1.Emergency medical response strategy for the 2025 Dingri, Tibet Earthquake
Chenggong HU ; Xiaoyang DONG ; Hai HU ; Hui YAN ; Yaowen JIANG ; Qian HE ; Chang ZOU ; Si ZHANG ; Wei DONG ; Yan LIU ; Huanhuan ZHONG ; Ji DE ; Duoji MIMA ; Jin YANG ; Qiongda DAWA ; Lü ; JI ; La ZHA ; Qiongda JIBA ; Lunxu LIU ; Lei CHEN ; Dong WU
Chinese Journal of Clinical Thoracic and Cardiovascular Surgery 2025;32(04):421-426
This paper systematically summarizes the practical experience of the 2025 Dingri earthquake emergency medical rescue in Tibet. It analyzes the requirements for earthquake medical rescue under conditions of high-altitude hypoxia, low temperature, and low air pressure. The paper provides a detailed discussion on the strategic layout of earthquake medical rescue at the national level, local government level, and through social participation. It covers the construction of rescue organizational systems, technical systems, material support systems, and information systems. The importance of building rescue teams is emphasized. In high-altitude and cold conditions, rapid response, scientific decision-making, and multi-party collaboration are identified as key elements to enhance rescue efficiency. By optimizing rescue organizational structures, strengthening the development of new equipment, and promoting telemedicine technologies, the precision and effectiveness of medical rescue can be significantly improved, providing important references for future similar disaster rescues.
2.Study on the Correlation between Serum NSE Levels and Recurrence after Percutaneous Balloon Compression Surgery in Patients with Trigeminal Neuralgia
Liang QI ; Wenguang LIU ; Jinyu ZHENG ; Huanhuan JI
Journal of Modern Laboratory Medicine 2025;40(2):180-185
Objective To explore the correlation between neuron specific enolase(NSE)levels and recurrence after percutaneous balloon compression(PBC)in patients with trigeminal neuralgia(TN).Methods 166 TN patients who underwent PBC at the Second People's Hospital of Huai'an City,Jiangsu Province from July 2018 to April 2021 were selected as the study subjects.According to the recurrence rate after 2 years of surgery,patients were divided into a recurrence group(n=22)and a non-recurrence group(n=144).The general information of the two groups of patients was compared,and the serum biomarker levels before and after PBC in TN patients were analyzed,as well as the postoperative efficacy of TN patients with PBC.Compared the difference changes(T2-T1)between various inflammatory markers and nerve injury markers before surgery(T1)and 2 days after surgery(T2),and perform correlation analysis(Spearman correlation and Logistic regression)between the significantly changed difference indicators and prognosis recurrence to explor the predictive value of serum NSE for recurrence after PBC in TN patients.Results The serum NSE level of TN patients on the first day of PBC was 12.39±3.15 ng/ml,were compored with those on the second day after PBC was 16.27±4.03ng/ml,and the difference was statisically significant(t=14.922,P<0.01).The difference in serum NEC levels before and after PBC in the recurrent group was 5.72(5.25,7.58)ng/ml,while the difference in serum NSE levels before and after PBC in the non-recurrent group was 3.01(2.63,3.37)ng/ml,the difference between the two groups was statistically significant(Z=3.925,P<0.001).Logistic regression results showed that the difference in serum NSE levels(T2-T1)before and after PBC was a rish factor for postoperative recurrence in TN patients at two-years(OR=1.602,Wald χ2=12.252,P<0.05).ROC analysis tesults:the predictive power of serum NSE difference(T2-T1)before and after PBC for two-year recurrence in TN patients AUC(95%CI)was 0.777(0.587~0.954),and the prediction threshold was 4ng/ml.The corresponding sensitivity and specificity was 0.727 and 0.806,respectively.Conclusion Serum NSE may become a biomarker for predicting the recurrence of TN patients after PBC treatment.
