1.Genetic imputation of lung cancer transcriptome,proteome and multiomics illuminates new therapeutic targets
Jian-le YANG ; Ting-yang LI ; Wen-feng GOU ; Bing-xiao ZHANG ; Yi-liang LI ; Wen-bin HOU
Chinese Pharmacological Bulletin 2025;41(6):1064-1071
Aim To infer novel therapeutic and phar-macological targets related to lung cancer treatment through multiomics approaches,so as to provide new directions for developing more personalized and effec-tive treatment strategies.Methods Genome-wide as-sociation study(GWAS)data analysis,pan-cancer,single-cell,transcriptomics,and protein-protein interac-tion analysis were employed in this study.Results We analyzed biomarkers and therapeutic targets associ-ated with lung cancer.The study identified key bio-markers closely related to lung cancer progression and explored the interrelationships between these biomark-ers and viral infections.According to KEGG pathway annotation,the number of genes related to metabolic processes increased significantly.In particular,metab-olites such as alanine and isoleucine emerged as pivotal factors in therapeutic interventions.The IgD+CD24+and IgD+CD24-B cell subsets were identified as cen-tral elements in immune evasion and treatment re-sponse.Concurrently,the Lachnospiraceae and Prevo-tella were shown to modulate host immune responses and the tumor microenvironment by regulating short-chain fatty acid levels,thereby opening novel avenues for cancer research.Conclusions Through mul-tiomics analysis combined with transcriptomics and pro-teomics analysis,we identify several potential therapeu-tic targets for lung cancer,providing key insights for developing novel treatment strategies.
2.A randomized,double-blind,placebo-controlled,multicenter clinical study of Shengxuebao Mixture in treating cancer-related anemia
Zhu LIU ; Xiangrong LI ; Xiaojun DAI ; Yanjun WANG ; Xiao LI ; Keqiong WANG ; Tao WU ; Miaowen ZHONG ; Hongjiang YU ; Ji FENG ; Zuowei HU ; Kainan LI ; Shaowei CHEN ; Chunhua LI ; Zhengchuan FU ; Rui ZHANG ; Yongfa CHEN ; Hongyu XU ; Tao REN ; Yibo YAO ; Jianxu JIN ; Pengyin WANG ; Zhijiang HE ; Jian SHEN ; Lei WANG ; Min LI ; Wenming CHANG ; Xinyi CHEN ; Li HOU
Journal of Beijing University of Traditional Chinese Medicine 2025;48(10):1447-1459
Objective We aimed to evaluate the efficacy and safety of Shengxuebao Mixture in the treatment of cancer-related anemia(CRA)presenting with syndrome of deficiency of liver and kidney combined with syndrome of deficiency of both qi and blood.Methods A randomized,double-blind,placebo-controlled,multicenter clinical trial was conducted.Eligible patients with malignant tumors meeting the inclusion and exclusion criteria were enrolled from 26 hospitals,including Dongzhimen Hospital,Beijing University of Chinese Medicine,Xiaogan Central Hospital,and Yangzhou Hospital of Traditional Chinese Medicine,from June 1,2022,to September 30,2024.Patients were allocated 1:1 to either the experimental group receiving Shengxuebao Mixture or the control group receiving its simulator(placebo)using a block randomization method under double-blind conditions.Both groups received 15 mL orally three times daily for 28 consecutive days.The primary efficacy indicators included the hemoglobin(Hb)improvement rate(RHb)and the traditional Chinese medicine(TCM)syndrome improvement rate(RTCM)at week 4 of treatment.The secondary efficacy indicators encompassed Hb and red blood cell(RBC)count,Karnofsky Performance Status(KPS)score,TCM syndrome score,individual TCM symptom scores,and changes in each of these indicators compared to the baseline period at weeks 2,4,and 6 of treatment.Safety evaluations were conducted at week 4 of treatment.Results A total of 239 patients were enrolled,with 225 cases included in the Full Analysis Set(FAS)(109 in the experimental group vs.116 control group),163 in the Per Protocol Set(PPS)(77 vs.86),and 225 in the Safety Set(SS)(109 vs.116).Baseline characteristics between groups showed no significant differences.Significant differences were observed between the experimental and control groups in RHb at