1.Disease burden of chronic kidney disease attributable to high BMI in China and trend prediction in 1992-2021
Hong LIU ; Guimao YANG ; Yan SUI ; Xia ZHANG ; Xuebing CHENG ; Yaxing WU ; Xu GUO ; Yanfeng REN
Journal of Public Health and Preventive Medicine 2025;36(1):27-31
Objective To analyze the disease burden of chronic kidney diseases (CKD) attributed to high body mass index (BMI) in China from 1992 to 2021 and predict the disease burden for the next decade, and to provide evidence for the prevention and treatment of CKD. Methods Using the Global Burden of Disease (GBD) database and the Joinpoint model, the average annual percentage rate change (AAPC) of the mortality rate and disability-adjusted life year (DALY) rate was calculated to describe and analyze the CKD disease burden attributed to high BMI in China from 1992 to 2021. The ARIMA model was employed to predict and analyze the change trend of the CKD disease burden. Results From 1992 to 2021, the mortality rate and DALY rate attributed to high BMI-induced chronic kidney disease showed an upward trend. Compared to 1992, the attributed number of deaths increased by 324.38%, and DALYs increased by 268.56%; the mortality rate increased by 64.00%, and the DALY rate grew by 51.62%. From 1992 to 2021, the mortality rate and DALY rate for males were lower than those for females, but the growth rate for males exceeded that of females. From 1992 to 2021, the mortality rate and DALY rate of chronic kidney disease attributed to high BMI in China increased with age. The average annual change rate of chronic kidney disease attributed to high BMI in China from 1992 to 2021 (mortality rate: 1.40 per 100,000 (95% CI: 1.04–1.76), DALY rate: 1.43 per 100 000 (95% CI: 1.17–1.70)) was higher than thHuaiyin Normal University, Huai'anher social demographic index (SDI) regions. The ARIMA model predicted that the age-standardized mortality rate increased from 2.91 per 100 000 in 2022 to 3.05 per 100 000 in 2026, and the age-standardized DALY rate increased from 69.65 per 100 000 in 2022 to 73.58 per 100 000 in 2026. Conclusion Chronic kidney disease attributed to high BMI in China is on the rise, and it will continue to grow in the future. The focus of CKD prevention and control should be on males and the elderly, while active measures should be taken to reduce the occurrence and progression of chronic kidney disease.
2.Analysis of Quality Uniformity of Hengzhi Kechuan Capsules Based on HPLC-DAD-CAD
Qian MA ; An LIU ; Qingxia XU ; Cong GUO ; Jun ZHANG ; Maoqing WANG ; Xiaodi KOU ; Yan LIU
Chinese Journal of Experimental Traditional Medical Formulae 2025;31(3):168-174
ObjectiveTo establish the fingerprints of 15 batches of Hengzhi Kechuan capsules, to quantitatively analyze 10 index components, and to evaluate the quality uniformity of samples from different batches. MethodsThe fingerprints and quantitative analysis of Hengzhi Kechuan capsules were established by a combination method of high performance liquid chromatography coupled with diode array detector and charged aerosol detector(HPLC-DAD-CAD), adenosine, guanosine, vanillic acid, safflomin A, agarotetrol, naringin, hesperidin, militarine, ginsenoside Rb1, and glycyrrhizic acid were selected as quality attribute indexes. A total of 15 batches of Hengzhi Kechuan capsules from 2022 to 2024(3 boxes per batch) were qualitatively and quantitatively analyzed, and the quality uniformity level of the manufacturers was characterized by parameters of intra-batch consistency(PA) and inter-batch consistency(PB). The homogeneity and difference of quality attribute indexes of samples from different years were analyzed by heatmap clustering analysis. ResultsHPLC fingerprints and quantitative method of Hengzhi Kechuan capsules were established, and the methods could be used for qualitative and quantitative analysis of this preparation, which was found to be stable and reliable by method validation. The similarity of fingerprints of 15 batches of samples was 0.887-0.975, a total of 13 common peaks were calibrated, and 10 common peaks were designated, all of which were quality attribute index components. The results of quantitative analysis showed that the contents of the above 10 ingredients in the samples were 0.038-0.078, 0.115-0.251, 0.007-0.018, 0.291-0.673, 0.122-0.257, 0.887-1.905, 1.841-3.364, 1.412-2.450, 2.207-3.112, 0.650-1.161, respectively. And the contents of ginsenoside Rb1 and glycyrrhizic acid met the limit requirements in the 2020 edition of Chinese Pharmacopoeia. For the samples from 15 batches, the PA values of the 10 index components were all <10%, indicating good intra-batch homogeneity, and the PB values ranged from 33.86% to 92.97%, suggesting that the inter-batch homogeneity was poor. Heatmap clustering analysis showed that the samples from different years were clustered into separate categories, and adenosine, guanosine, safflomin A, naringin, hesperidin and agarotetrol were the main differential components. ConclusionThe intra-annual quality uniformity of Hengzhi Kechuan capsules is good and the inter-annual quality uniformity is insufficient, which may be related to the quality difference of Pinellinae Rhizoma Praeparatum, Carthami Flos, Citri Sarcodactylis Fructus, Citri Reticulatae Pericarpium, Aquilariae Lignum Resinatum, Citri Fructus, etc. In this study, the fingerprint and multi-indicator determination method of Hengzhi Kechuan capsules was established, which can be used for more accurate and efficient quality control and standardization enhancement.
