1.Determination of 238Pu,239Pu,240Pu and 241Pu in Soil by Tandem Quadrupole Inductively Coupled Plasmon-Mass Spectrometry
Yi-Chao GUO ; Chen-Yang PENG ; Xin-Yu DU ; Feng ZHANG ; Hao-Lin ZHOU ; Ke-Liang SHI ; Shan XING ; Xiao-Lin HOU
Chinese Journal of Analytical Chemistry 2025;53(3):397-406
Plutonium isotopes(238Pu,239Pu,240Pu and 241Pu)in the environment are important"fingerprint"nuclides in the study of nuclear activity traceability.The content of plutonium isotopes in the environmental metrics is usually very low,and the measurement of these isotopes,especially 238Pu,using mass spectrometry is seriously interfered with by the coexisting 238U.The analysis of several plutonium isotopes in soil usually requires combination of multiple measurement techniques,which leads to a long analysis time and large uncertainty in the isotope ratio.In this work,the hydrous titanium oxide(HTiO)precipitated by the hydrolysis of titanium oxydichloride(TiOCl2)under near-neutral condition was used to preconcentrate plutonium from the soil digestion solution,and the highly efficient decontamination of 238U in the sample was achieved by TK200 resin column chromatography with a decontamination factor of 108.Simulation resuts of density functional theory(DFT)showed that NH3 was considered as a promising reaction gas to eliminate the interference of 238U from 238Pu measurement using mass spectrometry due to the significant discrepancy of the chemical reactivity of U+and Pu+with the reactive gas NH3.Experiments confirmed that by optimizing the flow rates of collision gas(He)and reaction gas(NH3),the interference of 238U could be effectively suppressed,and the decontamination factor of 238U was 104.Combined with chemical separation,the overall decontamination factor of 238U could reach 1012 by using the developed method.By combining chemical separation and tandem quadrupole inductively coupled plasmon-mass spectrometry(ICP-MS/MS)measurement,the simultaneous determination of four ultra-trace plutonium isotopes in soil was realized,and the detection limit of plutonium isotopes was at the femtogram level.Analysis of the international standard reference materials(NIST-SRM-4357 and IAEA-384)showed that the established method could be successfully used for the accurate analysis of ultra-trace four plutonium isotopes(238Pu,239Pu,240Pu and 241Pu)in soil samples.
2.Correlation between differences in starch gelatinization, water distribution, and terpenoid content during steaming process of Curcuma kwangsiensis root tubers by multivariate statistical analysis.
Yan LIANG ; Meng-Na YANG ; Xiao-Li QIN ; Zhi-Yong ZHANG ; Zhong-Nan SU ; Hou-Kang CAO ; Ke-Feng ZHANG ; Ming-Wei WANG ; Bo LI ; Shuo LI
China Journal of Chinese Materia Medica 2025;50(10):2684-2694
To elucidate the mechanism by which steaming affects the quality of Curcuma kwangsiensis root tubers, methods such as LSCM, RVA, dual-wavelength spectrophotometry, LF-NMR, and LC-MS were employed to qualitatively and quantitatively detect changes in starch gelatinization characteristics, water distribution, and material composition of C. kwangsiensis root tubers under different steaming durations. Based on multivariate statistical analysis, the correlation between differences in gelatinization parameters, water distribution, and terpenoid material composition was investigated. The results indicate that steaming affects both starch gelatinization and water distribution in C. kwangsiensis. During the steaming process, transformations occur between amylose and amylopectin, as well as between semi-bound water and free water. After 60 min of steaming, starch gelatinization and water distribution reached an equilibrium state. The content of amylopectin, the amylose-to-amylopectin ratio, and parameters such as gelatinization temperature, viscosity, breakdown value, and setback value were significantly correlated(P≤0.05). Additionally, the amylose-to-amylopectin ratio was significantly correlated with total free water and total water content(P≤0.05). Steaming induced differences in the material composition of C. kwangsiensis root tubers. Clustering of primary metabolites in the OPLS-DA model was distinct, while secondary metabolites were classified into 9 clusters using the K-means clustering algorithm. Differential terpenoid metabolites such as(-)-α-curcumene were significantly correlated with zerumbone, retinal, and all-trans-retinoic acid(P<0.05). Curcumenol was significantly correlated with isoalantolactone and ursolic acid(P<0.05), while all-trans-retinoic acid was significantly correlated with both zerumbone and retinal(P<0.05). Alpha-tocotrienol exhibited a significant correlation with retinal and all-trans-retinoic acid(P<0.05). Amylose was extremely significantly correlated with(-)-α-curcumene, curcumenol, zerumbone, retinal, all-trans-retinoic acid, and α-tocotrienol(P<0.05). Amylopectin was significantly correlated with zerumbone(P<0.05) and extremely significantly correlated with(-)-α-curcumene, curcumenol, zerumbone, retinal, all-trans-retinoic acid, and 9-cis-retinoic acid(P<0.01). The results provide scientific evidence for elucidating the mechanism of quality formation of steamed C. kwangsiensis root tubers as a medicinal material.