week 4(FAS:49.51%vs.35.24%,P<0.05;PPS:53.25%vs.36.05%,P<0.05)and RTCM at week 4(FAS:61.54%vs.39.62%,P<0.01;PPS:64.94%vs.40.70%,P<0.01).At weeks 2,4,and 6,the experimental group showed greater improvements in Hb and RBC counts than the control group.Additionally,the TCM syndrome scores were lower in the experimental group than in the control group at these time points.Except for week 2 in PPS,the KPS improvement was better in the experimental group than in the control group(P<0.05).The experimental group also demonstrated a greater reduction in scores for individual TCM symptoms such as spiritlessness and weakness,poor appetite and reduced food intake at weeks 4 and 6 compared to the control group(P<0.05,P<0.01).Furthermore,the reduction in vertigo score was more pronounced in the experimental group at week 6(P<0.01).For the score of pale and lusterless complexion,only in the PPS was the reduction from baseline more significant in the experimental group than in the control group at weeks 4 and 6(P<0.05).No significant differences were observed between the experimental and control groups in the incidence of all adverse events or drug-related adverse reactions.Conclusion Shengxuebao Mixture demonstrates significant efficacy in patients with CRA presenting syndrome of deficiency of liver and kidney combined with syndrome of deficiency of both qi and blood,effectively increasing Hb levels,ameliorating TCM syndromes,alleviating clinical symptoms,and enhancing functional status,with no significant difference in adverse drug reactions compared to the placebo.
3.A randomized,double-blind,placebo-controlled,multicenter clinical study of Shengxuebao Mixture in treating cancer-related anemia
Zhu LIU ; Xiangrong LI ; Xiaojun DAI ; Yanjun WANG ; Xiao LI ; Keqiong WANG ; Tao WU ; Miaowen ZHONG ; Hongjiang YU ; Ji FENG ; Zuowei HU ; Kainan LI ; Shaowei CHEN ; Chunhua LI ; Zhengchuan FU ; Rui ZHANG ; Yongfa CHEN ; Hongyu XU ; Tao REN ; Yibo YAO ; Jianxu JIN ; Pengyin WANG ; Zhijiang HE ; Jian SHEN ; Lei WANG ; Min LI ; Wenming CHANG ; Xinyi CHEN ; Li HOU
Journal of Beijing University of Traditional Chinese Medicine 2025;48(10):1447-1459
Objective We aimed to evaluate the efficacy and safety of Shengxuebao Mixture in the treatment of cancer-related anemia(CRA)presenting with syndrome of deficiency of liver and kidney combined with syndrome of deficiency of both qi and blood.Methods A randomized,double-blind,placebo-controlled,multicenter clinical trial was conducted.Eligible patients with malignant tumors meeting the inclusion and exclusion criteria were enrolled from 26 hospitals,including Dongzhimen Hospital,Beijing University of Chinese Medicine,Xiaogan Central Hospital,and Yangzhou Hospital of Traditional Chinese Medicine,from June 1,2022,to September 30,2024.Patients were allocated 1:1 to either the experimental group receiving Shengxuebao Mixture or the control group receiving its simulator(placebo)using a block randomization method under double-blind conditions.Both groups received 15 mL orally three times daily for 28 consecutive days.The primary efficacy indicators included the hemoglobin(Hb)improvement rate(RHb)and the traditional Chinese medicine(TCM)syndrome improvement rate(RTCM)at week 4 of treatment.The secondary efficacy indicators encompassed Hb and red blood cell(RBC)count,Karnofsky Performance Status(KPS)score,TCM syndrome score,individual TCM symptom scores,and changes in each of these indicators compared to the baseline period at weeks 2,4,and 6 of treatment.Safety evaluations were conducted at week 4 of treatment.Results A total of 239 patients were enrolled,with 225 cases included in the Full Analysis Set(FAS)(109 in the experimental group vs.116 control group),163 in the Per Protocol Set(PPS)(77 vs.86),and 225 in the Safety Set(SS)(109 vs.116).Baseline characteristics between groups showed no significant differences.Significant differences were observed between the experimental and control groups in RHb at week 4(FAS:49.51%vs.35.24%,P<0.05;PPS:53.25%vs.36.05%,P<0.05)and RTCM at week 4(FAS:61.54%vs.39.62%,P<0.01;PPS:64.94%vs.40.70%,P<0.01).At