3.Influencing factors for delay in healthcare-seeking, definitive diagnosis, identification in patients with pulmonary tuberculosis in Minhang District
MA Qiongjin ; YAN Huiqin ; WU Yunhua ; GUO Xu ; YANG Lijia ; TANG Lihong ; YANG Shengyuan
Journal of Preventive Medicine 2025;37(1):59-64
Objective:
To investigate the influencing factors for delay in healthcare-seeking, definitive diagnosis and identification in patients with pulmonary tuberculosis (PTB) in Minhang District, Shanghai Municipality, so as to provide the basis for effectively reducing delay in PTB patients.
Methods:
Data of PTB patients in Minhang District from 2017 to 2022 were collected from the Infectious Disease Reporting Information System of Chinese Disease Prevention and Control Information System. The prevalence rates of delay in healthcare-seeking, definitive diagnosis and identification were analyzed, and factors affecting delay in healthcare-seeking, definitive diagnosis and identification were identified using multivariable logistic regression models.
Results:
A total of 4 214 PTB patients were reported in Minhang District from 2017 to 2022, including 2 802 males and 1 412 females, with a male-to-female ratio of 1.98∶1. The majority of patients were aged 25 to <45 years (1 664 cases, 39.49%). The prevalence rates of delay in healthcare-seeking, definitive diagnosis and identification were 36.81%, 30.21% and 38.09%, respectively. Delay in healthcare-seeking was associated with the year (2018, OR=0.708; 2019, OR=0.549; 2020, OR=0.670; 2021, OR=0.682), gender (female, OR=1.199), occupation (worker, OR=1.379; housekeeping service/housework/unemployed, OR=1.481), case identification route (symptom-based consultation, OR=11.159), and level of the first-diagnosed hospital (city-level, OR=1.528). Delay in definitive diagnosis was associated with age (45 to <65 years, OR=1.476), occupation (commercial service, OR=0.687; housekeeping service/housework/unemployed, OR=0.672), household registration (non-local, OR=0.820), case identification route (symptom-based consultation, OR=0.616), pathogen test result (negative/not tested, OR=1.903), and the level of the first-diagnosed hospital (city-level, OR=0.311). Delay in identification was associated with the year (2018, OR=0.785; 2019, OR=0.647; 2020, OR=0.790; 2021, OR=0.710), occupation (commercial service, OR=0.687), household registration (non-local, OR=0.848) and level of the first-diagnosed hospital (city-level, OR=0.560)
Conclusions
Year, gender, occupation, case identification route and level of the first-diagnosed hospital are influencing factors for delay in healthcare-seeking in PTB patients. Age, occupation, household registration, case identification route, pathogen test result and level of the first-diagnosed hospital are influencing factors for delay in definitive diagnosis. Year, occupation, household registration and level of the first-diagnosed hospital are influencing factors for delay in identification.
4.Evaluation of the comprehensive intervention effect on lunch for primary and secondary school students in Minhang District of Shanghai
HU Yuhuan, ZANG Jiajie, XU Huilin, GUO Qi, HAN Yan, TANG Hongmei, YING Fangjia, LIANG Hao
Chinese Journal of School Health 2025;46(2):191-195
Objective:
To evaluate the comprehensive intervention effect of lunch for primary and secondary school students in Minhang District, so as to provide a theoretical and practical basis for lunch intervention in school.