3.Study on the Correlation between Serum NSE Levels and Recurrence after Percutaneous Balloon Compression Surgery in Patients with Trigeminal Neuralgia
Liang QI ; Wenguang LIU ; Jinyu ZHENG ; Huanhuan JI
Journal of Modern Laboratory Medicine 2025;40(2):180-185
Objective To explore the correlation between neuron specific enolase(NSE)levels and recurrence after percutaneous balloon compression(PBC)in patients with trigeminal neuralgia(TN).Methods 166 TN patients who underwent PBC at the Second People's Hospital of Huai'an City,Jiangsu Province from July 2018 to April 2021 were selected as the study subjects.According to the recurrence rate after 2 years of surgery,patients were divided into a recurrence group(n=22)and a non-recurrence group(n=144).The general information of the two groups of patients was compared,and the serum biomarker levels before and after PBC in TN patients were analyzed,as well as the postoperative efficacy of TN patients with PBC.Compared the difference changes(T2-T1)between various inflammatory markers and nerve injury markers before surgery(T1)and 2 days after surgery(T2),and perform correlation analysis(Spearman correlation and Logistic regression)between the significantly changed difference indicators and prognosis recurrence to explor the predictive value of serum NSE for recurrence after PBC in TN patients.Results The serum NSE level of TN patients on the first day of PBC was 12.39±3.15 ng/ml,were compored with those on the second day after PBC was 16.27±4.03ng/ml,and the difference was statisically significant(t=14.922,P<0.01).The difference in serum NEC levels before and after PBC in the recurrent group was 5.72(5.25,7.58)ng/ml,while the difference in serum NSE levels before and after PBC in the non-recurrent group was 3.01(2.63,3.37)ng/ml,the difference between the two groups was statistically significant(Z=3.925,P<0.001).Logistic regression results showed that the difference in serum NSE levels(T2-T1)before and after PBC was a rish factor for postoperative recurrence in TN patients at two-years(OR=1.602,Wald χ2=12.252,P<0.05).ROC analysis tesults:the predictive power of serum NSE difference(T2-T1)before and after PBC for two-year recurrence in TN patients AUC(95%CI)was 0.777(0.587~0.954),and the prediction threshold was 4ng/ml.The corresponding sensitivity and specificity was 0.727 and 0.806,respectively.Conclusion Serum NSE may become a biomarker for predicting the recurrence of TN patients after PBC treatment.
4.Two cases of developmental and epileptic encephalopathy related to the EEF1A2 gene and a literature review
Yanyan GAO ; Xinna JI ; Shuo FENG ; Wanting LIU ; Jinxiao CHEN ; Shupin LI ; Huanhuan WU ; Qian CHEN
Chinese Journal of Neurology 2025;58(4):404-413
Objective:To investigate the clinical and genetic characteristics of developmental and epileptic encephalopathy related to the EEF1A2 gene. Methods:The clinical data and whole exome sequencing results of 2 patients who were diagnosed as developmental and epileptic encephalopathy related to the EEF1A2 gene in the Children′s Hospital, Capital Institute of Pediatrics in June 2016 and August 2018 were retrospectively analyzed. Relevant literatures were retrieved using " EEF1A2" and "epileptic encephalopathy" or "epilepsy" as key words in Online Mendelian Inheritance in Man, PubMed, CNKI and Wanfang databases (literatures searching from establishment of these databases to June 2024). The clinical and genetic characteristics of developmental and epileptic encephalopathy related to the EEF1A2 gene were summarized based on literature reports and the data of these 2 patients. Results:Patient 1 was a 9 months old male infant. He presented with global developmental delay. He developed myoclonic seizures at 4 months old. Valproic acid, clonazepam, topiramate and vagus nerve stimulation were all ineffective. Both of his hands had transverse palmar crease. The de novo c.364G>A variant in the EEF1A2 gene (NM_001958.3) was identified and he was diagnosed with developmental and epileptic encephalopathy related to the EEF1A2 gene. Patient 2 was a 2 years and 2 months old boy. He presented with global developmental delay. Myoclonic seizures occurred when he was 2 years and 3 months old, and various anti-epileptic drugs were ineffective. He had left eye esotropia and low muscle tone in the extremities. He died at the age of 4. The de novo c.208G>A variant in the EEF1A2 gene (NM_001958.3) was identified and he was diagnosed with developmental and epileptic encephalopathy related to the EEF1A2 gene. Eight literatures on developmental and epileptic encephalopathy related to the EEF1A2 gene (all in English) were retrieved, reporting 28 cases (totally 30 patients, including 2 cases in this study). The main clinical manifestations were psychomotor developmental delay (30/30, 100.0%), facial dysmorphism (15/30, 50.0%), refractory epilepsy (14/26, 53.8%), myoclonic seizures (19/26, 73.1%), and movement disorders (8/16). A total of 15 mutation sites in the EEF1A2 gene were reported, all of which were missense mutations. Conclusions:Developmental and epileptic encephalopathy related to the EEF1A2 gene is primarily characterized by delayed psychomotor development, distinctive facial features, drug-resistant epilepsy, myoclonic seizures, and movement disorders. Variants in the EEF1A2 gene are predominantly missense mutations, and identifying these variants plays a crucial role in accurate diagnosis of the disease.