Curcuma/chemistry*
;
Starch/chemistry*
;
Multivariate Analysis
;
Water/chemistry*
;
Terpenes/analysis*
;
Plant Roots/chemistry*
;
Plant Tubers/chemistry*
;
Drugs, Chinese Herbal/chemistry*
3.Multiple biomarkers risk score for accurately predicting the long-term prognosis of patients with acute coronary syndrome.
Zhi-Yong ZHANG ; Xin-Yu WANG ; Cong-Cong HOU ; Hong-Bin LIU ; Lyu LYU ; Mu-Lei CHEN ; Xiao-Rong XU ; Feng JIANG ; Long LI ; Wei-Ming LI ; Kui-Bao LI ; Juan WANG
Journal of Geriatric Cardiology 2025;22(7):656-667
BACKGROUND:
Biomarkers-based prediction of long-term risk of acute coronary syndrome (ACS) is scarce. We aim to develop a risk score integrating clinical routine information (C) and plasma biomarkers (B) for predicting long-term risk of ACS patients.
METHODS:
We included 2729 ACS patients from the OCEA (Observation of cardiovascular events in ACS patients). The earlier admitted 1910 patients were enrolled as development cohort; and the subsequently admitted 819 subjects were treated as validation cohort. We investigated 10-year risk of cardiovascular (CV) death, myocardial infarction (MI) and all cause death in these patients. Potential variables contributing to risk of clinical events were assessed using Cox regression models and a score was derived using main part of these variables.
RESULTS:
During 16,110 person-years of follow-up, there were 238 CV death/MI in the development cohort. The 7 most important predictors including in the final model were NT-proBNP, D-dimer, GDF-15, peripheral artery disease (PAD), Fibrinogen, ST-segment elevated MI (STEMI), left ventricular ejection fraction (LVEF), termed as CB-ACS score. C-index of the score for predication of cardiovascular events was 0.79 (95% CI: 0.76-0.82) in development cohort and 0.77 (95% CI: 0.76-0.78) in the validation cohort (5832 person-years of follow-up), which outperformed GRACE 2.0 and ABC-ACS risk score. The CB-ACS score was also well calibrated in development and validation cohort (Greenwood-Nam-D'Agostino: P = 0.70 and P = 0.07, respectively).
CONCLUSIONS
CB-ACS risk score provides a useful tool for long-term prediction of CV events in patients with ACS. This model outperforms GRACE 2.0 and ABC-ACS ischemic risk score.