Methods:
From October to December 2023, a convenience sampling method was used to select 1 937 students from one primary and secondary school in Minhang District.A comprehensive intervention measure focusing on "reducing oil and salt" for lunch recipe optimization and nutrition education was carried out, and a questionnaire survey was conducted to evaluate the intervention effect three months later. Chi square test and Wilcoxon rank test were used to compare the data before and after the intervention.
Results:
After intervention, the use of cooking oil and salt, the supply of protein and fat in primary and secondary school lunches were reduced, and had no obvious impact on energy and other major nutrients. After intervention, compared to before intervention, the proportion of primary school students who felt that lunch was greasy decreased (8.9%, 6.2%, χ 2=4.35), and the proportion of primary and secondary school students who felt that lunch were delicious decreased significantly (33.2%, 23.2%; 63.9%, 53.5%, χ 2=26.39, 17.52) ( P < 0.05 ). Secondary school students also felt reduced variety of food ingredients (46.9%, 38.3%, χ 2=16.05, P <0.05). In addition, after intervention, the total surplus rate of primary school students meals decreased (7.4%, 4.4%, χ 2=5.73), mainly reflected in the decrease of the surplus rate of staple foods (7.1%, 2.4%, χ 2=17.39), while the surplus rate of vegetable dishes increased ( 16.0 %, 21.2%, χ 2=6.01) ( P <0.05). Although there was no significant change in the total surplus rate of meals for secondary school students, the surplus rate of staple foods decreased (12.9%, 5.4%, χ 2=33.52), while the surplus rates of meat and vegetable dishes increased (11.2%, 26.9%; 17.5%, 33.2%, χ 2=74.26, 61.88) ( P <0.05). After intervention, there was no statistically significant difference in the overweight and obesity rates of primary school students ( χ 2=0.11,0.43) and secondary school students ( χ 2=0.01,0.00) compared to before intervention( P >0.05). After intervention, the lung capacity of primary school students [1 564 (1 269,1 890) mL] and sitting forward flexion [11.3 (7.6, 15.2) cm] increased compared to before intervention [1 522 (1 259, 1 819 ) mL, 10.5 (6.3, 13.5) cm] ( Z =2.20, 4.68, P <0.01), but there was no statistically significant difference in lung capacity and sitting forward flexion of secondary school students before and after intervention ( Z =-0.46, -0.08, P >0.05).
Conclusion
The comprehensive intervention of school lunch has promoted a significant decrease in the use of oil and salt in lunch and improved the quality of recipes, and has a positive impact on the situation of leftover lunch and the health of students to a certain extent.
5.Three new gallic acid sugaresters from Elaeagnus oxycarpa Schlechtend leaves and their antioxidant and tyrosinase inhibitory activities
Feng-zhen CUI ; Jian-hong FU ; Guo-yan XU ; AYEKABAYR·EKBAYR ; Chang-da MA
Acta Pharmaceutica Sinica 2025;60(2):434-441
Five compounds were isolated and purified from the water extract of
6.Objective characteristics of tongue manifestation in different stages of damp-heat syndrome in diabetic kidney disease
Zhaoxi DONG ; Yang SHI ; Jiaming SU ; Yaxuan WEN ; Zheyu XU ; Xinhui YU ; Jie MEI ; Fengyi CAI ; Xinyue ZANG ; Yan GUO ; Chengdong PENG ; Hongfang LIU
Journal of Beijing University of Traditional Chinese Medicine 2025;48(3):398-411
Objective:
To investigate the objective characteristics of tongue manifestation in different stages of damp-heat syndrome in diabetic kidney disease (DKD).
Methods:
A cross-sectional study enrolled 134 patients with DKD G3-5 stages who met the diagnostic criteria for damp-heat syndrome in DKD. The patients were treated at Dongzhimen Hospital, Beijing University of Chinese Medicine, from May 2023 to January 2024. The patients were divided into three groups: DKD G3, DKD G4, and DKD G5 stage, with 53, 33, and 48 patients in each group, respectively. Clinical general data (gender, age, and body mass index) and damp-heat syndrome scores were collected from the patients. The YZAI-02 traditional Chinese medicine (TCM) AI Tongue Image Acquisition Device was used to capture tongue images from these patients. The accompanying AI Open Platform for TCM Tongue Diagnosis of the device was used to analyze and extract tongue manifestation features, including objective data on tongue color, tongue quality, coating color, and coating texture. Clinical data and objective tongue manifestation characteristics were compared among patients with DKD G3-5 based on their DKD damp-heat syndrome status.