5.Current status and influencing factors of intrinsic capacity in elderly patients with Parkinson's disease based on health ecology model
Yan ZHANG ; Fan JI ; Mengya HAN ; Xinyu ZHAO ; Ludan XU ; Huanhuan FENG ; Ping ZHUANG ; Wei SHU ; Binru HAN
Chinese Journal of Modern Nursing 2025;31(22):2962-2972
Objective:To explore the current status and influencing factors of intrinsic capacity in elderly patients with Parkinson's disease.Methods:Convenience sampling was used to select 306 elderly patients with Parkinson's disease who attended Xuanwu Hospital of Capital Medical University from March to September 2024 for the study. Influencing factors were screened based on the health ecology model. Elderly patients with Parkinson's disease were surveyed using the General Information Questionnaire, Connor-Davidson Resilience Scale, Family APGAR Scale, Social Support Rating Scale, and Intrinsic Capacity Assessment Tool. Multiple linear regression was used to analyze the factors influencing the total score and the scores of each dimension of intrinsic capacity in elderly patients with Parkinson's disease.Results:A total of 306 questionnaires were distributed and 301 valid questionnaires were recovered, with a valid recovery rate of 98.37% (301/306). The total intrinsic capacity score of 301 elderly patients with Parkinson's disease was (67.21±11.47), of which 297 elderly patients with Parkinson's disease had impaired intrinsic capacity, and the rate of impaired intrinsic capacity was 98.7% (297/301). The dimensions in descending order of impairment were motor [89.7% (270/301) ], mental [76.1% (229/301) ], sensory [70.4% (212/301) ], vitality [38.2% (115/301) ], and cognitive [25.6% (77/301) ]. Multiple linear regression analysis showed that age, Hoehn-Yahr staging, levodopa equivalent dosage, activity of daily living, history of falls, regular exercise, psychological resilience, social support, and monthly income were the factors influencing the total intrinsic capacity score of elderly patients with Parkinson's disease ( P<0.05) and heterogeneity of influencing factors in each dimension. Conclusions:Elderly patients with Parkinson's disease have a high rate of impaired intrinsic capacity, with the motor dimension being the most severely impaired. Healthcare professionals should pay attention to the assessment of the intrinsic capacity of elderly patients with Parkinson's disease, and customize interventions according to the influencing factors to promote the functioning of elderly patients so as to reduce the burden of care on families and society.