weeks 2,4,and 6,the experimental group showed greater improvements in Hb and RBC counts than the control group.Additionally,the TCM syndrome scores were lower in the experimental group than in the control group at these time points.Except for week 2 in PPS,the KPS improvement was better in the experimental group than in the control group(P<0.05).The experimental group also demonstrated a greater reduction in scores for individual TCM symptoms such as spiritlessness and weakness,poor appetite and reduced food intake at weeks 4 and 6 compared to the control group(P<0.05,P<0.01).Furthermore,the reduction in vertigo score was more pronounced in the experimental group at week 6(P<0.01).For the score of pale and lusterless complexion,only in the PPS was the reduction from baseline more significant in the experimental group than in the control group at weeks 4 and 6(P<0.05).No significant differences were observed between the experimental and control groups in the incidence of all adverse events or drug-related adverse reactions.Conclusion Shengxuebao Mixture demonstrates significant efficacy in patients with CRA presenting syndrome of deficiency of liver and kidney combined with syndrome of deficiency of both qi and blood,effectively increasing Hb levels,ameliorating TCM syndromes,alleviating clinical symptoms,and enhancing functional status,with no significant difference in adverse drug reactions compared to the placebo.
4.Immunotherapy for Lung Cancer
Pei-Yang LI ; Feng-Qi LI ; Xiao-Jun HOU ; Xue-Ren LI ; Xin MU ; Hui-Min LIU ; Shou-Chun PENG
Progress in Biochemistry and Biophysics 2025;52(8):1998-2017
Lung cancer is the most common malignant tumor worldwide, ranking first in both incidence and mortality rates. According to the latest statistics from the International Agency for Research on Cancer (IARC), approximately 2.5 million new cases and around 1.8 million deaths from lung cancer occurred in 2022, placing a tremendous burden on global healthcare systems. The high mortality rate of lung cancer is closely linked to its subtle early symptoms, which often lead to diagnosis at advanced stages. This not only complicates treatment but also results in substantial economic losses. Current treatment options for lung cancer include surgery, radiotherapy, chemotherapy, targeted drug therapy, and immunotherapy. Among these, immunotherapy has emerged as the most groundbreaking advancement in recent years, owing to its unique antitumor mechanisms and impressive clinical benefits. Unlike traditional therapies such as radiotherapy and chemotherapy, immunotherapy activates or enhances the patient’s immune system to recognize and eliminate tumor cells. It offers advantages such as more durable therapeutic effects and relatively fewer toxic side effects. The main approaches to lung cancer immunotherapy include immune checkpoint inhibitors, tumor-specific antigen-targeted therapies, adoptive cell therapies, cancer vaccines, and oncolytic virus therapies. Among these, immune checkpoint inhibitors and tumor-specific antigen-targeted therapies have received approval from the U.S. Food and Drug Administration (FDA) for clinical use in lung cancer, significantly improving outcomes for patients with advanced non-small cell lung cancer. Although other immunotherapy strategies are still in clinical trials, they show great potential in improving treatment precision and efficacy. This article systematically reviews the latest research progress in lung cancer immunotherapy, including the development of novel immune checkpoint molecules, optimization of treatment strategies, identification of predictive biomarkers, and findings from recent clinical trials. It also discusses the current challenges in the field and outlines future directions, such as the development of next-generation immunotherapeutic agents, exploration of more effective combination regimens, and the establishment of precise efficacy prediction systems. The aim is to provide a valuable reference for the continued advancement of lung cancer immunotherapy.
