopic children on weekdays and weekends.A multivariate binary logistic regression model was constructed to analyze the influencing factors related to myopia.The study protocol was approved by the Medical Ethics Committee of the Affiliated Eye Hospital of Shandong University of Traditional Chinese Medicine (No.HEC-HY-2022023KY).Written informed consent was obtained from the legal guardian of each subject.Results:For each subject, the proportion of near work time on weekdays was greater than on weekends, the proportion of time spent looking at cell phones, computer screens, and outdoor activities was smaller, the duration of single continuous near eye use was longer, the tilt angle of the head in sitting position was greater, and the light intensity was stronger, showing statistically significant differences ( t=19.427, -9.964, -5.916, -10.470, 2.211, 2.898, 15.061; all P<0.05).During weekdays, compared with the non-myopia group, the myopia group had longer total near work duration, longer single continuous near eye use duration, shorter outdoor activity duration, closer eye use distance, larger proportion of near work time, and smaller proportion of outdoor activity time, showing statistically significant differences (all P<0.05).During weekends, compared with the non-myopia group, the myopia group had longer time spent looking at cell phones and computer screens, shorter outdoor activity time, greater proportion of time spent looking at cell phones and computer screens, and smaller proportion of outdoor activity time, with statistically significant differences (all P<0.05).During weekdays, after adjusting for confounding factors, longer single continuous near eye use duration ( OR=1.138, 95% CI: 1.086-1.192, P<0.001) was the risk factor for myopia, and longer working distance ( OR=0.906, 95% CI: 0.847-0.970, P=0.004) and longer outdoor activity time ( OR=0.127, 95% CI: 0.023-0.703, P=0.018) were protective factors for myopia.During weekends, after adjusting for confounding factors, longer time spent on looking at cell phone screens ( OR=2.437, 95% CI: 1.460-4.068, P<0.001) and longer time spent on looking at computer screens ( OR=2.260, 95% CI: 1.283-3.979, P=0.005) were risk factors for myopia, and longer outdoor activity time ( OR=0.624, 95% CI: 0.416-0.934, P=0.022) was the protective factor for myopia. Conclusions:The eyes with continuous near work, prolonged use of smartphone and computer screens, closer eye use distance, and less time spent outdoors have been confirmed to be significantly correlated with myopia based on objective monitoring data.When formulating intervention measures for myopia prevention and control in children, it is advocated to further pay attention to control the distance and duration of near work on weekdays and strengthen screen time management on weekends.

Objective:To investigate the clinical experience and efficacy of unrelated umbilical cord blood hematopoietic stem cell transplantation (HSCT) for the treatment of congenital amegakaryocytic thrombocytopenia (CAMT).Methods:A case summary was conducted.The clinical data of 2 children with CAMT who were finally cured by unrelated umbilical cord blood HSCT in the Department of Pediatric Medicine, the First Affiliated Hospital of Zhengzhou University from March 2020 to August 2023 were retrospectively analyzed.Related studies were retrieved from databases CNKI, Wanfang and PubMed using search terms including " congenital amegakaryocytic thrombocytopenia" and " hematopoietic stem cell transplantation" from the inception to July 2024.The clinical characteristics, diagnosis and treatment processes, and prognosis of CAMT patients treated by HSCT were then summarized.Results:Both cases exhibited scattered skin haemorrhages throughout the body and carried 2 compound heterozygous mutations with pathogenicity in the MPL gene.Both patients were finally diagnosed with CAMT.Case 1 was a girl aged 3 at the time of transplantation, and case 2 was also a girl, who aged 5 at the time of transplantation.Both of them received unrelated umbilical cord blood HSCT and hematopoietic reconstruction was achieved.The time of neutrophil and platelet implantation was 21 and 40 days after transplantation in case 1, and 20 and 31 days in case 2, respectively.The chimerism rate of neutrophil implantation in both children was complete chimerism of donor cells.Implantation syndrome was detected in case 1 following transplantation.Case 2 suffered implantation syndrome, hypertensive encephalopathy, and cytomegalovirus infection following transplantation.Both children showed no graft-versus-host disease (GVHD).Both children had hematopoietic and immune reconstruction after transplantation and their primary diseases were cured.Cases 1 and 2 were followed up for more than 14 and 17 months, respectively.Both of them achieved disease-free survival during the follow up.Literature review of 26 cases with CAMT treated by HSCT, including the above-mentioned 2 cases was conducted, with an overall disease-free survival rate of 92.3%(24/26).Of 12 cases with CAMT typing, 10 were type Ⅰ and 2 were type Ⅱ.Of the 26 cases treated by HSCT, 17 had bone marrow HSCT, with an overall survival rate of 88.2%(15/17), and 2 had peripheral blood HSCT.Seven cases had umbilical cord blood HSCT (6 cases receiving unrelated umbilical cord blood HSCT and 1 case receiving related umbilical cord blood HSCT), with an overall survival rate of 100%.Unlike bone marrow and peripheral blood HSCT, unrelated umbilical cord blood HSCT did not result in 3-4 grade GVHD. Conclusions:Unrelated umbilical cord blood HSCT can achieve good therapeutic effects in CAMT patients when there is no suitable donor.Myeloablative pretreatment is conducive to CAMT patients.