Results:
No statistically significant difference in gender or body mass index was observed among the three patient groups. The DKD G3 stage group had the highest age (P<0.05). The DKD G3 stage group had a lower score for symptoms of poor appetite and anorexia(P<0.05) than the DKD G5 group. No statistically significant difference was observed in damp-heat syndrome scores among the three groups. Compared with the DKD G5 stage group, the DKD G3 stage group showed a decreased proportion of pale color at the tip and edges of the tongue (P<0.05). The DKD G4 stage group exhibited an increased proportion of crimson at the root of the tongue, a decreased proportion of thick white tongue coating at the root, a decreased proportion of pale color at the tip and edges of the tongue, an increased hue value (indicating color tone) of the tongue color in the middle, an increased brightness value (indicating color lightness) of the tongue coating color in the middle, and an increased thickness of the tongue coating (P<0.05). No statistically significant difference was observed in other tongue color proportions, color chroma values, body characteristics, coating color proportions, coating color chroma values, and coating texture characteristics among the three groups.
Conclusion
Tongue features differ in different stages of DKD damp-heat syndrome in multiple dimensions, enabling the inference that during the DKD G5 stage, the degree of qi and blood deficiency in the kidneys, heart, lungs, liver, gallbladder, spleen, and stomach is prominent. Dampness is more likely to accumulate in the lower jiao, particularly in the kidneys, whereas heat evil in the spleen and stomach is the most severe. These insights provide novel ideas for the clinical treatment of DKD.
7.Dynamics of eosinophil infiltration and microglia activation in brain tissues of mice infected with Angiostrongylus cantonensis
Fanna WEI ; Renjie ZHANG ; Yahong HU ; Xiaoyu QIN ; Yunhai GUO ; Xiaojin MO ; Yan LU ; Jiahui SUN ; Yan ZHOU ; Jiatian GUO ; Peng SONG ; Yanhong CHU ; Bin XU ; Ting ZHANG ; Yuchun CAI ; Muxin CHEN
Chinese Journal of Schistosomiasis Control 2025;37(2):163-175
Objective To investigate the changes in eosinophil counts and the activation of microglial cells in the brain tissues of mice at different stages of Angiostrongylus cantonensis infection, and to examine the role of microglia in regulating the progression of angiostrongyliasis and unravel the possible molecular mechanisms. Methods Fifty BALB/c mice were randomly divided into the control group and the 7-d, 14-d, 21-day and 25-d infection groups, of 10 mice in each group. All mice in infection groups were infected with 30 stage III A. cantonensis larvae by gavage, and animals in the control group was given an equal amount of physiological saline. Five mice were collected from each of infection groups on days 7, 14, 21 d and 25 d post-infection, and 5 mice were collected from the control group on the day of oral gavage. The general and focal functional impairment was scored using the Clark scoring method to assess the degree of mouse neurological impairment. Five mice from each of infection groups were sacrificed on days 7, 14, 21 d and 25 d post-infection, and 5 mice from the control group were sacrificed on the day of oral gavage. Mouse brain tissues were sampled, and the pathological changes of brain tissues were dynamically observed using hematoxylin and eosin (HE) staining. Immunofluorescence staining with eosinophilic cationic protein (ECP) and ionized calcium binding adaptor molecule 1 (Iba1) was used to assess the degree of eosinophil infiltration and the counts of microglial cells in mouse brain tissues in each group, and the morphological parameters of microglial cells (skeleton analysis and fractal analysis) were quantified by using Image J software to determine the morphological changes of microglial cells. In addition, the expression of M1 microglia markers Fcγ receptor III (Fcgr3), Fcγ receptor IIb (Fcgr2b) and CD86 antigen (Cd86), M2 microglia markers Arginase 1 (Arg1), macrophage mannose receptor C-type 1 (Mrc1), chitinase-like 3 (Chil3), and phagocytosis genes myeloid cell triggering receptor expressed on myeloid cells 2 (Trem2), CD68 antigen (Cd68), and apolipoprotein E (Apoe) was quantified using real-time quantitative reverse transcription PCR (RT-qPCR) assay in the mouse cerebral cortex of mice post-infection. Results A large number of A. cantonensis larvae were seen on the mouse meninges surface post-infection, and many