1.Application of pulsed electromagnetic fields in the treatment of orthopedic diseases
Hairui LIANG ; Zhencun CAI ; He ZHANG ; Siyu DUAN ; Beibei CHEN
Chinese Journal of Tissue Engineering Research 2024;28(12):1944-1949
BACKGROUND:Pulsed electromagnetic field is a non-invasive and non-radiative treatment method.Clinical use of pulsed electromagnetic fields in the treatment of orthopedic diseases has achieved certain results. OBJECTIVE:To review the current clinical application of the pulsed electromagnetic field in the treatment of orthopedic diseases,providing a scientific theoretical basis for the clinical treatment of orthopedic diseases. METHODS:The first author used a computer to search PubMed,CBM,Cochrane Library,CNKI,and WanFang Data for related studies on the pulsed electromagnetic field in the treatment of orthopedic diseases,using the keywords of"pulsed electromagnetic field,orthopedics,osteoarthritis,osteoporosis,bone healing,electromagnetic navigation"in English and Chinese.For the literature related to the same content,recent publications were selected.A total of 69 articles were selected from the search results for review. RESULTS AND CONCLUSION:Pulsed electromagnetic field has a definite curative effect on fracture healing.It can be used in the treatment of osteomyelitis by antibacterial,bactericidal,anti-inflammatory and promoting bone healing,and can inhibit osteoporosis and its progress.In addition,the treatment of early osteoarthritis,femoral head necrosis and postoperative rehabilitation of late joint replacement through various ways can become a treatment for orthopedic diseases.However,the therapeutic mechanism of the pulsed electromagnetic field for a variety of orthopedic diseases is still unclear,and most of the research is still in the primary stage.In the future,it is still necessary to obtain more reliable evidence from high-quality research and clinical trials to provide a more perfect basis for the clinical treatment of orthopedic diseases.
2.Thinking on compatibility of prescription and drugs based on perspective of combination of disease, syndrome, and symptom
Zhibin WANG ; Wen TANG ; Kang TONG ; Weijie HUANG ; Binbin CHEN ; Shijie QIAO ; Hairui HAN ; Candong LI ; Yang WANG
Journal of Beijing University of Traditional Chinese Medicine 2024;47(7):929-933
In the context of the complex and ever-changing spectrum of diseases, the traditional Chinese medicine compatibility of prescription and drugs is no longer able to fully meet the needs of clinical diagnosis and treatment. Therefore, this article is based on the diagnosis and treatment model of the combination of disease, syndrome, and symptom, combined with the development achievements of Western medicine, and explores the principles of formulating traditional prescriptions based on the combination of chief, deputy, assistant, and envoy. This article proposes a formulation principle of composing prescriptions with the diagnosis of syndrome as the chief, the diagnosis of disease as the deputy, the treatment of symptoms as the assistant, and the harmonization of medicine as the envoy. This forms a treatment plan with the core link of syndrome differentiation and treatment, disease differentiation and treatment, symptomatic treatment, detoxification, and efficacy enhancement. The purpose of this article is to address the current clinical challenges such as an increasing disease spectrum and the complexity of syndrome patterns and symptom clusters. It aims to provide new insights into traditional Chinese medicine clinical treatment plans and herbal formulation strategies, with the ultimate goal of improving the clinical effectiveness of traditional Chinese medicine.
3.Single-shot AAV-vectored vaccine against SARS-CoV-2 with fast and long-lasting immunity.
Fuhua WU ; Shuang LUO ; Yongshun ZHANG ; Yangsen OU ; Hairui WANG ; Zhaofei GUO ; Chunting HE ; Shuting BAI ; Penghui HE ; Min JIANG ; Xiaoyan CHEN ; Guangsheng DU ; Xun SUN
Acta Pharmaceutica Sinica B 2023;13(5):2219-2233
Due to the insufficient long-term protection and significant efficacy reduction to new variants of current COVID-19 vaccines, the epidemic prevention and control are still challenging. Here, we employ a capsid and antigen structure engineering (CASE) strategy to manufacture an adeno-associated viral serotype 6-based vaccine (S663V-RBD), which expresses trimeric receptor binding domain (RBD) of spike protein fused with a biological adjuvant RS09. Impressively, the engineered S663V-RBD could rapidly induce a satisfactory RBD-specific IgG titer within 2 weeks and maintain the titer for more than 4 months. Compared to the licensed BBIBP-CorV (Sinopharm, China), a single-dose S663V-RBD induced more endurable and robust immune responses in mice and elicited superior neutralizing antibodies against three typical SARS-CoV-2 pseudoviruses including wild type, C.37 (Lambda) and B.1.617.2 (Delta). More interestingly, the intramuscular injection of S663V-RBD could overcome pre-existing immunity against the capsid. Given its effectiveness, the CASE-based S663V-RBD may provide a new solution for the current and next pandemic.