5.Guideline for Adult Weight Management in China
Weiqing WANG ; Qin WAN ; Jianhua MA ; Guang WANG ; Yufan WANG ; Guixia WANG ; Yongquan SHI ; Tingjun YE ; Xiaoguang SHI ; Jian KUANG ; Bo FENG ; Xiuyan FENG ; Guang NING ; Yiming MU ; Hongyu KUANG ; Xiaoping XING ; Chunli PIAO ; Xingbo CHENG ; Zhifeng CHENG ; Yufang BI ; Yan BI ; Wenshan LYU ; Dalong ZHU ; Cuiyan ZHU ; Wei ZHU ; Fei HUA ; Fei XIANG ; Shuang YAN ; Zilin SUN ; Yadong SUN ; Liqin SUN ; Luying SUN ; Li YAN ; Yanbing LI ; Hong LI ; Shu LI ; Ling LI ; Yiming LI ; Chenzhong LI ; Hua YANG ; Jinkui YANG ; Ling YANG ; Ying YANG ; Tao YANG ; Xiao YANG ; Xinhua XIAO ; Dan WU ; Jinsong KUANG ; Lanjie HE ; Wei GU ; Jie SHEN ; Yongfeng SONG ; Qiao ZHANG ; Hong ZHANG ; Yuwei ZHANG ; Junqing ZHANG ; Xianfeng ZHANG ; Miao ZHANG ; Yifei ZHANG ; Yingli LU ; Hong CHEN ; Li CHEN ; Bing CHEN ; Shihong CHEN ; Guiyan CHEN ; Haibing CHEN ; Lei CHEN ; Yanyan CHEN ; Genben CHEN ; Yikun ZHOU ; Xianghai ZHOU ; Qiang ZHOU ; Jiaqiang ZHOU ; Hongting ZHENG ; Zhongyan SHAN ; Jiajun ZHAO ; Dong ZHAO ; Ji HU ; Jiang HU ; Xinguo HOU ; Bimin SHI ; Tianpei HONG ; Mingxia YUAN ; Weibo XIA ; Xuejiang GU ; Yong XU ; Shuguang PANG ; Tianshu GAO ; Zuhua GAO ; Xiaohui GUO ; Hongyi CAO ; Mingfeng CAO ; Xiaopei CAO ; Jing MA ; Bin LU ; Zhen LIANG ; Jun LIANG ; Min LONG ; Yongde PENG ; Jin LU ; Hongyun LU ; Yan LU ; Chunping ZENG ; Binhong WEN ; Xueyong LOU ; Qingbo GUAN ; Lin LIAO ; Xin LIAO ; Ping XIONG ; Yaoming XUE
Chinese Journal of Endocrinology and Metabolism 2025;41(11):891-907
Body weight abnormalities, including overweight, obesity, and underweight, have become a dual public health challenge in Chinese adults: overweight and obesity lead to a variety of chronic complications, while underweight increases the risks of malnutrition, sarcopenia, and organ dysfunction. To systematically address these issues, multidisciplinary experts in endocrinology, sports science, nutrition, and psychiatry from various regions have held multiple weight management seminars. Based on the latest epidemiological data and clinical evidence, they expanded the guideline to include assessment and intervention strategies for underweight, in addition to the core content of obesity management. This guideline outlines the etiological mechanisms, evaluation methods, and multidimensional management strategies for overweight and obesity, covering key areas such as diagnosis and assessment, medical nutrition therapy, exercise prescription, pharmacological intervention, and psychological support. It is intended to provide a scientific and standardized approach to weight management across the adult population, aiming to curb the rising prevalence of obesity, mitigate complications associated with abnormal body weight, and improve nutritional status and overall quality of life.
6.Correlation between differences in starch gelatinization, water distribution, and terpenoid content during steaming process of Curcuma kwangsiensis root tubers by multivariate statistical analysis.