neuronal nuclei were crumpled and deeply stained, with a large number of bleeding points in the meninges. The median Clark scores of mouse general functional impairment were 0 (interquartile range, 0), 0 (interquartile range, 0.5), 6 (interquartile range, 1.0), 14 (interquartile range, 8.5) points and 20 (interquartile range, 9.0) points in the control group and the 7-d, 14-d, 21-d and 25-d groups, respectively (H = 22.45, P < 0.01), and the median Clark scores of mouse focal functional impairment were 0 (interquartile range, 0), 2 (interquartile range, 2.5), 7 (interquartile range, 3.0), 18 (interquartile range, 5.0) points and 25 (interquartile range, 6.5) points in the control group and the 7-d, 14-d, 21-d and 25-d groups, respectively (H = 22.72, P < 0.01). The mean scores of mice general and focal functional impairment were all higher in the infection groups than in the control group (all P values < 0.05). Immunofluorescence staining showed a significant difference in the eosinophil counts in mouse brain tissues among the five groups (F = 40.05, P < 0.000 1), and the eosinophil counts were significantly higher in mouse brain tissues in the 14-d (3.08 ± 0.78) and 21-d infection groups (5.97 ± 1.37) than in the control group (1.00 ± 0.28) (both P values < 0.05). Semi-quantitative analysis of microglia immunofluorescence showed a significant difference in the counts of microglial cells among the five groups (F = 17.66, P < 0.000 1), and higher Iba1 levels were detected in mouse brain tissues in 14-d (5.75 ± 1.28), 21-d (6.23 ± 1.89) and 25-d infection groups (3.70 ± 1.30) than in the control group (1.00 ± 0.30) (all P values < 0.05). Skeleton and fractal analyses showed that the branch length [(162.04 ± 34.10) μm vs. (395.37 ± 64.11) μm; t = 5.566, P < 0.05] and fractal dimension of microglial cells (1.30 ± 0.01 vs. 1.41 ± 0.03; t = 5.266, P < 0.05) were reduced in mouse brain tissues in the 21-d infection group relative to the control group. In addition, there were significant differences among the 5 groups in terms of M1 and M2 microglia markers Fcgr3 (F = 48.34, P < 0.05), Fcgr2b (F = 55.46, P < 0.05), Cd86 (F = 24.44, P < 0.05), Arg1 (F = 31.18, P < 0.05), Mrc1 (F = 15.42, P < 0.05) and Chil3 (F = 24.41, P < 0.05), as well as phagocytosis markers Trem2 (F = 21.19, P < 0.05), Cd68 (F = 43.95, P < 0.05) and Apoe (F = 7.12, P < 0.05) in mice brain tissues. Conclusions A. cantonensis infections may induce severe pathological injuries in mouse brain tissues that are characterized by massive eosinophil infiltration and persistent activation of microglia cells, thereby resulting in progressive deterioration of neurological functions.
8.Essential tremor plus affects disease prognosis: A longitudinal study.
Runcheng HE ; Mingqiang LI ; Xun ZHOU ; Lanqing LIU ; Zhenhua LIU ; Qian XU ; Jifeng GUO ; Xinxiang YAN ; Chunyu WANG ; Hainan ZHANG ; Irene X Y WU ; Beisha TANG ; Sheng ZENG ; Qiying SUN
Chinese Medical Journal 2025;138(1):117-119
9.Production of GTKO pigs and kidney xenotransplantation from pigs to rhesus macaques
Yan WANG ; Yue CHANG ; Chang YANG ; Taiyun WEI ; Xiaoying HUO ; Bowei CHEN ; Jiaoxiang WANG ; Heng ZHAO ; Jianxiong GUO ; Hongfang ZHAO ; Xiong ZHANG ; Feiyan ZHU ; Wenmin CHENG ; Hongye ZHAO ; Kaixiang XU ; Ameen Jamal MUHAMMAD ; Zhendi WANG ; Hongjiang WEI
Organ Transplantation 2025;16(4):526-537
Objective To explore the construction of α-1,3-galactosyltransferase (GGTA1) gene-knockout (GTKO) Diannan miniature pigs and the kidney xenotransplantation from pigs to rhesus macaques, and to assess the effectiveness of GTKO pigs. Methods The GTKO Diannan miniature pigs were constructed using the CRISPR/Cas9 gene-editing system and somatic cell cloning technology. The phenotype of GTKO pigs was verified through polymerase chain reaction, Sanger sequencing and immunofluorescence staining. Flow cytometry was used to detect antigen-antibody (IgM) binding and complement-dependent cytotoxicity. Kidney xenotransplantation was performed from GTKO pigs to rhesus macaques. The humoral immunity, cellular immunity, coagulation and physiological indicators of the recipient monkeys were monitored. The function and pathological changes of the transplanted kidneys were analyzed using ultrasonography, hematoxylin-eosin staining, immunohistochemical staining and immunofluorescence staining. Results Single-guide RNA (sgRNA) targeting exon 4 of the GGTA1 gene in Diannan miniature pigs was designed. The pGL3-GGTA1-sgRNA1-GFP vector was transfected into fetal fibroblasts of