4.Immunotherapy for Lung Cancer
Pei-Yang LI ; Feng-Qi LI ; Xiao-Jun HOU ; Xue-Ren LI ; Xin MU ; Hui-Min LIU ; Shou-Chun PENG
Progress in Biochemistry and Biophysics 2025;52(8):1998-2017
Lung cancer is the most common malignant tumor worldwide, ranking first in both incidence and mortality rates. According to the latest statistics from the International Agency for Research on Cancer (IARC), approximately 2.5 million new cases and around 1.8 million deaths from lung cancer occurred in 2022, placing a tremendous burden on global healthcare systems. The high mortality rate of lung cancer is closely linked to its subtle early symptoms, which often lead to diagnosis at advanced stages. This not only complicates treatment but also results in substantial economic losses. Current treatment options for lung cancer include surgery, radiotherapy, chemotherapy, targeted drug therapy, and immunotherapy. Among these, immunotherapy has emerged as the most groundbreaking advancement in recent years, owing to its unique antitumor mechanisms and impressive clinical benefits. Unlike traditional therapies such as radiotherapy and chemotherapy, immunotherapy activates or enhances the patient’s immune system to recognize and eliminate tumor cells. It offers advantages such as more durable therapeutic effects and relatively fewer toxic side effects. The main approaches to lung cancer immunotherapy include immune checkpoint inhibitors, tumor-specific antigen-targeted therapies, adoptive cell therapies, cancer vaccines, and oncolytic virus therapies. Among these, immune checkpoint inhibitors and tumor-specific antigen-targeted therapies have received approval from the U.S. Food and Drug Administration (FDA) for clinical use in lung cancer, significantly improving outcomes for patients with advanced non-small cell lung cancer. Although other immunotherapy strategies are still in clinical trials, they show great potential in improving treatment precision and efficacy. This article systematically reviews the latest research progress in lung cancer immunotherapy, including the development of novel immune checkpoint molecules, optimization of treatment strategies, identification of predictive biomarkers, and findings from recent clinical trials. It also discusses the current challenges in the field and outlines future directions, such as the development of next-generation immunotherapeutic agents, exploration of more effective combination regimens, and the establishment of precise efficacy prediction systems. The aim is to provide a valuable reference for the continued advancement of lung cancer immunotherapy.
5.Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood.
Juan YE ; Feng YE ; Ling HOU ; Wei WU ; Xiao-Ping LUO ; Yan LIANG
Chinese Journal of Contemporary Pediatrics 2025;27(1):94-100
OBJECTIVES:
To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.
METHODS:
A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.
RESULTS:
All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.
CONCLUSIONS
This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Male
;
Female
;
Child
;
Retrospective Studies
;
Glucokinase/genetics*
;
Adolescent
;
Child, Preschool
;
Glucose Tolerance Test
6.NFKBIE: Novel Biomarkers for Diagnosis, Prognosis, and Immunity in Colorectal Cancer: Insights from Pan-cancer Analysis.
Chen Yang HOU ; Peng WANG ; Feng Xu YAN ; Yan Yan BO ; Zhen Peng ZHU ; Xi Ran WANG ; Shan LIU ; Dan Dan XU ; Jia Jia XIAO ; Jun XUE ; Fei GUO ; Qing Xue MENG ; Ren Sen RAN ; Wei Zheng LIANG
Biomedical and Environmental Sciences 2025;38(10):1320-1325
7.Multidisciplinary expert consensus on weight management for overweight and obese children and adolescents based on healthy lifestyle
HONG Ping, MA Yuguo, TAO Fangbiao, XU Yajun, ZHANG Qian, HU Liang, WEI Gaoxia, YANG Yuexin, QIAN Junwei, HOU Xiao, ZHANG Yimin, SUN Tingting, XI Bo, DONG Xiaosheng, MA Jun, SONG Yi, WANG Haijun, HE Gang, CHEN Runsen, LIU Jingmin, HUANG Zhijian, HU Guopeng, QIAN Jinghua, BAO Ke, LI Xuemei, ZHU Dan, FENG Junpeng, SHA Mo, Chinese Association for Student Nutrition & ; Health Promotion, Key Laboratory of Sports and Physical Fitness of the Ministry of Education,〖JZ〗 Engineering Research Center of Ministry of Education for Key Core Technical Integration System and Equipment,〖JZ〗 Key Laboratory of Exercise Rehabilitation Science of the Ministry of Education
Chinese Journal of School Health 2025;46(12):1673-1680
Abstract
In recent years, the prevalence of overweight and obesity among children and adolescents has risen rapidly, posing a serious threat to their physical and mental health. To provide scientific, systematic, and standardized weight management guidance for overweight and obese children and adolescents, the study focuses on the core concept of healthy lifestyle intervention, integrates multidisciplinary expert opinions and research findings,and proposes a comprehensive multidisciplinary intervention framework covering scientific exercise intervention, precise nutrition and diet, optimized sleep management, and standardized psychological support. It calls for the establishment of a multi agent collaborative management mechanism led by the government, implemented by families, fostered by schools, initiated by individuals, optimized by communities, reinforced by healthcare, and coordinated by multiple stakeholders. Emphasizing a child and adolescent centered approach, the consensus advocates for comprehensive, multi level, and personalized guidance strategies to promote the internalization and maintenance of a healthy lifestyle. It serves as a reference and provides recommendations for the effective prevention and control of overweight and obesity, and enhancing the health level of children and adolescents.