6.Analysis of clinical characteristics and etiologies of hospitalized patients with spike-and-wave activation in sleep
Yanyan GAO ; Xinna JI ; Shuo FENG ; Wanting LIU ; Jinxiao CHEN ; Shupin LI ; Huanhuan WU ; Qian CHEN
Chinese Journal of Applied Clinical Pediatrics 2025;40(6):426-433
Objective:To investigate the clinical features and etiologies of hospitalized patients with spike-and-wave activation in sleep(SWAS).Methods:Case-series study.The clinical features and etiologies of patients diagnosed with SWAS in the Department of Neurology, Capital Center for Children′s Health, Capital Medical University from September 2016 to March 2023 were retrospectively analyzed.The measurement data were analyzed by normality testing, and those conforming to the normal distribution were characterized by Mean± SD deviation.After the homogeneity test of variance, either the independent sample t test or the completely random analysis of variance (ANOVA) was employed for data comparison between groups.If the results of ANOVA were statistically significant, the LSD test was utilized for pairwise comparison. Results:(1)Basic data: a total of 140 patients with SWAS were included, with the onset age of (7.4±2.1) years.There were 134 cases (134/140, 95.7%) complicated by epilepsy, and the age of epilepsy onset was (5.3±2.2) years.Seventy-four cases (74/137, 54.0%) had self-limited epilepsy and centrotemporal spikes.Twenty-one cases (21/137, 15.3%) had epileptic encephalopathy and SWAS.Eight cases (8/137, 5.8%) had developmental and epileptic encephalopathy and SWAS.Pulse Methylprednisolone therapy, Clonazepam or Clobazam, callosotomy, and left temporo-parietal-occipital craniotomy for epileptogenic lesion resection were effective in 20 cases (20/32, 62.5%), 3 cases (3/13, 23.1%), 1 case (1/2, 50.0%) and 1 case, respectively.One patient achieved development improvement and a decrease in discharge index after vagus nerve stimulation.(2) Etiologies: ①Genetic etiology: 6 patients carried pathogenic or suspected pathogenic mutations, including GRIN2A (c.87_106dupGGGTCCCCCCGCGCTAAATA/p.I36Rfs*6), GRIN2A (c.2069C>T/p.T690M), CREBBP (c.4844A>G/p.N1615S), KAT6A(c.2203C>T/p.R735X), GRIN1 (c.2326_2327insACCTCT-GGAAGCAGAACGTCTCCCTGTCCA/p.S775_I776insNLWKQNVSLS) and MECP2 (c.916C>T/p.R306C).Among them, there were no reports on the association of CREBBP and KAT6A with SWAS.②Structural etiology: there were 7 cases with perinatal brain injury and 1 case with bilateral temporo-parietal gyrus.③Metabolic etiology: 1 patient with cerebrotendinous xanthomatosis carried the pathogenic gene CYP27A1 (c.379C>T/p.R127W, c.1415G>C/p.G472A), which was not related to SWAS.④Infectious etiology: 1 case had congenital cytomegalovirus infection.⑤ Immune etiology: 1 case had autoimmune encephalitis.⑥ There were 123 cases with unknown etiologies.(3) Etiologies and clinical characteristics: SWAS occurred earlier in patients with structural etiology than that in patients with unknown etiologies ( F=4.478, P<0.05).The proportions of discharge index ≥85% ( χ2=10.079, P<0.05) and encephalopathy ( χ2=9.385, P<0.05) were higher in patients with genetic etiology than those in patients with unknown etiologies.(4) Discharge index: the patients were divided into a group with a discharge index ≥85% and a group with a discharge index < 85%.Compared with the latter group, the former group had a higher proportion of developmental retardation ( χ2=15.976, P<0.001), suffered epilepsy ( t=-3.498, P<0.05) and SWAS at a younger age ( t=-2.044, P<0.05), and used more types of antiepileptic drugs ( t=2.079, P<0.05).(5) Neurodevelopmental outcomes: 21 patients had neurodevelopmental disorders and 75 had normal neurodevelopment. Conclusions:There are various etiologies for encephalopathy or epilepsy complicated by SWAS.The patients with structural etiology may develop SWAS at a younger age, whereas those with a clearly identified pathogenic gene may exhibit a higher discharge index and a higher rate of encephalopathy.When patients present with encephalopathy or refractory epilepsy, surgical treatment should be considered if structural lesions are found.The proportion of developing encephalopathy in patients with a discharge index ≥85% is the same as that in patients with a discharge index <85%.However, the patients with a higher discharge index develop epilepsy and SWAS at a younger age, and are more difficult to treat.