Diannan miniature pigs. After puromycin selection, two cell clones, C59# and C89#, were identified as GGTA1 gene-knockout clones. These clones were expanded to form cell lines, which were used as donor cells for somatic cell nuclear transfer. The reconstructed embryos were transferred into the oviducts of trihybrid surrogate sows, resulting in 13 fetal pigs. Among them, fetuses F04 and F11 exhibited biallelic mutations in the GGTA1 gene, and F04 had a normal karyotype. Using this GTKO fetal pig for recloning and transferring the reconstructed embryos into the oviducts of trihybrid surrogate sows, seven surviving piglets were obtained, all of which did not express α-Gal epitope. The binding of IgM from the serum of rhesus monkey 20# to GTKO pig PBMC was reduced, and the survival rate of GTKO pig PBMC in the complement-dependent cytotoxicity assay was higher than that of wild-type pig. GTKO pig kidneys were harvested and perfused until completely white. After the left kidney of the recipient monkey was removed, the pig kidney was heterotopically transplanted. Following vascular anastomosis and blood flow restoration, the pig kidney rapidly turned pink without hyperacute rejection (HAR). Urine appeared in the ureter 6 minutes later, indicating successful kidney transplantation. The right kidney of the recipient was then removed. Seven days after transplantation, the transplanted kidney had good blood flow, the recipient monkey's serum creatinine level was stable, and serum potassium and cystatin C levels were effectively controlled, although they increased 10 days after transplantation. Seven days after transplantation, the levels of white blood cells, lymphocytes, monocytes and eosinophils in the recipient monkey increased, while platelet count and fibrinogen levels decreased. The activated partial thromboplastin time, thrombin time and prothrombin time remained relatively stable but later showed an upward trend. The recipient monkey survived for 10 days. At autopsy, the transplanted kidney was found to be congested, swollen and necrotic, with a small amount of IgG deposition in the renal tissue, and a large amount of IgM, complement C3c and C4d deposition, as well as CD68+ macrophage infiltration. Conclusions The kidneys of GTKO Diannan miniature pigs may maintain normal renal function for a certain period in rhesus macaques and effectively overcome HAR, confirming the effectiveness of GTKO pigs for xenotransplantation.
10.Detection of residual DNA in host cells of Escherichia coli in levodopa by Real-time PCR
Bingyu XU ; YAN LIU ; Xinyao GUO ; Fang YAN ; Guibin SUN
Journal of China Pharmaceutical University 2025;56(2):176-182
Using Real-time PCR technology, a highly specific and sensitive method for detecting DNA residues of Escherichia coli host cells in levodopa was established, validated, and preliminarily applied. Escherichia coli strain MB6 16S ribosomal RNA gene was selected as the target gene to design multiple pairs of primers and the target fragment by specific amplification of PCR was obtained. The target fragment was cloned into the pLENTI-BSD-CON vector and the recombinant plasmid was constructed and named pLENTI-BSD-CON-E.coli-16S. A quantitative PCR detection method (SYBR Green method) with magnetic bead extraction and purification methods was established with the reference standard of the recombinant plasmid. Furthermore, the established method was validated, including linear and range, accuracy, precision, specificity, and quantification limit, and applied to the detection of levodopa raw materials. Meanwhile, the detection method was compared with the Taqman probe method by the commercial kit. The primer sequences of the quantitative PCR detection method (SYBR Green method) were TTCGATGCAACGCGAAGAAC (forward) and GTGTAGCCCTGGTCGTAAGG (reverse). The standard curve of DNA was in the range of 10 fg/μL to 3 ng/μL with good linearity (R2≥ 0.98). The quantitative limit was 10 fg/μL. In addition, the detection recovery rate was in the range of 59.7% to 80.7%, with RSD at less than 15%. Nine batches of levodopa were detected by this method, and the amount of E.coli DNA residue was below the limit. The developed qPCR method can be used for quantitative detection of residual DNA in biological products produced by E.coli as host cells, such as levodopa . The results indicate that the sensitivity of the detection method for recombinant plasmid construction standards is superior than the reagent kit detection method.


Result Analysis
Print
Save
E-mail