ObjectiveTo observe the effect of Yifei Jianpi prescription on the of signal transducer and activator of transcription protein 1 （STAT1）/interferon regulatory factor 3 （IRF3） signaling pathway in a pneumonia model induced by lipopolysaccharide （LPS） and to explore the mechanism of Yifei Jianpi prescription in improving lung immune and inflammatory responses. MethodsSixty male SPF SD rats were used in this study. Ten rats were randomly assigned to the normal control group， and the remaining 50 were instilled with LPS in the trachea to establish a pneumonia model. After successful modeling， the rats were randomly divided into the model group， dexamethasone group （0.5 mg·kg^-1）， and Yifei Jianpi prescription high-dose （12 mg·kg^-1）， medium-dose （6 mg·kg^-1）， and low-dose （3 mg·kg^-1） groups， with 10 rats in each group. Treatment was administered once daily， and the normal control and model groups received the same volume of normal saline. After 14 days， flow cytometry was used to detect the classification of whole blood lymphocytes. Enzyme-linked immunosorbent assay （ELISA） was used to measure serum levels of immunoglobulin G （IgG）， immunoglobulin A （IgA）， immunoglobulin M （IgM）， and the content of tumor necrosis factor-α （TNF-α）， interleukin-8 （IL-8）， interleukin-6 （IL-6）， and interleukin-10 （IL-10） in alveolar lavage fluid （BALF）. Hematoxylin-eosin （HE） staining was used to observe lung tissue pathology and score the damage. Thymus weight， spleen weight， and wet-to-dry weight ratio （W/D） were recorded. Real-time fluorescence quantitative polymerase chain reaction （Real-time PCR） was used to detect the mRNA expression of STAT1， IRF3， IL-6， and interferon-alpha （IFN-α） in lung tissues， while Western blot was performed to assess the protein expression of STAT1， IRF3， IL-6， and IFN-α. ResultsCompared with the normal control group， the model group showed significantly increased proportion of B lymphocytes in peripheral blood， decreased proportions of NK cells and CD4⁺/CD8⁺ （P<0.05， P<0.01）， decreased serum levels of IgG and IgA， significantly increased IgM levels （P<0.01）， significantly elevated content of TNF-α， IL-6， and IL-8 in BALF， and significantly decreased IL-10 levels （P<0.01）. Lung tissue damage was evident， with significant increases in thymus and spleen weights and a higher W/D ratio （P<0.01）. The mRNA and protein expression of STAT1， IRF3， IFN-α， and IL-6 in lung tissues was significantly upregulated （P<0.05，P<0.01）. Compared with the model group， the Yifei Jianpi prescription groups showed significantly reduced proportions of B lymphocytes in peripheral blood， increased proportions of NK cells and CD4⁺/CD8⁺ ratios （P<0.05， P<0.01）， significantly increased serum levels of IgG and IgA， significantly decreased IgM levels （P<0.05， P<0.01）， significantly reduced levels of TNF-α， IL-6， and IL-8 in BALF， and significantly increased IL-10 levels （P<0.01）. Lung tissue damage was alleviated， thymus and spleen weights were significantly reduced， and the W/D ratio was markedly decreased （P<0.01）. The mRNA and protein expression of STAT1， IRF3， IFN-α， and IL-6 in lung tissues was significantly downregulated （P<0.05， P<0.01）. ConclusionYifei Jianpi prescription can alleviate lung tissue damage and improve immune and inflammatory responses in LPS-induced pneumonia rats. The mechanism may be related to the inhibition of STAT1/IRF3 signaling pathway activation.