7.Analysis of clinical characteristics and etiologies of hospitalized patients with spike-and-wave activation in sleep
Yanyan GAO ; Xinna JI ; Shuo FENG ; Wanting LIU ; Jinxiao CHEN ; Shupin LI ; Huanhuan WU ; Qian CHEN
Chinese Journal of Applied Clinical Pediatrics 2025;40(6):426-433
Objective:To investigate the clinical features and etiologies of hospitalized patients with spike-and-wave activation in sleep(SWAS).Methods:Case-series study.The clinical features and etiologies of patients diagnosed with SWAS in the Department of Neurology, Capital Center for Children′s Health, Capital Medical University from September 2016 to March 2023 were retrospectively analyzed.The measurement data were analyzed by normality testing, and those conforming to the normal distribution were characterized by Mean± SD deviation.After the homogeneity test of variance, either the independent sample t test or the completely random analysis of variance (ANOVA) was employed for data comparison between groups.If the results of ANOVA were statistically significant, the LSD test was utilized for pairwise comparison. Results:(1)Basic data: a total of 140 patients with SWAS were included, with the onset age of (7.4±2.1) years.There were 134 cases (134/140, 95.7%) complicated by epilepsy, and the age of epilepsy onset was (5.3±2.2) years.Seventy-four cases (74/137, 54.0%) had self-limited epilepsy and centrotemporal spikes.Twenty-one cases (21/137, 15.3%) had epileptic encephalopathy and SWAS.Eight cases (8/137, 5.8%) had developmental and epileptic encephalopathy and SWAS.Pulse Methylprednisolone therapy, Clonazepam or Clobazam, callosotomy, and left temporo-parietal-occipital craniotomy for epileptogenic lesion resection were effective in 20 cases (20/32, 62.5%), 3 cases (3/13, 23.1%), 1 case (1/2, 50.0%) and 1 case, respectively.One patient achieved development improvement and a decrease in discharge index after vagus nerve stimulation.(2) Etiologies: ①Genetic etiology: 6 patients carried pathogenic or suspected pathogenic mutations, including GRIN2A (c.87_106dupGGGTCCCCCCGCGCTAAATA/p.I36Rfs*6), GRIN2A (c.2069C>T/p.T690M), CREBBP (c.4844A>G/p.N1615S), KAT6A(c.2203C>T/p.R735X), GRIN1 (c.2326_2327insACCTCT-GGAAGCAGAACGTCTCCCTGTCCA/p.S775_I776insNLWKQNVSLS) and MECP2 (c.916C>T/p.R306C).Among them, there were no reports on the association of CREBBP and KAT6A with SWAS.②Structural etiology: there were 7 cases with perinatal brain injury and 1 case with bilateral temporo-parietal gyrus.③Metabolic etiology: 1 patient with cerebrotendinous xanthomatosis carried the pathogenic gene CYP27A1 (c.379C>T/p.R127W, c.1415G>C/p.G472A), which was not related to SWAS.④Infectious etiology: 1 case had congenital cytomegalovirus infection.⑤ Immune etiology: 1 case had autoimmune encephalitis.⑥ There were 123 cases with unknown etiologies.(3) Etiologies and clinical characteristics: SWAS occurred earlier in patients with structural etiology than that in patients with unknown etiologies ( F=4.478, P<0.05).The proportions of discharge index ≥85% ( χ2=10.079, P<0.05) and encephalopathy ( χ2=9.385, P<0.05) were higher in patients with genetic etiology than those in patients with unknown etiologies.(4) Discharge index: the patients were divided into a group with a discharge index ≥85% and a group with a discharge index < 85%.Compared with the latter group, the former group had a higher proportion of developmental retardation ( χ2=15.976, P<0.001), suffered epilepsy ( t=-3.498, P<0.05) and SWAS at a younger age ( t=-2.044, P<0.05), and used more types of antiepileptic drugs ( t=2.079, P<0.05).(5) Neurodevelopmental outcomes: 21 patients had neurodevelopmental disorders and 75 had normal neurodevelopment. Conclusions:There are various etiologies for encephalopathy or epilepsy complicated by SWAS.The patients with structural etiology may develop SWAS at a younger age, whereas those with a clearly identified pathogenic gene may exhibit a higher discharge index and a higher rate of encephalopathy.When patients present with encephalopathy or refractory epilepsy, surgical treatment should be considered if structural lesions are found.The proportion of developing encephalopathy in patients with a discharge index ≥85% is the same as that in patients with a discharge index <85%.However, the patients with a higher discharge index develop epilepsy and SWAS at a younger age, and are more difficult to treat.
