1.Immunotherapy for Lung Cancer
Pei-Yang LI ; Feng-Qi LI ; Xiao-Jun HOU ; Xue-Ren LI ; Xin MU ; Hui-Min LIU ; Shou-Chun PENG
Progress in Biochemistry and Biophysics 2025;52(8):1998-2017
Lung cancer is the most common malignant tumor worldwide, ranking first in both incidence and mortality rates. According to the latest statistics from the International Agency for Research on Cancer (IARC), approximately 2.5 million new cases and around 1.8 million deaths from lung cancer occurred in 2022, placing a tremendous burden on global healthcare systems. The high mortality rate of lung cancer is closely linked to its subtle early symptoms, which often lead to diagnosis at advanced stages. This not only complicates treatment but also results in substantial economic losses. Current treatment options for lung cancer include surgery, radiotherapy, chemotherapy, targeted drug therapy, and immunotherapy. Among these, immunotherapy has emerged as the most groundbreaking advancement in recent years, owing to its unique antitumor mechanisms and impressive clinical benefits. Unlike traditional therapies such as radiotherapy and chemotherapy, immunotherapy activates or enhances the patient’s immune system to recognize and eliminate tumor cells. It offers advantages such as more durable therapeutic effects and relatively fewer toxic side effects. The main approaches to lung cancer immunotherapy include immune checkpoint inhibitors, tumor-specific antigen-targeted therapies, adoptive cell therapies, cancer vaccines, and oncolytic virus therapies. Among these, immune checkpoint inhibitors and tumor-specific antigen-targeted therapies have received approval from the U.S. Food and Drug Administration (FDA) for clinical use in lung cancer, significantly improving outcomes for patients with advanced non-small cell lung cancer. Although other immunotherapy strategies are still in clinical trials, they show great potential in improving treatment precision and efficacy. This article systematically reviews the latest research progress in lung cancer immunotherapy, including the development of novel immune checkpoint molecules, optimization of treatment strategies, identification of predictive biomarkers, and findings from recent clinical trials. It also discusses the current challenges in the field and outlines future directions, such as the development of next-generation immunotherapeutic agents, exploration of more effective combination regimens, and the establishment of precise efficacy prediction systems. The aim is to provide a valuable reference for the continued advancement of lung cancer immunotherapy.
2.Correlation between differences in starch gelatinization, water distribution, and terpenoid content during steaming process of Curcuma kwangsiensis root tubers by multivariate statistical analysis.
Yan LIANG ; Meng-Na YANG ; Xiao-Li QIN ; Zhi-Yong ZHANG ; Zhong-Nan SU ; Hou-Kang CAO ; Ke-Feng ZHANG ; Ming-Wei WANG ; Bo LI ; Shuo LI
China Journal of Chinese Materia Medica 2025;50(10):2684-2694
To elucidate the mechanism by which steaming affects the quality of Curcuma kwangsiensis root tubers, methods such as LSCM, RVA, dual-wavelength spectrophotometry, LF-NMR, and LC-MS were employed to qualitatively and quantitatively detect changes in starch gelatinization characteristics, water distribution, and material composition of C. kwangsiensis root tubers under different steaming durations. Based on multivariate statistical analysis, the correlation between differences in gelatinization parameters, water distribution, and terpenoid material composition was investigated. The results indicate that steaming affects both starch gelatinization and water distribution in C. kwangsiensis. During the steaming process, transformations occur between amylose and amylopectin, as well as between semi-bound water and free water. After 60 min of steaming, starch gelatinization and water distribution reached an equilibrium state. The content of amylopectin, the amylose-to-amylopectin ratio, and parameters such as gelatinization temperature, viscosity, breakdown value, and setback value were significantly correlated(P≤0.05). Additionally, the amylose-to-amylopectin ratio was significantly correlated with total free water and total water content(P≤0.05). Steaming induced differences in the material composition of C. kwangsiensis root tubers. Clustering of primary metabolites in the OPLS-DA model was distinct, while secondary metabolites were classified into 9 clusters using the K-means clustering algorithm. Differential terpenoid metabolites such as(-)-α-curcumene were significantly correlated with zerumbone, retinal, and all-trans-retinoic acid(P<0.05). Curcumenol was significantly correlated with isoalantolactone and ursolic acid(P<0.05), while all-trans-retinoic acid was significantly correlated with both zerumbone and retinal(P<0.05). Alpha-tocotrienol exhibited a significant correlation with retinal and all-trans-retinoic acid(P<0.05). Amylose was extremely significantly correlated with(-)-α-curcumene, curcumenol, zerumbone, retinal, all-trans-retinoic acid, and α-tocotrienol(P<0.05). Amylopectin was significantly correlated with zerumbone(P<0.05) and extremely significantly correlated with(-)-α-curcumene, curcumenol, zerumbone, retinal, all-trans-retinoic acid, and 9-cis-retinoic acid(P<0.01). The results provide scientific evidence for elucidating the mechanism of quality formation of steamed C. kwangsiensis root tubers as a medicinal material.