ObjectiveTo investigate the effect of 1，25（OH）₂D₃ on the level of peroxisome proliferator-activated receptor-γ （PPAR-γ） in the liver， the phenotype of hepatic macrophages， and liver inflammation in a rat model of nonalcoholic steatohepatitis （NASH）， as well as the mechanism of 1，25（OH）₂D₃ improving liver inflammation. MethodsAfter 1 week of adaptive feeding， 24 specific pathogen-free Wistar rats were randomly divided into normal group ［choline-supplemented L-amino acid-defined （CSAA） diet］， normal+1，25（OH）₂D₃ group ［CSAA diet+1，25（OH）₂D₃］， model group ［choline-deficient L-amino acid-defined diet （CDAA） diet］， and model+1，25（OH）₂D₃ group ［CDAA diet+1，25（OH）₂D₃］， with 6 rats in each group. The dose of 1，25（OH）₂D₃ was 5 μg/kg for intraperitoneal injection twice a week for 12 weeks. The serum levels of aspartate aminotransferase （AST） and alanine aminotransferase （ALT） were measured， liver histopathology was observed， and SAF score was assessed. M1 hepatic macrophages and M2 hepatic macrophages were measured to analyze in the change in the phenotype of hepatic macrophages， and ELISA was used to measure the levels of tumor necrosis factor-α （TNF-α）， interleukin-1β （IL-1β）， interleukin-4 （IL-4）， and interleukin-10 （IL-10） in liver tissue， and qPCR was used to measure the mRNA level of PPAR-γ. The two-factor analysis of variance was use for comparison between groups， and the least significant difference t-test was used for further comparison； the Pearson method was used for correlation analysis. ResultsCompared with the normal group， the model rats with CDAA diet-induced NASH had significant increases in the serum levels of AST and ALT （P=0.019 and P<0.001）， the SAF score of liver histopathology （P<0.001）， the level of M1 hepatic macrophages （P<0.001）， and the ratio of M1 and M2 hepatic macrophages （P<0.001）， as well as a significant increase in the level of TNF-α （P<0.001） and a significant reduction in the level of IL-4 in liver tissue （P=0.025）. The 1，25（OH）₂D₃ group had significant reductions in the serum levels of ALT （P<0.001）， the SAF score of liver histopathology （P<0.001）， the level of M1 hepatic macrophages （P<0.001）， and the ratio of M1 and M2 hepatic macrophages （P=0.001）， the level of IL-1β （P<0.001） and a significant increase in the level of M2 hepatic macrophages （P=0.017）， the level of IL-10 （P=0.039）， the level of IL-4 （P<0.001）， the level of PPAR-γ （P=0.016）. There were significant interactions between CDAA diet-induced NASH model and 1，25（OH）₂D₃ in serum the levels of AST and ALT （P=0.007 and P=0.008）， the SAF scores of liver histopathology （P<0.001）， the level of M1 hepatic macrophages （P<0.001）， the level of M2 hepatic macrophages （P=0.008）， the ratio of M1 and M2 of hepatic macrophages （P=0.005）， the level of TNF-α （P<0.001）， the level of IL-10 （P=0.038）， the level of IL-4 （P<0.001） and the level of PPAR-γ （P=0.009）. The correlation analysis showed that PPAR-γ was negatively correlated with the ratio of M1 and M2 hepatic macrophages （r=-0.415， P=0.044） and was positively correlated with M2 hepatic macrophages （r=0.435， P=0.033）， IL-10 （r=0.433， P=0.035）， and IL-4 （r=0.532， P=0.007）. ConclusionThis study shows that 1，25（OH）₂D₃ improves liver inflammation in NASH by activating PPAR-γ to regulate the phenotypic transformation of hepatic macrophages.

Background The high work intensity and possible subsequently increased susceptibility to occupational hazards of calcium carbide plants may lead to hypertension in workers, but there are few studies on the relationship between occupational hazard exposure and hypertension in workers involving the production process of calcium carbide. Objective To explore the influence of occupational hazards on the incidence of hypertension in calcium carbide plants. Methods Using historical cohort design, the employees of a calcium carbide factory in the western part of Inner Mongolia Autonomous Region were selected as research subjects. According to the pre-determined inclusion and exclusion criteria, the study population comprised an exposure group of 377 employees (including furnace workers, inspection workers, and maintenance workers) exposed to dust, noise & carbon monoxide, and a control group of 388 employees (including central control workers, electricians, and administrative personnel) without above-mentioned exposure. The total sample size was 765 participants. The follow-up period was from April 2011 to October 2022, and the study endpoint was defined as the conclusion of the follow-up period or diagnosed hypertension in annual occupational health examination. Information on general demographic characteristics, living habits, and work status was collected from all study subjects. Cox proportional hazards regression model was used to analyze the association between occupational hazard exposure and the risk of hypertension among the calcium carbide plant employees. Results The average age, mean systolic and diastolic blood pressure, proportion of males, smoking rate, and alcohol consumption rate in the exposure group were higher than those in the control group (P<0.05). Compared to baseline, both systolic and diastolic blood pressure levels increased in the exposure group and the control group at the end of the follow-up (P<0.05). At the end of the follow-up, the average differences between systolic/ diastolic blood pressure and baseline values in the exposure group were higher than those in the control group (P<0.05). During the follow-up period, a total of 223 cases of hypertension occurred, with a total follow-up of 2785 person-years, resulting in an incidence density of 8007.18 per 100000 person-years, an average age of onset of (35.90±8.22) years, and an average working age of onset of (2.69±1.97) years. The incidence density in the exposure group was 128.71% higher than that in the control group, and the risk of hypertension in the exposure group was 2.115 times that of the control group. The risk of hypertension was 2.199 times higher for men than for women, 1.344 times higher for those aged 30 and above than for those under 30, 1.546 times higher for smokers than for non-smokers, and 1.750 times higher for drinking workers than for non-drinking ones. The results of Cox proportional hazards regression modeling indicated that the hazard ratio (95%CI) of hypertension among the employees exposed to dust, noise, and carbon monoxide was 2.254 (1.703, 2.982), 1.594 (1.107, 2.295), and 1.567 (1.079, 2.274), respectively, when different covariates (gender, age, smoking, and alcohol consumption) were included. The results of Log-rank test showed that there were statistically significant differences in the distribution of disease-free survival between the exposure group and the control group (P<0.05). Conclusion Occupational exposures to dust, noise, and carbon monoxide may increase the risk of hypertension among calcium carbide plant workers.

