1.Development of a new platform for testing antiviral drugs using coronavirus-infected human nasal mucosa organoids
Yan YU ; Junyuan CAO ; Rong LIU ; Minmin ZHOU ; Jinyan WEI ; Hairui ZHENG ; Wei WANG ; Gang LI
Journal of Southern Medical University 2024;44(11):2227-2234
Objective To establish a coronavirus(CoV)infection model using human nasal mucosa organoids for testing antiviral drugs and evaluate the feasibility of using human nasal mucosa organoids with viral infection as platforms for viral research and antiviral drug development.Methods Human nasal mucosa organoids were tested for susceptibility to SARS-CoV-2 and HCoV-OC43 pseudoviruses.In a P3 laboratory,nasal mucosa organoids were infected with the original strain of SARS-CoV-2 and 4 variant strains,and the infection conditions were optimized.The viral loads in the culture supernatants were measured at different time points using RT-qPCR,and immunofluorescence assay was employed to localize SARS-CoV-2 nucleocapsid protein to determine the type of the infected cells.In the optimized nasal mucosa viral infection model,the antiviral effects of camostat and bergamot extract(which were known to inhibit SARS-CoV-2)were tested and the underlying molecular mechanisms were explored.Results In the optimized nasal mucosa organoid models infected with SARS-CoV-2 and HCoV-OC43 pseudoviruses,the viral load in the culture supernatants increased significantly during the period of 2 to 24 h following the infection,which confirmed infection of the organoids by both of the pseudoviruses.The nasal mucosa organoids could be stably infected by the original SARS-CoV-2 strain and its 4 variant strains,validating successful establishment of the viral infection model,in which both camostat and bergamot extract exhibited dose-dependent antiviral effects.Conclusions Human nasal mucosa organoids with SARS-CoV-2 infection can serve as platforms for screening and testing antiviral drugs,particularly those intended for nasal administration.
2.Development of a new platform for testing antiviral drugs using coronavirus-infected human nasal mucosa organoids
Yan YU ; Junyuan CAO ; Rong LIU ; Minmin ZHOU ; Jinyan WEI ; Hairui ZHENG ; Wei WANG ; Gang LI
Journal of Southern Medical University 2024;44(11):2227-2234
Objective To establish a coronavirus(CoV)infection model using human nasal mucosa organoids for testing antiviral drugs and evaluate the feasibility of using human nasal mucosa organoids with viral infection as platforms for viral research and antiviral drug development.Methods Human nasal mucosa organoids were tested for susceptibility to SARS-CoV-2 and HCoV-OC43 pseudoviruses.In a P3 laboratory,nasal mucosa organoids were infected with the original strain of SARS-CoV-2 and 4 variant strains,and the infection conditions were optimized.The viral loads in the culture supernatants were measured at different time points using RT-qPCR,and immunofluorescence assay was employed to localize SARS-CoV-2 nucleocapsid protein to determine the type of the infected cells.In the optimized nasal mucosa viral infection model,the antiviral effects of camostat and bergamot extract(which were known to inhibit SARS-CoV-2)were tested and the underlying molecular mechanisms were explored.Results In the optimized nasal mucosa organoid models infected with SARS-CoV-2 and HCoV-OC43 pseudoviruses,the viral load in the culture supernatants increased significantly during the period of 2 to 24 h following the infection,which confirmed infection of the organoids by both of the pseudoviruses.The nasal mucosa organoids could be stably infected by the original SARS-CoV-2 strain and its 4 variant strains,validating successful establishment of the viral infection model,in which both camostat and bergamot extract exhibited dose-dependent antiviral effects.Conclusions Human nasal mucosa organoids with SARS-CoV-2 infection can serve as platforms for screening and testing antiviral drugs,particularly those intended for nasal administration.
3.A case of Bainbridge-Ropers syndrome with autism in conjunct with ASXL3 gene variant and its clinical analysis.
Shuhong ZHENG ; Hairui CHEN ; Miaojun MO
Chinese Journal of Medical Genetics 2021;38(7):671-673
OBJECTIVE:
To retrospectively analyze the clinical phenotype and genetic characteristics of a child with severe mental retardation, language and motor development delays and autism.
METHODS:
High-throughput sequencing was carried out for the patient. Candidate variant was verified by Sanger sequencing and bioinformatics analysis.