4.Exploring the Mechanism of Acanthopanax Senticosus in the Treatment of Alzheimer’s Disease Based on GEO Data Mining and Network Pharmacology
WANG Yanyan ; TANG Weiwei ; GAO Qi ; CHEN Chen ; SHAO Mengting ; LI Changxu ; LIU Jiayue ; ZHOU Hairui ; ZHAO Hong
Chinese Journal of Modern Applied Pharmacy 2023;40(16):2192-2202
OBJECTIVE To screen the potential drug targets and signaling pathways of Acanthopanax senticosus for the treatment of Alzheimer’s disease(AD) by bioinformatics and network pharmacology-based approach, and to preliminarily validate its efficacy. METHODS The ingredients of Acanthopanax senticosus were obtained through literature, the ingredients were screened by Swiss ADME, and potential targets were predicted by Swiss Target Prediction. AD’s differentially expressed genes were screened from the GSE28146 dataset. The target of Acanthopanax senticosus and AD target were mapped to construct a “drug-ingredients-potential target-disease” network and protein-protein interaction network. The DAVID database was used for GO and KEGG enrichment analysis. Autodock software was used to verify the molecular docking between key active ingredients and core targets. AD mice model was induced by D-galactose combined with aluminum chloride. Morris water maze test was performed to examine the learning memory ability of each group of mice and to observe the pathological changes in the hippocampus of mice. RESULTS Screened to obtain 24 active components and 74 potential targets of Acanthopanax senticosus for the treatment of AD. “Drug-ingredients-potential target-disease” network indicated that quercetin and kaempferol were the main components of Acanthopanax senticosus for the treatment of AD, and the protein-protein interaction network indicated that STAT3, MAPK1 and PIK3CA were the key targets. Obtained 366 GO enrichment entries(P<0.01) and 109 KEGG enrichment pathways(P<0.01). It mainly involved PI3K-AKT, AGE-RAGE, TNF and other pathways. The molecular docking results showed that the main active ingredients of Acanthopanax senticosus were able to bind well to the main targets. The in vivo pharmacological results showed that Acanthopanax senticosus could significantly improve the learning and memory ability of mice, reduce hippocampal tissue damage, and decrease the content of TNF-α, IL-6, and IL-1β in hippocampal tissue. CONCLUSION Acanthopanax senticosus may exert anti-AD effects by inhibiting the expression of inflammatory factors and reducing inflammatory damage.
5.Pathogenesis, prenatal diagnosis and clinical features of fetal cardiomyopathies
Xin WANG ; Xiaowei LIU ; Xiaoyan HAO ; Jiancheng HAN ; Hairui SUN ; Lin SUN ; Ye ZHANG ; Xiaoyan GU ; Ying ZHAO ; Zhuo CHEN ; Shaomei YU ; Jianfeng SHANG ; Yihua HE
Chinese Journal of Ultrasonography 2022;31(5):379-385
Objective:To summarize the etiological mechanism, echocardiographic and clinical features of fetal cardiomyopathies (FCMs).Methods:According to the data of echocardiography in Maternal-Fetal Medicine Center in Fetal Heart Disease of Beijing Anzhen Hospital during 2015 January to 2020 December, 70 cases with FCMs were retrospectively reviewed, and the clinical, ultrasonic, pathological and clinical outcome data were collected. Whole exome sequencing and whole genome sequencing were used to identify the genetic changes.Results:Primary FCMs were diagnosed in 55 cases (78.6%, 55/70), including 39 fetuses with non-compaction of the ventricular myocardium (NVM), 10 with dilated cardiomyopathy (DCM), 5 with hypertrophic cardiomyopathy (HCM), and 1 with restricted cardiomyopathy (RCM). Secondary FCMs were diagnosed in 15 cases (21.4%, 15/70), including 7 fetuses with maternal anti-Ro/La antibodies (presenting with DCM), 4 with twin-twin transfusion syndrome (2 with DCM and 2 with HCM), 2 with fetal anemia (presenting with DCM), 1 with maternal diabetes (presenting with HCM) and 1 with chorioangioma of the placenta (presenting with DCM). In all cases, 9 cases were born, 3 cases died in perinatal period, and 58 pregnancies were terminated due to ineffective treatment or the decisions of pregnant women. Thirty cases with primary FCMs were performed with genetic tests, and 13 of them were identified with positive genetic changes related to FCMs, including 12 cases with NVM and 1 with HCM.Conclusions:Primary FCMs are more common than secondary FCMs in fetal period. The genetic disorders have a high proportion in fetal NVM. Fetal DCM and HCM have a large spectrum of intrinsic and extrinsic causes.