Objective:To investigate the clinical features and etiologies of hospitalized patients with spike-and-wave activation in sleep(SWAS).Methods:Case-series study.The clinical features and etiologies of patients diagnosed with SWAS in the Department of Neurology, Capital Center for Children′s Health, Capital Medical University from September 2016 to March 2023 were retrospectively analyzed.The measurement data were analyzed by normality testing, and those conforming to the normal distribution were characterized by Mean± SD deviation.After the homogeneity test of variance, either the independent sample t test or the completely random analysis of variance (ANOVA) was employed for data comparison between groups.If the results of ANOVA were statistically significant, the LSD test was utilized for pairwise comparison. Results:(1)Basic data: a total of 140 patients with SWAS were included, with the onset age of (7.4±2.1) years.There were 134 cases (134/140, 95.7%) complicated by epilepsy, and the age of epilepsy onset was (5.3±2.2) years.Seventy-four cases (74/137, 54.0%) had self-limited epilepsy and centrotemporal spikes.Twenty-one cases (21/137, 15.3%) had epileptic encephalopathy and SWAS.Eight cases (8/137, 5.8%) had developmental and epileptic encephalopathy and SWAS.Pulse Methylprednisolone therapy, Clonazepam or Clobazam, callosotomy, and left temporo-parietal-occipital craniotomy for epileptogenic lesion resection were effective in 20 cases (20/32, 62.5%), 3 cases (3/13, 23.1%), 1 case (1/2, 50.0%) and 1 case, respectively.One patient achieved development improvement and a decrease in discharge index after vagus nerve stimulation.(2) Etiologies: ①Genetic etiology: 6 patients carried pathogenic or suspected pathogenic mutations, including GRIN2A (c.87_106dupGGGTCCCCCCGCGCTAAATA/p.I36Rfs*6), GRIN2A (c.2069C>T/p.T690M), CREBBP (c.4844A>G/p.N1615S), KAT6A(c.2203C>T/p.R735X), GRIN1 (c.2326_2327insACCTCT-GGAAGCAGAACGTCTCCCTGTCCA/p.S775_I776insNLWKQNVSLS) and MECP2 (c.916C>T/p.R306C).Among them, there were no reports on the association of CREBBP and KAT6A with SWAS.②Structural etiology: there were 7 cases with perinatal brain injury and 1 case with bilateral temporo-parietal gyrus.③Metabolic etiology: 1 patient with cerebrotendinous xanthomatosis carried the pathogenic gene CYP27A1 (c.379C>T/p.R127W, c.1415G>C/p.G472A), which was not related to SWAS.④Infectious etiology: 1 case had congenital cytomegalovirus infection.⑤ Immune etiology: 1 case had autoimmune encephalitis.⑥ There were 123 cases with unknown etiologies.(3) Etiologies and clinical characteristics: SWAS occurred earlier in patients with structural etiology than that in patients with unknown etiologies ( F=4.478, P<0.05).The proportions of discharge index ≥85% ( χ2=10.079, P<0.05) and encephalopathy ( χ2=9.385, P<0.05) were higher in patients with genetic etiology than those in patients with unknown etiologies.(4) Discharge index: the patients were divided into a group with a discharge index ≥85% and a group with a discharge index < 85%.Compared with the latter group, the former group had a higher proportion of developmental retardation ( χ2=15.976, P<0.001), suffered epilepsy ( t=-3.498, P<0.05) and SWAS at a younger age ( t=-2.044, P<0.05), and used more types of antiepileptic drugs ( t=2.079, P<0.05).(5) Neurodevelopmental outcomes: 21 patients had neurodevelopmental disorders and 75 had normal neurodevelopment. Conclusions:There are various etiologies for encephalopathy or epilepsy complicated by SWAS.The patients with structural etiology may develop SWAS at a younger age, whereas those with a clearly identified pathogenic gene may exhibit a higher discharge index and a higher rate of encephalopathy.When patients present with encephalopathy or refractory epilepsy, surgical treatment should be considered if structural lesions are found.The proportion of developing encephalopathy in patients with a discharge index ≥85% is the same as that in patients with a discharge index <85%.However, the patients with a higher discharge index develop epilepsy and SWAS at a younger age, and are more difficult to treat.