8.Current status and influencing factors of intrinsic capacity in elderly patients with Parkinson's disease based on health ecology model
Yan ZHANG ; Fan JI ; Mengya HAN ; Xinyu ZHAO ; Ludan XU ; Huanhuan FENG ; Ping ZHUANG ; Wei SHU ; Binru HAN
Chinese Journal of Modern Nursing 2025;31(22):2962-2972
Objective:To explore the current status and influencing factors of intrinsic capacity in elderly patients with Parkinson's disease.Methods:Convenience sampling was used to select 306 elderly patients with Parkinson's disease who attended Xuanwu Hospital of Capital Medical University from March to September 2024 for the study. Influencing factors were screened based on the health ecology model. Elderly patients with Parkinson's disease were surveyed using the General Information Questionnaire, Connor-Davidson Resilience Scale, Family APGAR Scale, Social Support Rating Scale, and Intrinsic Capacity Assessment Tool. Multiple linear regression was used to analyze the factors influencing the total score and the scores of each dimension of intrinsic capacity in elderly patients with Parkinson's disease.Results:A total of 306 questionnaires were distributed and 301 valid questionnaires were recovered, with a valid recovery rate of 98.37% (301/306). The total intrinsic capacity score of 301 elderly patients with Parkinson's disease was (67.21±11.47), of which 297 elderly patients with Parkinson's disease had impaired intrinsic capacity, and the rate of impaired intrinsic capacity was 98.7% (297/301). The dimensions in descending order of impairment were motor [89.7% (270/301) ], mental [76.1% (229/301) ], sensory [70.4% (212/301) ], vitality [38.2% (115/301) ], and cognitive [25.6% (77/301) ]. Multiple linear regression analysis showed that age, Hoehn-Yahr staging, levodopa equivalent dosage, activity of daily living, history of falls, regular exercise, psychological resilience, social support, and monthly income were the factors influencing the total intrinsic capacity score of elderly patients with Parkinson's disease ( P<0.05) and heterogeneity of influencing factors in each dimension. Conclusions:Elderly patients with Parkinson's disease have a high rate of impaired intrinsic capacity, with the motor dimension being the most severely impaired. Healthcare professionals should pay attention to the assessment of the intrinsic capacity of elderly patients with Parkinson's disease, and customize interventions according to the influencing factors to promote the functioning of elderly patients so as to reduce the burden of care on families and society.