6.Anesthetic strategy for endovascular treatment in patients with acute ischemic stroke due to large vessel occlusion
Tengteng CHEN ; Jingjing XIAO ; Hairui ZHAO
International Journal of Cerebrovascular Diseases 2022;30(1):37-41
Endovascular treatment is a standard treatment regimen for patients with acute ischemic stroke caused by large vessel occlusion. The anesthetic strategy for patients with acute ischemic stroke undergoing endovascular treatment includes local anesthesia, conscious sedation, and general anesthesia. However, the optimal anesthetic strategy for patients with acute ischemic stroke undergoing endovascular treatment is controversial.
7.Nanoparticles with rough surface improve the therapeutic effect of photothermal immunotherapy against melanoma.
Jiao XUE ; Yining ZHU ; Shuting BAI ; Chunting HE ; Guangsheng DU ; Yuandong ZHANG ; Yao ZHONG ; Wenfei CHEN ; Hairui WANG ; Xun SUN
Acta Pharmaceutica Sinica B 2022;12(6):2934-2949
Photothermal therapy has been intensively investigated for treating cancer in recent years. However, the long-term therapeutic outcome remains unsatisfying due to the frequently occurred metastasis and recurrence. To address this challenge, immunotherapy has been combined with photothermal therapy to activate anti-tumor immunity and relieve the immunosuppressive microenvironment within tumor sites. Here, we engineered silica-based core‒shell nanoparticles (JQ-1@PSNs-R), in which silica cores were coated with the photothermal agent polydopamine, and a bromodomain-containing protein 4 (BRD4) inhibitor JQ-1 was loaded in the polydopamine layer to combine photothermal and immune therapy for tumor elimination. Importantly, to improve the therapeutic effect, we increased the surface roughness of the nanoparticles by hydrofluoric acid (HF) etching during the fabrication process, and found that the internalization of JQ-1@PSNs-R was significantly improved, leading to a strengthened photothermal killing effect as well as the increased intracellular delivery of JQ-1. In the animal studies, the multifunctional nanoparticles with rough surfaces effectively eradicated melanoma via photothermal therapy, successfully activated tumor-specific immune responses against residual tumor cells, and further prevented tumor metastasis and recurrence. Our results indicated that JQ-1@PSNs-R could serve as an innovative and effective strategy for combined cancer therapy.
8.A case of Bainbridge-Ropers syndrome with autism in conjunct with ASXL3 gene variant and its clinical analysis.
Shuhong ZHENG ; Hairui CHEN ; Miaojun MO
Chinese Journal of Medical Genetics 2021;38(7):671-673
OBJECTIVE:
To retrospectively analyze the clinical phenotype and genetic characteristics of a child with severe mental retardation, language and motor development delays and autism.
METHODS:
High-throughput sequencing was carried out for the patient. Candidate variant was verified by Sanger sequencing and bioinformatics analysis.
RESULTS:
The child was found to harbor a heterozygous variant of exon 11:c.1421_1422insTGAATTTTCTGAGGAGGCTGAAAGT(p.Leu483*) of the ASXL3 gene. The same variant was found in neither of her parents, suggesting that it has a de novo origin.
