BACKGROUND:Multiple studies have confirmed that mitogen-activated protein kinase(MAPK)signaling pathway is involved in cell proliferation,and microRNA(miR)is involved in the occurrence and development of hypertrophic scars.Therefore,the role of miR-27a-3p and MAPK signaling pathways in pathological scar formation has been further explored. OBJECTIVE:To explore the effect of miR-27a-3p on the proliferation of human hypertrophic scar fibroblasts through the MAPK signaling pathway. METHODS:The primary fibroblasts were isolated and collected from the skin samples.The primary fibroblasts were observed by inverted microscope and verified by immunofluorescence.The relative expression level of miR-27a-3p in tissues was detected by qRT-PCR.The target genes of hsa-miR-27a-3p were predicted using the database,and then the predicted target genes were enriched by gene ontology function analysis and biological pathway enrichment analysis of the Kyoto Encyclopedia of Genes and Genomes.There were seven groups:blank control,negative control,miR-27a-3p mimic,miR-27a-3p inhibitor,miR-27a-3p mimic+p38 MAPK inhibitor,miR-27a-3p mimic+extracellular regulated protein kinase inhibitor,miR-27a-3p mimic+c-Jun N-terminal kinase inhibitor.Western blot was used to detect the levels of extracellular regulated protein kinase,c-Jun N-terminal kinase inhibitor.and p38 kinase and their phosphorylation levels.Cell counting kit-8 and EdU were used to detect cell proliferation. RESULTS AND CONCLUSION:Compared with normal skin fibroblasts,hypertrophic scar fibroblasts had stronger proliferative activity(P<0.05)and faster proliferation level(P<0.001).Compared with normal skin,miR-27a-3p was highly expressed in hypertrophic scars(P<0.001).Compared with the negative control group,overexpression of miR-27a-3p could promote cell proliferation activity(P<0.001)and proliferation levels(P<0.001).Compared with the negative control group,knockdown of miR-27a-3p could inhibit the proliferation activity(P<0.05)and proliferation levels(P<0.001).Compared with the negative control group,overexpression of miR-27a-3p promoted the phosphorylated levels of extracellular regulated protein kinase,c-Jun N-terminal kinase,and p38 mitogen-activated protein kinase(P<0.05).Compared with the negative control group,knockdown of miR-27a-3p inhibited the phosphorylated levels of extracellular regulated protein kinase,c-Jun N-terminal kinase,and p38 MAPK(P<0.05).Compared with the miR-27a-3p mimic group,specific inhibitors of extracellular regulated protein kinase,c-Jun N-terminal kinase,and p38 MAPK reversed the effects of miR-27a-3p on the proliferative activity(P<0.01)and proliferation level(P<0.001)of fibroblasts.To conclude,these results suggest that miR-27a-3p promotes the proliferation of human hypertrophic scar fibroblasts by activating the MAPK signaling pathway.

Using Real-time PCR technology, a highly specific and sensitive method for detecting DNA residues of Escherichia coli host cells in levodopa was established, validated, and preliminarily applied. Escherichia coli strain MB6 16S ribosomal RNA gene was selected as the target gene to design multiple pairs of primers and the target fragment by specific amplification of PCR was obtained. The target fragment was cloned into the pLENTI-BSD-CON vector and the recombinant plasmid was constructed and named pLENTI-BSD-CON-E.coli-16S. A quantitative PCR detection method (SYBR Green method) with magnetic bead extraction and purification methods was established with the reference standard of the recombinant plasmid. Furthermore, the established method was validated, including linear and range, accuracy, precision, specificity, and quantification limit, and applied to the detection of levodopa raw materials. Meanwhile, the detection method was compared with the Taqman probe method by the commercial kit. The primer sequences of the quantitative PCR detection method (SYBR Green method) were TTCGATGCAACGCGAAGAAC (forward) and GTGTAGCCCTGGTCGTAAGG (reverse). The standard curve of DNA was in the range of 10 fg/μL to 3 ng/μL with good linearity (R2≥ 0.98). The quantitative limit was 10 fg/μL. In addition, the detection recovery rate was in the range of 59.7% to 80.7%, with RSD at less than 15%. Nine batches of levodopa were detected by this method, and the amount of E.coli DNA residue was below the limit. The developed qPCR method can be used for quantitative detection of residual DNA in biological products produced by E.coli as host cells, such as levodopa . The results indicate that the sensitivity of the detection method for recombinant plasmid construction standards is superior than the reagent kit detection method.