BackgroundMigraine is a common chronic neurological disease， and patent foramen ovale （PFO） has been closely associated with migraine. Current research primarily focuses on the pathological mechanism and the therapeutic effects of interventional closure， with limited attention paid to the impact of PFO on sleep quality in migraine patients. ObjectiveTo compare the difference in sleep quality between PFO-positive and PFO-negative migraine patients， and to analyzes influencing factors of sleep quality in PFO-positive migraine patients， so as to provide references for clinical interventions to improve sleep quality in PFO-positive migraine patients. MethodsA total of 673 migraine patients who met the diagnostic criteria of migraine in the International Classification of Headache Disorders， third edition （ICHD-3）， and all patients underwent contrast-enhanced transcranial Doppler （c-TCD） and transthoracic echocardiographic right heart contrast echocardiography （cTTE） in the Third Hospital of Mianyang from January 2020 to October 2024. Basic demographic data were collected using a self-designed questionnaire， headache severity was assessed with the Visual Analogue Scale （VAS）， and sleep quality was invaluated using the Pittsburgh Sleep Quality Index （PSQI）. PFO patients was diagnosed through c-TCD combined with c-TTE. Binary logistic regression analysis was employed to examine the influencing factors of sleep quality in PFO-positive migraine patients. ResultsA total of 673 （100.00%） migraine patients were enrolled， including 223 PFO-positive cases （33.14%） and 450 PFO-negative cases（66.86%）. The PFO-positive group showed significantly more severe headache severity （χ²=15.799， P<0.01） and poorer sleep quality （χ²=14.377， P<0.01） compared with PFO-negative group. PFO-positive patients demonstrated significantly higher barrier factor scores of sleep quality， sleep latency， sleep efficiency， sleep disturbance， hypnotic medication use， and daytime dysfunction compared with PFO-negative counterparts （t=3.634， 3.269， 2.785， 3.428， 2.907， 3.637， Bonferroni adjust P<0.05/7=0.007）.By contrast， no significant difference was noted in sleep duration scores between the two groups（t=2.349， Bonferroni adjust P>0.05/7=0.007）.The Binary Logistic regression analysis revealed that age （OR=1.021， 95% CI： 1.001~1.041）， headache severity （OR=6.030， 95% CI： 4.085~8.901）， and PFO grade （OR=1.893，95% CI： 1.288~2.784）were significant influencing factors for sleep quality in migraine patients with PFO. ConclusionMigraine patients with PFO-positive exhibited poorer sleep quality compared wtih PFO-negative patients. Older age， higher headache servity， and more severe PFO grade are identified as risk factors for impaired sleep quality in PFO-positive migraine patients.

Approximately 10% of the global adult population has diabetes, with accumulating evidence linking suboptimal vitamin D levels to an increased risk of type 2 diabetes and its complications. Current clinical studies suggest that vitamin D supplementation may enhance insulin sensitivity and improve glycemic control, prompting significant interest in its potential as a therapeutic intervention. However, further high-quality, large-scale randomized controlled trials are required to validate its efficacy in glucose metabolism regulation and clarify the underlying molecular mechanisms. These investigations will provide critical evidence to inform precision medicine approaches for diabetes prevention and management.