CONCLUSION
The exon 11:c.1421_1422ins TGAATTTTCTGAGGAGGCTGAAAGT(p.Leu483*) variant of the ASXL3 gene probably underlay the pathogenesis of Bainbridge-Ropers syndrome in this patient. Above finding has enriched the spectrum of ASXL3 gene variants.
Autistic Disorder/genetics*
;
Child
;
Developmental Disabilities
;
Female
;
Humans
;
Mutation
;
Retrospective Studies
;
Syndrome
;
Transcription Factors/genetics*
9.Genetically-engineered "all-in-one" vaccine platform for cancer immunotherapy.
Aihua WU ; Yingzhi CHEN ; Hairui WANG ; Ya CHANG ; Meng ZHANG ; Pengfei ZHAO ; Yisi TANG ; Qin XU ; Zhuangzhi ZHU ; Yang CAO ; Yongzhuo HUANG
Acta Pharmaceutica Sinica B 2021;11(11):3622-3635
An essential step for cancer vaccination is to break the immunosuppression and elicit a tumor-specific immunity. A major hurdle against cancer therapeutic vaccination is the insufficient immune stimulation of the cancer vaccines and lack of a safe and efficient adjuvant for human use. We discovered a novel cancer immunostimulant, trichosanthin (TCS), that is a clinically used protein drug in China, and developed a well-adaptable protein-engineering method for making recombinant protein vaccines by fusion of an antigenic peptide, TCS, and a cell-penetrating peptide (CPP), termed an "all-in-one" vaccine, for transcutaneous cancer immunization. The TCS adjuvant effect on antigen presentation was investigated and the antitumor immunity of the vaccines was investigated using the different tumor models. The vaccines were prepared
10.Determination of individualized PEEP during lung-protective ventilation in patients undergoing general anesthesia: comparison of pulmonary electrical impedance tomography and dynamic lung compliance
Jinlu LI ; Xuemei WU ; Hong XIE ; Jiang ZHU ; Peimin CHEN ; Hairui LIU
Chinese Journal of Anesthesiology 2021;41(1):72-75
Objective:To compare the efficacy of individualized PEEP determined by lung electrical impedance tomography (EIT) and dynamic lung compliance (Cdyn) during lung-protective ventilation strategies in the patients undergoing general anesthesia.Methods:Sixty patients of both sexes, aged 18-64 yr, of American Society of Anesthesiologists physical status Ⅰor Ⅱ, with body mass index of 18.5-28.0 kg/m 2, undergoing elective surgery with general anesthesia and endotracheal intubation in the Second Affiliated Hospital of Soochow University, were selected.Lung-protective ventilation strategy was applied in supine position after general anesthesia.The peak value of PEEP did not exceed 10 cmH 2O, with an increment/decrement of 2 cmH 2O for titration.The corresponding Cdyn value and lung EIT data were collected during titration.The patients were divided into 2 groups ( n=30 each) using a random number table method: titration first increased and then decreased group (group A) and titration first decreased and then increased group (group B). The determination method of individualized PEEP: Cdyn method was the PEEP corresponding to the maximum Cdyn value; EIT method was obtained through PV500 PC software analysis.The level and success rate of individualized PEEP determined by the Cdyn and EIT methods were compared, and the ICC consistency analysis of the determined individualized PEEP was performed. Results:Compared with the Cdyn method, the success rate of individualized PEEP determined by EIT method was significantly increased, and the level of individualized PEEP was decreased in the two group ( P<0.05). In group A, the individualized PEEP titrated by the EIT and Cdyn methods showed good agreement (the ICC value of the increment-Cdyn and increment-EIT methods was 0.761, P<0.05; the ICC value of the decrement-Cdyn and decrement-EIT methods was 0.763, P<0.05). In group B, the individualized PEEP titrated by the EIT and Cdyn methods showed good agreement (the ICC value of the increment-Cdyn and increment-EIT methods was 0.809, P<0.05; the ICC value of the decrement-Cdyn and decrement-EIT methods was 0.797, P<0.05). Conclusion:The agreement between the individualized PEEP determined by lung EIT method and Cdyn method during lung-protective ventilation is good in the patients undergoing general anesthesia, and the success rate of EIT method is higher, and the level of individualized PEEP is lower.


Result Analysis
Print
Save
E-mail