Yan LIANG ; Meng-Na YANG ; Xiao-Li QIN ; Zhi-Yong ZHANG ; Zhong-Nan SU ; Hou-Kang CAO ; Ke-Feng ZHANG ; Ming-Wei WANG ; Bo LI ; Shuo LI
China Journal of Chinese Materia Medica 2025;50(10):2684-2694
To elucidate the mechanism by which steaming affects the quality of Curcuma kwangsiensis root tubers, methods such as LSCM, RVA, dual-wavelength spectrophotometry, LF-NMR, and LC-MS were employed to qualitatively and quantitatively detect changes in starch gelatinization characteristics, water distribution, and material composition of C. kwangsiensis root tubers under different steaming durations. Based on multivariate statistical analysis, the correlation between differences in gelatinization parameters, water distribution, and terpenoid material composition was investigated. The results indicate that steaming affects both starch gelatinization and water distribution in C. kwangsiensis. During the steaming process, transformations occur between amylose and amylopectin, as well as between semi-bound water and free water. After 60 min of steaming, starch gelatinization and water distribution reached an equilibrium state. The content of amylopectin, the amylose-to-amylopectin ratio, and parameters such as gelatinization temperature, viscosity, breakdown value, and setback value were significantly correlated(P≤0.05). Additionally, the amylose-to-amylopectin ratio was significantly correlated with total free water and total water content(P≤0.05). Steaming induced differences in the material composition of C. kwangsiensis root tubers. Clustering of primary metabolites in the OPLS-DA model was distinct, while secondary metabolites were classified into 9 clusters using the K-means clustering algorithm. Differential terpenoid metabolites such as(-)-α-curcumene were significantly correlated with zerumbone, retinal, and all-trans-retinoic acid(P<0.05). Curcumenol was significantly correlated with isoalantolactone and ursolic acid(P<0.05), while all-trans-retinoic acid was significantly correlated with both zerumbone and retinal(P<0.05). Alpha-tocotrienol exhibited a significant correlation with retinal and all-trans-retinoic acid(P<0.05). Amylose was extremely significantly correlated with(-)-α-curcumene, curcumenol, zerumbone, retinal, all-trans-retinoic acid, and α-tocotrienol(P<0.05). Amylopectin was significantly correlated with zerumbone(P<0.05) and extremely significantly correlated with(-)-α-curcumene, curcumenol, zerumbone, retinal, all-trans-retinoic acid, and 9-cis-retinoic acid(P<0.01). The results provide scientific evidence for elucidating the mechanism of quality formation of steamed C. kwangsiensis root tubers as a medicinal material.
Curcuma/chemistry*
;
Starch/chemistry*
;
Multivariate Analysis
;
Water/chemistry*
;
Terpenes/analysis*
;
Plant Roots/chemistry*
;
Plant Tubers/chemistry*
;
Drugs, Chinese Herbal/chemistry*
7.Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood.
Juan YE ; Feng YE ; Ling HOU ; Wei WU ; Xiao-Ping LUO ; Yan LIANG
Chinese Journal of Contemporary Pediatrics 2025;27(1):94-100
OBJECTIVES:
To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.
METHODS:
A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.
RESULTS:
All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.
CONCLUSIONS
This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Male
;
Female
;
Child
;
Retrospective Studies
;
Glucokinase/genetics*
;
Adolescent
;
Child, Preschool
;
Glucose Tolerance Test
8.Multiple biomarkers risk score for accurately predicting the long-term prognosis of patients with acute coronary syndrome.
Zhi-Yong ZHANG ; Xin-Yu WANG ; Cong-Cong HOU ; Hong-Bin LIU ; Lyu LYU ; Mu-Lei CHEN ; Xiao-Rong XU ; Feng JIANG ; Long LI ; Wei-Ming LI ; Kui-Bao LI ; Juan WANG
Journal of Geriatric Cardiology 2025;22(7):656-667
BACKGROUND:
Biomarkers-based prediction of long-term risk of acute coronary syndrome (ACS) is scarce. We aim to develop a risk score integrating clinical routine information (C) and plasma biomarkers (B) for predicting long-term risk of ACS patients.