Esophageal cancer is one of the malignant tumors that poses a threat to human health, with both high incidence and malignancy. Currently, surgery following neoadjuvant chemoradiotherapy is the standard treatment for locally advanced esophageal cancer; however, the long-term prognosis remains unsatisfactory. In recent years, inhibitors of programmed death protein-1 (PD-1) and its ligand (programmed death ligand-1, PD-L1) have achieved breakthrough progress in other solid tumors, and research on esophageal cancer is gradually being conducted. With the demonstration of good efficacy of PD-1/PD-L1 inhibitors in the first-line and second-line treatment of advanced unresectable esophageal cancer, their incorporation into neoadjuvant treatment regimens has become a hot topic. Therefore, this article reviews the mechanism of action of PD-1/PD-L1 inhibitors and their application in the neoadjuvant treatment of esophageal cancer.

ObjectiveTo develop traditional Chinese medicine （TCM） formulae for the treatment of nonsevere coronavirus disease 2019 （COVID-19） and to explore its anti-inflammatory mechanism. MethodsThe dysregulated signaling pathways were determined in macrophages from bronchoalveolar lavage fluid of COVID-19 patients and in lung epithelial cells infected with SARS-CoV-2 in vitro based on transcriptome analysis. A total of 102 TCM formulae for the clinical treatment of nonsevere COVID-19 were collected through literature. The pathway-reversing rates of these formulae in macrophages and lung epithelial cells were evaluated based on signature signaling pathways， and the basic formula was determined in conjunction with TCM theory. The commonly used Chinese materia medica for nonsevere COVID-19 were summarized from the 102 TCM formulae as abovementioned. And together with the screening results from the Pharmacopoeia of the People's Republic of China， a “Chinese materia medica pool” was esta-blished for the development of TCM formulae for COVID-19. The regulatory effects of each herb on signaling pathways were obtained based on targeted transcriptome analysis. Oriented at reversing dysregulated signaling pathways of COVID-19， the calculation was carried out， and the artificial intelligent methods for compositing formulae， that are exhaustive method and parallel computing， were used to obtain candidate compound formulas. Finally， with reference to professional experience， an innovative formula for the treatment of nonsevere COVID-19 was developed. The ethanol extract of the formula was evaluated for its anti-inflammatory effects by detecting the mRNA expression of interleukin 1b （Il1b）， C-X-C motif chemokine ligand 2 （Cxcl2）， C-X-C motif chemokine ligand 10 （Cxcl10）， C-C motif chemokine ligand 2 （Ccl2）， nitric oxide synthase 2 （Nos2）， and prostaglandin-endoperoxide synthase 2 （Ptgs2） using reverse transcription-quantitative polymerase chain reaction （RT-qPCR） in RAW264.7 cells treated with lipopolysaccharide （LPS）. ResultsIn macrophages and lung epithelial cells， 34 dysregulated signaling pathways associated with COVID-19 were identified respectively. The effects of the 102 formulae for clinical treatment of nonsevere COVID-19 were evaluated based on the dysregulated signaling pathways and targeted transcriptome， and the result showed that Yinqiao Powder and Pingwei Powder （银翘散合平胃散， YQPWP） ranked first， reversing 91.18% of the dysregulated signaling pathways in macrophages and 100% of the dysregulated signaling pathways in lung epithelial cells. Additionally， YQPWP had the function of scattering wind and clearing heat， resolving toxins and removing dampness in accordance with the pathogenesis of wind-heat with dampness in COVID-19. It was selected as the basic formula， and was further modified and optimized to develop an innovative fomula Qiaobang Zhupi Yin （翘蒡术皮饮， QBZPY） based on expert experience and artificial intelligence in composing formulae. QBZPY can reverse all the dysregulated signaling pathways associated with COVID-19 in macrophages and lung epithelial cells， with the reversing rates of 100%. The chief medicinal of QBZPY， including Lianqiao （Fructus Forsythiae）， Xixiancao （Herba Siegesbeckiae） and Niubangzi （Fructus Arctii）， can down-regulate multiple signaling pathways related with virus infection， immune response， and epithelial damage. RT-qPCR results indicated that compared with the model group， the QBZPY group down-regulated the mRNA expression of Il1b， tumor necrosis factor （Tnf）， Cxcl2， Cxcl10， Ccl2， Nos2 and Ptgs2 induced by LPS in RAW264.7 cells （P＜0.05 or P＜0.01）. ConclusionBased on targeted transcriptome analysis， expert experience in TCM and artificial intelligence， QBZPY has been developed for the treatment of nonsevere COVID-19. The ethanol extract of QBZPY has been found to inhibit mRNA expression of several pro-inflammatory genes in a cellular inflammation model.