RESULTS:
The child was found to harbor a heterozygous variant of exon 11:c.1421_1422insTGAATTTTCTGAGGAGGCTGAAAGT(p.Leu483*) of the ASXL3 gene. The same variant was found in neither of her parents, suggesting that it has a de novo origin.
CONCLUSION
The exon 11:c.1421_1422ins TGAATTTTCTGAGGAGGCTGAAAGT(p.Leu483*) variant of the ASXL3 gene probably underlay the pathogenesis of Bainbridge-Ropers syndrome in this patient. Above finding has enriched the spectrum of ASXL3 gene variants.
Autistic Disorder/genetics*
;
Child
;
Developmental Disabilities
;
Female
;
Humans
;
Mutation
;
Retrospective Studies
;
Syndrome
;
Transcription Factors/genetics*
4.Case report of WHIM syndrome with cardiac malformation as the first symptom
Na LIU ; Huyong ZHENG ; Linya WANG ; Xueling ZHENG ; Hairui HU
Chinese Journal of Applied Clinical Pediatrics 2021;36(1):64-66
The clinical data of a WHIM syndrome child with cardiac malformation as the first symptom in December 2017 in Beijing Children′s Hospital Affiliated to Capital Medical University was retrospectively analyzed.A 5-year-old female patient presented with cardiac malformation, neutropenia and recurrent infection.Heterozygous mutation(c.1000C>T) was detected in CXCR4 gene.Echocardiography and CT exhibited cardiac malformation.WHIM syndrome is very rare, and it was the first case with cardiac malformation as the first manifestation in China, thus hoping to improve clinicians′ understanding of this disease.
5.A study on the status quo and its influencing factors of depression and anxiety in postoperative patients with thoracic neoplasms
TANG Yudong ; MEI Xiaoli ; ZHENG E ; LI Hairui ; HU Xu ; CHE Guowei
Chinese Journal of Clinical Thoracic and Cardiovascular Surgery 2018;25(1):67-70
Objective To investigate the status quo and influencing factors of depression and anxiety in postoperative patients with thoracic neoplasms. Methods The general information questionnaire and Huaxi emotional-distress index scale (HEI) were adopted to survey 70 patients after surgery of thoracic neoplasms at the thoracic nursing outpatients from September to November 2016. There were 43 males and 27 females with age of 18-78 (56.20±11.34) years. Results The prevalence rate of depression and anxiety among postoperative patients with thoracic neoplasms was 50.0%, and moderate to severe negative emotions predominated. There was significant difference in educational levels, postoperative hospitalization and postoperative complications (P<0.05), while no significant difference in age, gender, disease types, complicated diseases, surgical procedures, pathological stages and hospitalization expenditures between patients with unhealthy emotions and normal emotions (P>0.05). Conclusion There is a high prevalence rate of negative emotion among postoperative patients with thoracic neoplasms. Educational levels, postoperative hospitalization and postoperative complications are important factors for negative emotion.
6.Age-associated proliferation and differentiation changes of rat bone marrow mesenchymal stem cells
Hairui LI ; Dong ZHENG ; Can JIANG ; Jun GUO ; Aidong ZHANG ; Zicheng LI
Chinese Journal of Tissue Engineering Research 2015;(1):18-23
BACKGROUND:Autologous bone marrow mesenchymal stem cel transplantation for the treatment of cardiovascular disease has become one of the hotspots, but it is unclear whether the proliferation and directional differentiation of autologous bone marrow mesenchymal stem cels varies changes with age. OBJECTIVE: To explore the proliferation and differentiation changes of rat bone mesenchymal stem cels in different ages. METHODS:The bone marrow mesenchymal stem cels from Sprague-Dawley rats in different age groups were purified and cultured, and then examined by flow cytometry in terms of cel cycle. Meanwhile, neonatal rat cardiomyocytes were co-cultured with bone marrow mesenchymal stem cels. The morphologic changes of bone marrow mesenchymal stem cels and the protein expression of troponin T were detected with immunofluorescence technique. RESULTS AND CONCLUSION: The percentage of bone marrow mesenchymal stem cels in G0/G1 phase was increased with age; while the percentage of expression of troponin T proteins-positive bone marrow mesenchymal stem cels were decreased with age. These findings indicate that the proliferation and differentiation abilities of rat bone marrow mesenchymal stem cels descend with age.

Result Analysis
Print
Save
E-mail