Curcuma/chemistry*
;
Starch/chemistry*
;
Multivariate Analysis
;
Water/chemistry*
;
Terpenes/analysis*
;
Plant Roots/chemistry*
;
Plant Tubers/chemistry*
;
Drugs, Chinese Herbal/chemistry*
3.Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood.
Juan YE ; Feng YE ; Ling HOU ; Wei WU ; Xiao-Ping LUO ; Yan LIANG
Chinese Journal of Contemporary Pediatrics 2025;27(1):94-100
OBJECTIVES:
To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.
METHODS:
A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.
RESULTS:
All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.
CONCLUSIONS
This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Male
;
Female
;
Child
;
Retrospective Studies
;
Glucokinase/genetics*
;
Adolescent
;
Child, Preschool
;
Glucose Tolerance Test
4.Multiple biomarkers risk score for accurately predicting the long-term prognosis of patients with acute coronary syndrome.
Zhi-Yong ZHANG ; Xin-Yu WANG ; Cong-Cong HOU ; Hong-Bin LIU ; Lyu LYU ; Mu-Lei CHEN ; Xiao-Rong XU ; Feng JIANG ; Long LI ; Wei-Ming LI ; Kui-Bao LI ; Juan WANG
Journal of Geriatric Cardiology 2025;22(7):656-667
BACKGROUND:
Biomarkers-based prediction of long-term risk of acute coronary syndrome (ACS) is scarce. We aim to develop a risk score integrating clinical routine information (C) and plasma biomarkers (B) for predicting long-term risk of ACS patients.
METHODS:
We included 2729 ACS patients from the OCEA (Observation of cardiovascular events in ACS patients). The earlier admitted 1910 patients were enrolled as development cohort; and the subsequently admitted 819 subjects were treated as validation cohort. We investigated 10-year risk of cardiovascular (CV) death, myocardial infarction (MI) and all cause death in these patients. Potential variables contributing to risk of clinical events were assessed using Cox regression models and a score was derived using main part of these variables.
RESULTS:
During 16,110 person-years of follow-up, there were 238 CV death/MI in the development cohort. The 7 most important predictors including in the final model were NT-proBNP, D-dimer, GDF-15, peripheral artery disease (PAD), Fibrinogen, ST-segment elevated MI (STEMI), left ventricular ejection fraction (LVEF), termed as CB-ACS score. C-index of the score for predication of cardiovascular events was 0.79 (95% CI: 0.76-0.82) in development cohort and 0.77 (95% CI: 0.76-0.78) in the validation cohort (5832 person-years of follow-up), which outperformed GRACE 2.0 and ABC-ACS risk score. The CB-ACS score was also well calibrated in development and validation cohort (Greenwood-Nam-D'Agostino: P = 0.70 and P = 0.07, respectively).
CONCLUSIONS
CB-ACS risk score provides a useful tool for long-term prediction of CV events in patients with ACS. This model outperforms GRACE 2.0 and ABC-ACS ischemic risk score.
5.NFKBIE: Novel Biomarkers for Diagnosis, Prognosis, and Immunity in Colorectal Cancer: Insights from Pan-cancer Analysis.