9.Two cases of developmental and epileptic encephalopathy related to the EEF1A2 gene and a literature review
Yanyan GAO ; Xinna JI ; Shuo FENG ; Wanting LIU ; Jinxiao CHEN ; Shupin LI ; Huanhuan WU ; Qian CHEN
Chinese Journal of Neurology 2025;58(4):404-413
Objective:To investigate the clinical and genetic characteristics of developmental and epileptic encephalopathy related to the EEF1A2 gene. Methods:The clinical data and whole exome sequencing results of 2 patients who were diagnosed as developmental and epileptic encephalopathy related to the EEF1A2 gene in the Children′s Hospital, Capital Institute of Pediatrics in June 2016 and August 2018 were retrospectively analyzed. Relevant literatures were retrieved using " EEF1A2" and "epileptic encephalopathy" or "epilepsy" as key words in Online Mendelian Inheritance in Man, PubMed, CNKI and Wanfang databases (literatures searching from establishment of these databases to June 2024). The clinical and genetic characteristics of developmental and epileptic encephalopathy related to the EEF1A2 gene were summarized based on literature reports and the data of these 2 patients. Results:Patient 1 was a 9 months old male infant. He presented with global developmental delay. He developed myoclonic seizures at 4 months old. Valproic acid, clonazepam, topiramate and vagus nerve stimulation were all ineffective. Both of his hands had transverse palmar crease. The de novo c.364G>A variant in the EEF1A2 gene (NM_001958.3) was identified and he was diagnosed with developmental and epileptic encephalopathy related to the EEF1A2 gene. Patient 2 was a 2 years and 2 months old boy. He presented with global developmental delay. Myoclonic seizures occurred when he was 2 years and 3 months old, and various anti-epileptic drugs were ineffective. He had left eye esotropia and low muscle tone in the extremities. He died at the age of 4. The de novo c.208G>A variant in the EEF1A2 gene (NM_001958.3) was identified and he was diagnosed with developmental and epileptic encephalopathy related to the EEF1A2 gene. Eight literatures on developmental and epileptic encephalopathy related to the EEF1A2 gene (all in English) were retrieved, reporting 28 cases (totally 30 patients, including 2 cases in this study). The main clinical manifestations were psychomotor developmental delay (30/30, 100.0%), facial dysmorphism (15/30, 50.0%), refractory epilepsy (14/26, 53.8%), myoclonic seizures (19/26, 73.1%), and movement disorders (8/16). A total of 15 mutation sites in the EEF1A2 gene were reported, all of which were missense mutations. Conclusions:Developmental and epileptic encephalopathy related to the EEF1A2 gene is primarily characterized by delayed psychomotor development, distinctive facial features, drug-resistant epilepsy, myoclonic seizures, and movement disorders. Variants in the EEF1A2 gene are predominantly missense mutations, and identifying these variants plays a crucial role in accurate diagnosis of the disease.
10.Effect of sorafenib induced apoptosis and autophagy on drug resistance in HeLa cells
Kaifei YANG ; Jingge ZHU ; Yangyang ZHANG ; Junguo ZHAO ; Yuyue GAO ; Huanhuan HU ; Guojie JI
Basic & Clinical Medicine 2024;44(4):467-473
Objective To explore the effect of sorafenib on HeLa cell proliferation by inducing cell apoptosis and autophagy and its impact on drug resistance.Methods The drug-resistant cell strains were constructed through in-termittent induction method,with concentrations of 0,2.5,5.0,7.5,10.0,15.0,20.0 μmol/L.HeLa cells were incubated with increasing concentrations of sorafenib with each concentration for 1 week.The drug-resistant cell strains with stable passages were collected.MTT assay was used to detect the effect of sorafenib on cell prolifer-ation.Cell cycle distribution was analyzed by flow cytometry.The change in the expression of drug-resistant and ap-optotic genes in the parents and drug-resistant cell strains under different drug concentrations was examined by semi-quantitative PCR.The changes of apoptotic related marker proteins LC3-Ⅰ and LC3-Ⅱ were detected by Westernblot.Results Stable drug-resistant strains were successfully obtained;Drug-treated cells were more blocked in the G1 phase.In drug-resistant cells,the expression of apoptosis suppressor gene Bcl-2 was significantly decreased and the apoptotic gene Bax as well as the drug-resistant genes were all significantly increased(P<0.05).The LC3-Ⅱ/LC3-Ⅰ ratio of drug-resistant cells was significantly higher than that of parent cells(P<0.05).Conclusions Sorafenib may block the cell cycle,suppress malignant cell proliferation and promote autophage.On one hand,autophagy participates in the development of cell drug resistance and promotes cell survival.On the other hand,drug-induced autophagy may activate some of apoptotic signaling pathway in drug-resistant cells and promote the reversal of cell drug resistance.

Result Analysis
Print
Save
E-mail