8.Influence of Modified Shashen Maidong Decoction Combined with Camrelizumab Immunotherapy Plus Chemotherapy on the Efficacy,Survival Status,and Serum CYFRA21-1 and NSE Levels in Patients with Advanced Non-Small Cell Lung Cancer
Hai-Feng WANG ; Yi-Qun ZHAO ; Xiao-Li DU ; Lu LIU ; Bao-Song HOU ; Wen-Yan ZHAN
Journal of Guangzhou University of Traditional Chinese Medicine 2024;41(3):606-611
Objective To investigate the influence of modified Shashen Maidong Decoction combined with Camrelizumab immunotherapy plus chemotherapy on the efficacy,survival status and serum cytokeratin 19 fragment(CYFRA21-1)and neuron-specific enolase(NSE)levels in patients with advanced non-small cell lung cancer(NSCLC).Methods Forty patients with advanced NSCLC of lung-stomach yin deficiency with intense heat-toxin type were randomly divided into a control group and a study group,with 20 patients in each group.The patients in the control group were given Camrelizumab immunotherapy plus chemotherapy,and the patients in the study group were given modified Shashen Maidong Decoction combined with Camrelizumab immunotherapy plus chemotherapy,with 21 days as a course of treatment and for a total of 4 courses of treatment.The changes of serum NSE and CYFRA21-1 levels in the two groups before and after treatment were observed,and the clinical efficacy,survival status and the incidence of toxic and side effects were compared between the two groups.Results(1)After 4 courses of treatment,the total effective rate of the study group was 70.00%(14/20),which was significantly higher than that of the control group(9/20,45.00%),but the intergroup comparison(tested by chi-square test)showed that the difference was not statistically significant(P>0.05).(2)After 2 years of follow-up,the overall survival(OS),time to progression(TTP),and progression-free survival(PFS)of the patients in the study group were significantly prolonged compared with those in the control group(P<0.01).(3)After treatment,the serum NSE and CYFRA21-1 levels of the patients in the two groups were decreased compared with those before treatment(P<0.05),and the decrease of serum NSE and CYFRA21-1 levels in the study group was significantly superior to that in the control group(P<0.01).(4)The incidence of toxic and side effects in the study group was 25.00%(5/20),which was significantly lower than that of 65.00%(13/20)in the control group,and the intergroup comparison showed that the difference was statistically significant(P<0.05).Conclusion Modified Shashen Maidong Decoction combined with Camrelizumab immunotherapy plus chemotherapy has satisfactory therapeutic effect on patients with advanced NSCLC,which can reduce the toxic and side effects of chemotherapy,lower the level of serum tumor markers,and prolong the survival period and time to progression(TTP)of the patients.