BACKGROUND: Generalized pustular psoriasis (GPP), a rare and recurrent autoinflammatory disease, imposes a substantial burden on patients and society. Awareness of GPP in China remains limited. METHODS: This cross-sectional survey, conducted between September 2021 and May 2023 across 14 hospitals in China, included GPP patients of all ages and disease phases. Data collected encompassed demographics, clinical characteristics, economic impact, disease severity, quality of life, and treatment-related complications. Risk factors for GPP recurrence were analyzed. RESULTS: Among 127 patients (female/male ratio = 1.35:1), the mean age of disease onset was 25 years (1st quartile [Q1]-3rd quartile [Q3]: 11-44 years); 29.2% had experienced GPP for more than 10 years. Recurrence occurred in 75.6% of patients, and nearly half reported no identifiable triggers. Younger age at disease onset ( P  = 0.021) and transitioning to plaque psoriasis ( P  = 0.022) were associated with higher recurrence rates. The median diagnostic delay was 8 months (Q1-Q3: 2-41 months), and 32.3% of patients reported misdiagnoses. Comorbidities were present in 53.5% of patients, whereas 51.1% experienced systemic complications during treatment. Depression and anxiety affected 84.5% and 95.6% of patients, respectively. During GPP flares, the median Dermatology Life Quality Index score was 19.0 (Q1-Q3: 13.0-23.5). This score showed significant differences between patients with and without systemic symptoms; it demonstrated correlations with both depression and anxiety scores. Treatment costs caused financial hardship in 55.9% of patients, underscoring the burden associated with GPP. CONCLUSIONS The substantial disease and economic burdens among Chinese GPP patients warrant increased attention. Patients with early onset disease and those transitioning to plaque psoriasis require targeted interventions to mitigate the high recurrence risk.
Humans ; Male ; Female ; Psoriasis/pathology* ; Adult ; Cross-Sectional Studies ; Adolescent ; Child ; Young Adult ; Quality of Life ; Middle Aged ; China/epidemiology* ; Recurrence ; Risk Factors ; Surveys and Questionnaires ; East Asian People

This study aims to explore the mechanism of Jiaotai Pills in treating depression based on metabolomics and network pharmacology. The chemical constituents of Jiaotai Pills were identified by UHPLC-Orbitrap Exploris 480, and the targets of Jiaotai Pills and depression were retrieved from online databases. STRING and Cytoscape 3.7.2 were used to construct the protein-protein interaction network of core targets of Jiaotai Pills in treating depression and the "compound-target-pathway" network. DAVID was used for Gene Ontology(GO) function and Kyoto Encyclopedia of Genes and Genomes(KEGG) pathway enrichment analyses of the core targets. The mouse model of depression was established with chronic unpredictable mild stress(CUMS) and treated with different doses of Jiaotai Pills. The behavioral changes and pathological changes in the hippocampus were observed. UHPLC-Orbitrap Exploris 120 was used for metabolic profiling of the serum, from which the differential metabolites and related metabolic pathways were screened. A "metabolite-reaction-enzyme-gene" network was constructed for the integrated analysis of metabolomics and network pharmacology. A total of 34 chemical components of Jiaotai Pills were identified, and 143 core targets of Jiaotai Pills in treating depression were predicted, which were mainly involved in the arginine and proline, sphingolipid, and neurotrophin metabolism signaling pathways. The results of animal experiments showed that Jiaotai Pills alleviated the depression behaviors and pathological changes in the hippocampus of the mouse model of CUMS-induced depression. In addition, Jiaotai Pills reversed the levels of 32 metabolites involved in various pathways such as arginine and proline metabolism, sphingolipid metabolism, and porphyrin metabolism in the serum of model mice. The integrated analysis showed that arginine and proline metabolism, cysteine and methionine metabolism, and porphyrin metabolism might be the key pathways in the treatment of depression with Jiaotai Pills. In conclusion, metabolomics combined with network pharmacology clarifies the antidepressant mechanism of Jiaotai Pills, which may provide a basis for the clinical application of Jiaotai Pills in treating depression.
Animals ; Drugs, Chinese Herbal/chemistry* ; Depression/genetics* ; Mice ; Network Pharmacology ; Metabolomics ; Male ; Disease Models, Animal ; Humans ; Protein Interaction Maps/drug effects* ; Antidepressive Agents