[Abstract] [Objective] To establish a detection method for complement C3d-sensitized platelets. [Methods] Parallel detection of the same platelet sample under conditions of complement C3d sensitization and non-sensitization was conducted using microcolumn gel immunoagglutination inhibition assay technology. The supernatant obtained after the reaction between anti-C3d monoclonal antibodies and platelet samples was then reacted with C3d-sensitized red blood cells to observe whether agglutination occurs. Subsequently, this method was used to test samples from 22 clinical patients to determine whether their platelets were sensitized by complement C3d. [Results] The same platelet sample, after being sensitized with complement C3d, showed negative or weakened aggregation, which was determined as a positive result, whereas platelets that were not sensitized with complement C3d exhibited aggregation, which was determined as a negative result. A total of 22 clinical patient samples were tested, of which 16 were negative and 6 were positive. [Conclusion] A microcolumn gel immunoagglutination inhibition test was established to detect whether platelets are sensitized by complement C3d, which aids in the auxiliary diagnosis of complement-related immune diseases involving platelets.

Deficiency of adenosine deaminase 2(DADA2) is a rare monogenic autoinflammatory disorder caused by genetic variations in the ADA2 gene. The disease has complex clinical manifestations. The hematological involvement is infrequent in the disease. Therefore, the disease is frequently wrongly diagnosed and missed diagnoses. This article reports a case of a child patient with DADA2 who was admitted to the Peking Union Medical College Hospital. The child had aplastic anemia. After inadequate response to treatment with glucocorticoids, cyclosporine, and various supportive measures, the patient exhibited pancytopenia. Genetic testing showed a novel homozygous mutation in the ADA2 gene (NM_001282225.2:c.712_750dupGACAACGTGCTCTACATGGAGATCAGAGCCAGGCTGCTG), with reduced ADA2 levels in peripheral blood. Based on the testing results and clinical manifestations, the patient was diagnosed DADA2. Genetic testing and monitoring of ADA2 levels proved helpful in the early diagnosis of DADA2. Treatment protocol should base on the disease phenotype and severity, and include glucocorticoids, immunosuppressants, biological agents, and hematopoietic stem cell transplantation.

【Objective】 To establish a highly sensitive detection method of platelet HPA-3 and HPA-15 genotyping by droplet digital PCR (ddPCR), and to explore the feasibility of applying it to the detection of human platelet antigen (HPA) compatibility in maternal peripheral blood fetal free DNA. 【Methods】 For SNP mutation sites of HPA-3 and HPA-15, specific primers and MGB probes were designed, and amplification conditions such as annealing temperature and primer concentration of ddPCR were optimized to establish the optimal reaction system and clarify the test procedures. The methodological performance of the assay was evaluated, including specificity, sensitivity, repeatability and stability. ddPCR was used to detect 67 clinical blood samples, and the allele typing results were compared with the gene sequencing results. The fetal free DNA HPA antigen of 52 maternal peripheral blood samples was detected. 【Results】 The ddPCR method for detecting platelet HPA-3 and HPA-15 showed good specificity of primers and probes. The optimal annealing temperatures for HPA-3 and HPA-15 were 61.6℃ and 60.2℃, respectively. The optimal concentrations of primers were 900 nM and 700 nM respectively. The final concentration of the probe was 250 nM. The quantitative detection range of copy number was 2 to 20 000 copies, with lower limit of detection of 0.1 copies/μL, and the linearity is good. In low copy number samples, the intra - and inter batch coefficient of variation (CV) of actual detection values for HPA-3 and HPA-15 were both lower than 5%. The detection results of HPA-3 and HPA-15 genotypes of 67 blood samples were consistent with the gene sequencing results, and its application in fetomaternal platelet HPA-3, HPA-15 genotype detection met expectations. 【Conclusion】 The HPA-3 and HPA-15 ddPCR detection system constructed in this study has high accuracy, good repeatability, stability and sensitivity, and can be applied to the establishment of platelet HPA-3 and HPA-15 genotype donor pool, gene matching and fetomaternal platelet compatibility detection.