9.Perilla AP2 Gene Family PfWRI1 Promotes Oil Accumulation in Plant Seeds
Xiao-Yan FENG ; Qi-Feng WANG ; Ke-Xin YUE ; Fu-Peng HOU ; Hua-Xiang XU ; Jun-Xing LU ; Jian HU ; Tao ZHANG
Chinese Journal of Biochemistry and Molecular Biology 2024;40(8):1161-1172
AP2 transcription factors belong to the AP2/ERF superfamily and are involved in the regula-tion of various biological processes in plant growth and development,as well as in response to biotic and abiotic stresses.However,studies on the AP2 transcription factor family of Perilla frutescens have not been reported.In this study,totally 18 AP2 family members were identified from the Perilla frutescens ge-nome and analyzed for gene structure,conserved motifs,and cis-acting elements using bioinformatics.WRINKLED1(WRI1)is a key regulator of lipid biosynthesis in many plant species and plays an impor-tant role in the regulation of lipid synthesis.Sequence comparison revealed that one member of WRI1 is highly homologous to AtWRI1 and contains two conserved AP2 domains,named PfWRI1.The expression levels of PfAP2 family genes were analyzed in different tissues of Perilla frutescens and at different stages of seed development in conjunction with the transcriptome data,and the results showed that PfWRI1 is highly expressed only in the seeds of Perilla frutescens,suggesting that PfWRI1 may be related to the de-velopmental process of the seeds.The overexpression vector of plant pCAMBIA1303-PfWRI1 was con-structed,and wild-type(Col)and mutant(wri1-1)Arabidopsis thaliana were transformed by Agrobacte-rium tumefaciens to obtain overexpression and complementation lines,respectively.The results showed that the expression of P fWRI1 led to an increase in oil content of Arabidopsis seeds by 8.90%-13.57%compared with Col,and promoted the accumulation of oleic acid(C18:1)and linoleic acid(18:2)and reduced the accumulation of palmitic acid(C16:0),arachidonic acid(C20:0),and cis-11-Eicosenoic acid(C20:1)in transgenic Arabidopsis seeds.In addition,PfWRI1 gene expression increased the ex-pression of glycolysis and fatty acid biosynthesis-related genes AtPKP-α,AtPKP-β1,AtBCCP2,AtSUS2,and AtLIP1.Taken together,PfWRI1 may promote lipid accumulation by increasing unsaturated fatty acid content through interaction with the above genes.
10.Functional Studies on the Regulation of Flowering by PfFT3,a Member of the Perilla PEBP Gene Family
Qi-Feng WANG ; Xiao-Yan FENG ; Hui LI ; Fu-Peng HOU ; Xi GUO ; Jun-Xing LU ; Jian HU ; Tao ZHANG
Chinese Journal of Biochemistry and Molecular Biology 2024;40(8):1173-1184
Perilla frutescens,a short-day plant,is rich in biologically active substances and nutrients.Current research on Perilla frutescens focuses on agronomic traits such as yield and fatty acid accumula-tion,with limited exploration of the flowering process and floral organ development.The molecular regu-latory mechanisms underlying these aspects remain unclear.FLOWERING LOUC T(FT)is a florigen in Arabidopsis,plays critical roles in floral transition.PfFT3 is unannotated by genome but annotated by transcriptomics data to the FT-like subfamily.Its function in controlling flowering is yet to be explored.Here subcellular localization analysis showed that PfFT3 is localized in the nucleus and cytoplasm.The plant over-expression vector pCAMBIAI1303-PfFT3 was constructed and transformed into wild-type(Col-0)and mutant fd-2,fd-3,and ft-10 plants by agrobacterium-mediated inflorescence infiltration as a means of obtaining genetically stable and pure overexpression and backfill transgenic lines in Arabidopsis,respectively.Analysis of the results showed that overexpression of PfFT3 significantly promoted early flowering in Arabidopsis and rescued the late-flowering phenotype of the mutants fd-2,fd-3,and ft-10,and that expression of the exogenous PfFT3 promoted the expression of the downstream endogenous flow-ering genes AtSOC1,AtAP1,AtFUL,and AtLFY.This study demonstrates the positive role of PfFT3 in promoting flowering,providing a foundation for further investigation of PfPEBP function and advancing the breeding of early-flowering Perilla frrutescens cultivars.


Result Analysis
Print
Save
E-mail