Chen Yang HOU ; Peng WANG ; Feng Xu YAN ; Yan Yan BO ; Zhen Peng ZHU ; Xi Ran WANG ; Shan LIU ; Dan Dan XU ; Jia Jia XIAO ; Jun XUE ; Fei GUO ; Qing Xue MENG ; Ren Sen RAN ; Wei Zheng LIANG
Biomedical and Environmental Sciences 2025;38(10):1320-1325
6.Multidisciplinary expert consensus on weight management for overweight and obese children and adolescents based on healthy lifestyle
HONG Ping, MA Yuguo, TAO Fangbiao, XU Yajun, ZHANG Qian, HU Liang, WEI Gaoxia, YANG Yuexin, QIAN Junwei, HOU Xiao, ZHANG Yimin, SUN Tingting, XI Bo, DONG Xiaosheng, MA Jun, SONG Yi, WANG Haijun, HE Gang, CHEN Runsen, LIU Jingmin, HUANG Zhijian, HU Guopeng, QIAN Jinghua, BAO Ke, LI Xuemei, ZHU Dan, FENG Junpeng, SHA Mo, Chinese Association for Student Nutrition & ; Health Promotion, Key Laboratory of Sports and Physical Fitness of the Ministry of Education,〖JZ〗 Engineering Research Center of Ministry of Education for Key Core Technical Integration System and Equipment,〖JZ〗 Key Laboratory of Exercise Rehabilitation Science of the Ministry of Education
Chinese Journal of School Health 2025;46(12):1673-1680
Abstract
In recent years, the prevalence of overweight and obesity among children and adolescents has risen rapidly, posing a serious threat to their physical and mental health. To provide scientific, systematic, and standardized weight management guidance for overweight and obese children and adolescents, the study focuses on the core concept of healthy lifestyle intervention, integrates multidisciplinary expert opinions and research findings,and proposes a comprehensive multidisciplinary intervention framework covering scientific exercise intervention, precise nutrition and diet, optimized sleep management, and standardized psychological support. It calls for the establishment of a multi agent collaborative management mechanism led by the government, implemented by families, fostered by schools, initiated by individuals, optimized by communities, reinforced by healthcare, and coordinated by multiple stakeholders. Emphasizing a child and adolescent centered approach, the consensus advocates for comprehensive, multi level, and personalized guidance strategies to promote the internalization and maintenance of a healthy lifestyle. It serves as a reference and provides recommendations for the effective prevention and control of overweight and obesity, and enhancing the health level of children and adolescents.
7.Exploring the mechanism of IgA vasculitis pathogenesis through the interaction of thrombin and inflammatory factors using urinary proteomics
Meng-Meng LIU ; Gai-Ling HOU ; Xiao-Qing YANG ; Qiu-Shuang ZHANG ; Xiao-Feng MEI ; Ying DING ; Lan SONG ; Yan-Jie HUANG
Chinese Journal of Contemporary Pediatrics 2024;26(7):683-689
Objective To explore the evidence,urinary biomarkers,and partial mechanisms of hypercoagulability in the pathogenesis of IgA vasculitis(IgAV).Methods Differential expression of proteins in the urine of 10 healthy children and 10 children with IgAV was screened using high-performance liquid chromatography-tandem mass spectrometry,followed by Reactome pathway analysis.Protein-protein interaction(PPI)network analysis was conducted using STRING and Cytoscape software.In the validation cohort,15 healthy children and 25 children with IgAV were included,and the expression levels of differential urinary proteins were verified using enzyme-linked immunosorbent assay.Results A total of 772 differential proteins were identified between the IgAV group and the control group,with 768 upregulated and 4 downregulated.Reactome pathway enrichment results showed that neutrophil degranulation,platelet activation,and hemostasis pathways were involved in the pathogenesis of IgAV.Among the differential proteins,macrophage migration inhibitory factor(MIF)played a significant role in neutrophil degranulation and hemostasis,while thrombin was a key protein in platelet activation and hemostasis pathways.PPI analysis indicated that thrombin directly interacted with several proteins involved in inflammatory responses,and these interactions involved MIF.Validation results showed that compared to healthy children,children with IgAV had significantly higher urine thrombin/creatinine and urine MIF/creatinine levels(P<0.05).Conclusions Thrombin contributes to the pathogenesis of IgAV through interactions with inflammatory factors.Urinary thrombin and MIF can serve as biomarkers reflecting the hypercoagulable and inflammatory states in children with IgAV.