METHODS:
We included 2729 ACS patients from the OCEA (Observation of cardiovascular events in ACS patients). The earlier admitted 1910 patients were enrolled as development cohort; and the subsequently admitted 819 subjects were treated as validation cohort. We investigated 10-year risk of cardiovascular (CV) death, myocardial infarction (MI) and all cause death in these patients. Potential variables contributing to risk of clinical events were assessed using Cox regression models and a score was derived using main part of these variables.
RESULTS:
During 16,110 person-years of follow-up, there were 238 CV death/MI in the development cohort. The 7 most important predictors including in the final model were NT-proBNP, D-dimer, GDF-15, peripheral artery disease (PAD), Fibrinogen, ST-segment elevated MI (STEMI), left ventricular ejection fraction (LVEF), termed as CB-ACS score. C-index of the score for predication of cardiovascular events was 0.79 (95% CI: 0.76-0.82) in development cohort and 0.77 (95% CI: 0.76-0.78) in the validation cohort (5832 person-years of follow-up), which outperformed GRACE 2.0 and ABC-ACS risk score. The CB-ACS score was also well calibrated in development and validation cohort (Greenwood-Nam-D'Agostino: P = 0.70 and P = 0.07, respectively).
CONCLUSIONS
CB-ACS risk score provides a useful tool for long-term prediction of CV events in patients with ACS. This model outperforms GRACE 2.0 and ABC-ACS ischemic risk score.
9.NFKBIE: Novel Biomarkers for Diagnosis, Prognosis, and Immunity in Colorectal Cancer: Insights from Pan-cancer Analysis.
Chen Yang HOU ; Peng WANG ; Feng Xu YAN ; Yan Yan BO ; Zhen Peng ZHU ; Xi Ran WANG ; Shan LIU ; Dan Dan XU ; Jia Jia XIAO ; Jun XUE ; Fei GUO ; Qing Xue MENG ; Ren Sen RAN ; Wei Zheng LIANG
Biomedical and Environmental Sciences 2025;38(10):1320-1325
10.Multidisciplinary expert consensus on weight management for overweight and obese children and adolescents based on healthy lifestyle
HONG Ping, MA Yuguo, TAO Fangbiao, XU Yajun, ZHANG Qian, HU Liang, WEI Gaoxia, YANG Yuexin, QIAN Junwei, HOU Xiao, ZHANG Yimin, SUN Tingting, XI Bo, DONG Xiaosheng, MA Jun, SONG Yi, WANG Haijun, HE Gang, CHEN Runsen, LIU Jingmin, HUANG Zhijian, HU Guopeng, QIAN Jinghua, BAO Ke, LI Xuemei, ZHU Dan, FENG Junpeng, SHA Mo, Chinese Association for Student Nutrition & ; Health Promotion, Key Laboratory of Sports and Physical Fitness of the Ministry of Education,〖JZ〗 Engineering Research Center of Ministry of Education for Key Core Technical Integration System and Equipment,〖JZ〗 Key Laboratory of Exercise Rehabilitation Science of the Ministry of Education
Chinese Journal of School Health 2025;46(12):1673-1680
Abstract
In recent years, the prevalence of overweight and obesity among children and adolescents has risen rapidly, posing a serious threat to their physical and mental health. To provide scientific, systematic, and standardized weight management guidance for overweight and obese children and adolescents, the study focuses on the core concept of healthy lifestyle intervention, integrates multidisciplinary expert opinions and research findings,and proposes a comprehensive multidisciplinary intervention framework covering scientific exercise intervention, precise nutrition and diet, optimized sleep management, and standardized psychological support. It calls for the establishment of a multi agent collaborative management mechanism led by the government, implemented by families, fostered by schools, initiated by individuals, optimized by communities, reinforced by healthcare, and coordinated by multiple stakeholders. Emphasizing a child and adolescent centered approach, the consensus advocates for comprehensive, multi level, and personalized guidance strategies to promote the internalization and maintenance of a healthy lifestyle. It serves as a reference and provides recommendations for the effective prevention and control of overweight and obesity, and enhancing the health level of children and adolescents.


Result Analysis
Print
Save
E-mail