8.Influence of Modified Shashen Maidong Decoction Combined with Camrelizumab Immunotherapy Plus Chemotherapy on the Efficacy,Survival Status,and Serum CYFRA21-1 and NSE Levels in Patients with Advanced Non-Small Cell Lung Cancer
Hai-Feng WANG ; Yi-Qun ZHAO ; Xiao-Li DU ; Lu LIU ; Bao-Song HOU ; Wen-Yan ZHAN
Journal of Guangzhou University of Traditional Chinese Medicine 2024;41(3):606-611
Objective To investigate the influence of modified Shashen Maidong Decoction combined with Camrelizumab immunotherapy plus chemotherapy on the efficacy,survival status and serum cytokeratin 19 fragment(CYFRA21-1)and neuron-specific enolase(NSE)levels in patients with advanced non-small cell lung cancer(NSCLC).Methods Forty patients with advanced NSCLC of lung-stomach yin deficiency with intense heat-toxin type were randomly divided into a control group and a study group,with 20 patients in each group.The patients in the control group were given Camrelizumab immunotherapy plus chemotherapy,and the patients in the study group were given modified Shashen Maidong Decoction combined with Camrelizumab immunotherapy plus chemotherapy,with 21 days as a course of treatment and for a total of 4 courses of treatment.The changes of serum NSE and CYFRA21-1 levels in the two groups before and after treatment were observed,and the clinical efficacy,survival status and the incidence of toxic and side effects were compared between the two groups.Results(1)After 4 courses of treatment,the total effective rate of the study group was 70.00%(14/20),which was significantly higher than that of the control group(9/20,45.00%),but the intergroup comparison(tested by chi-square test)showed that the difference was not statistically significant(P>0.05).(2)After 2 years of follow-up,the overall survival(OS),time to progression(TTP),and progression-free survival(PFS)of the patients in the study group were significantly prolonged compared with those in the control group(P<0.01).(3)After treatment,the serum NSE and CYFRA21-1 levels of the patients in the two groups were decreased compared with those before treatment(P<0.05),and the decrease of serum NSE and CYFRA21-1 levels in the study group was significantly superior to that in the control group(P<0.01).(4)The incidence of toxic and side effects in the study group was 25.00%(5/20),which was significantly lower than that of 65.00%(13/20)in the control group,and the intergroup comparison showed that the difference was statistically significant(P<0.05).Conclusion Modified Shashen Maidong Decoction combined with Camrelizumab immunotherapy plus chemotherapy has satisfactory therapeutic effect on patients with advanced NSCLC,which can reduce the toxic and side effects of chemotherapy,lower the level of serum tumor markers,and prolong the survival period and time to progression(TTP)of the patients.
9.Clinical and pathological characteristics as well as prognosis of adult pa-tients with chronic active Epstein-Barr virus infection
Wen-Jie ZHANG ; Qi-Ke ZHANG ; You-Fan FENG ; Feng-Lei LIU ; Jin-Xia HOU ; Xiao-Fang WEI
Chinese Journal of Infection Control 2024;23(9):1098-1105
Objective To study the clinical and pathological characteristics,as well as diagnosis,treatment methods and prognosis of adult patients with chronic active Epstein-Barr virus infection(CAEBVI).Methods Clinical and pathological data of 8 adult patients with CAEBVI admitted to a hospital in Gansu Province from January 2017 to December 2022 were collected retrospectively,clinical and histopathological characteristics,EBV-related test re-sults,as well as treatment and prognosis of patients were analyzed.Results Among 8 CAEBVI patients,3 were males and 5 were females,with the median age of 21.5 years.The median time from onset to diagnosis of CAEBVI was 7 months.The main manifestations were fever,pancytopenia(involving two or three peripheral blood lines),as well as lymph node enlargement,hepatomegaly and splenomegaly.The quantifications of plasma EBV nucleic acid(DNA)were all>1.0 × 103.The sorting results of EBV infected cells showed that 3 cases were T lymphocytes in-fection,2 were NK cell infection,and 3 were co-infection of T lymphocytes and NK cells.Bone marrow cytological examination of 8 patients showed no atypical lymphocytes,while 6 patients showed hemophagocytic cells.Flow cy-tometey(FCM)typing results showed that no abnormal cell population was detected in all the 8 patients,and no myeloid,B lymphocyte,T lymphocyte and NK cell markers were expressed.The positive rate of T cell receptor(TCR)gene rearrangement was 37.5%(n=3).Histopathology showed that most cases(n=6,75.0%)expressed CD3,partial cases expressed CD4,CD8,CD56,TIA-1,and EBV encoded RNA(EBER),all were positive.The survival rate of patients after treatment was 50.0%(n=4),the follow-up time was 6-51 months,the 1-year sur-vival rate was 85.7%,and the median survival time was 24 months.Conclusion CAEBVI is characterized by varia-ble clinical manifestations that may lead to fatal complications.Early diagnosis and individualized treatment should be performed to reduce mortality of patients.
10.Expert consensus on the diagnosis and treatment of osteoporotic proximal humeral fracture with integrated traditional Chinese and Western medicine (version 2024)
Xiao CHEN ; Hao ZHANG ; Man WANG ; Guangchao WANG ; Jin CUI ; Wencai ZHANG ; Fengjin ZHOU ; Qiang YANG ; Guohui LIU ; Zhongmin SHI ; Lili YANG ; Zhiwei WANG ; Guixin SUN ; Biao CHENG ; Ming CAI ; Haodong LIN ; Hongxing SHEN ; Hao SHEN ; Yunfei ZHANG ; Fuxin WEI ; Feng NIU ; Chao FANG ; Huiwen CHEN ; Shaojun SONG ; Yong WANG ; Jun LIN ; Yuhai MA ; Wei CHEN ; Nan CHEN ; Zhiyong HOU ; Xin WANG ; Aiyuan WANG ; Zhen GENG ; Kainan LI ; Dongliang WANG ; Fanfu FANG ; Jiacan SU
Chinese Journal of Trauma 2024;40(3):193-205
Osteoporotic proximal humeral fracture (OPHF) is one of the common osteoporotic fractures in the aged, with an incidence only lower than vertebral compression fracture, hip fracture, and distal radius fracture. OPHF, secondary to osteoporosis and characterized by poor bone quality, comminuted fracture pattern, slow healing, and severely impaired shoulder joint function, poses a big challenge to the current clinical diagnosis and treatment. In the field of diagnosis, treatment, and rehabilitation of OPHF, traditional Chinese and Western medicine have accumulated rich experience and evidence from evidence-based medicine and achieved favorable outcomes. However, there is still a lack of guidance from a relevant consensus as to how to integrate the advantages of the two medical systems and achieve the integrated diagnosis and treatment. To promote the diagnosis and treatment of OPHF with integrated traditional Chinese and Western medicine, relevant experts from Orthopedic Expert Committee of Geriatric Branch of Chinese Association of Gerontology and Geriatrics, Youth Osteoporosis Group of Orthopedic Branch of Chinese Medical Association, Osteoporosis Group of Orthopedic Surgeon Branch of Chinese Medical Doctor Association, and Osteoporosis Committee of Shanghai Association of Integrated Traditional Chinese and Western Medicine have been organized to formulate Expert consensus on the diagnosis and treatment of osteoporotic proximal humeral fracture with integrated traditional Chinese and Western medicine ( version 2024) by searching related literatures and based on the evidences from evidence-based medicine. This consensus consists of 13 recommendations about the diagnosis, treatment and rehabilitation of OPHF with integrated traditional Chinese medicine and Western medicine, aimed at standardizing, systematizing, and personalizing the diagnosis and treatment of OPHF with integrated traditional Chinse and Western medicine to improve the patients ′ function.


Result Analysis
Print
Save
E-mail