Prostate cancer is the second most common malignancy and the sixth leading cause of cancer-related death in men worldwide. Radical prostatectomy (RP) is the standard treatment for localized prostate cancer, but the procedure often results in postoperative erectile dysfunction (ED). The poor efficacy of phosphodiesterase 5 inhibitors after surgery highlights the need to develop new therapies to enhance cavernous nerve regeneration and improve the erectile function of these patients. In the present study, we aimed to examine the potential of heparin-binding epidermal growth factor-like growth factor (HB-EGF) in preserving erectile function in cavernous nerve injury (CNI) mice. We found that HB-EGF expression was reduced significantly on the 1 st day after CNI in penile tissue. Ex vivo and in vitro studies showed that HB-EGF promotes major pelvic ganglion neurite sprouting and neuro-2a (N2a) cell migration. In vivo studies showed that exogenous HB-EGF treatment significantly restored the erectile function of CNI mice to 86.9% of sham levels. Immunofluorescence staining showed that mural and neuronal cells were preserved by inducing cell proliferation and reducing apoptosis and reactive oxygen species production. Western blot analysis showed that HB-EGF upregulated protein kinase B and extracellular signal-regulated kinase activation and neurotrophic factor expression. Overall, HB-EGF is a major promising therapeutic agent for treating ED in postoperative RP.
Animals ; Male ; Heparin-binding EGF-like Growth Factor/therapeutic use* ; Erectile Dysfunction/etiology* ; Mice ; Penis/drug effects* ; Nerve Regeneration/drug effects* ; Penile Erection/drug effects* ; Peripheral Nerve Injuries/drug therapy* ; Cell Proliferation/drug effects* ; Apoptosis/drug effects* ; Cell Movement/drug effects* ; Prostatectomy/adverse effects* ; Mice, Inbred C57BL ; Reactive Oxygen Species/metabolism*

OBJECTIVE: To investigate the effects of astragaloside IV (AS-IV) on podocyte injury of diabetic nephropathy (DN) and reveal its potential mechanism. METHODS: In in vitro experiment, podocytes were divided into 4 groups, normal, high glucose (HG), inositol-requiring enzyme 1 (IRE-1) α activator (HG+thapsigargin 1 µmol/L), and IRE-1α inhibitor (HG+STF-083010, 20 µmol/L) groups. Additionally, podocytes were divided into 4 groups, including normal, HG, AS-IV (HG+AS-IV 20 µmol/L), and IRE-1α inhibitor (HG+STF-083010, 20 µmol/L) groups, respectively. After 24 h treatment, the morphology of podocytes and endoplasmic reticulum (ER) was observed by electron microscopy. The expressions of glucose-regulated protein 78 (GRP78) and IRE-1α were detected by cellular immunofluorescence. In in vivo experiment, DN rat model was established via a consecutive 3-day intraperitoneal streptozotocin (STZ) injections. A total of 40 rats were assigned into the normal, DN, AS-IV [AS-IV 40 mg/(kg·d)], and IRE-1α inhibitor [STF-083010, 10 mg/(kg·d)] groups (n=10), respectively. The general condition, 24-h urine volume, random blood glucose, urinary protein excretion rate (UAER), urea nitrogen (BUN), and serum creatinine (SCr) levels of rats were measured after 8 weeks of intervention. Pathological changes in the renal tissue were observed by hematoxylin and eosin (HE) staining. Quantitative reverse transcription-polymerase chain reaction (RT-PCR) and Western blot were used to detect the expressions of GRP78, IRE-1α, nuclear factor kappa Bp65 (NF-κBp65), interleukin (IL)-1β, NLR family pyrin domain containing 3 (NLRP3), caspase-1, gasdermin D-N (GSDMD-N), and nephrin at the mRNA and protein levels in vivo and in vitro, respectively. RESULTS: Cytoplasmic vacuolation and ER swelling were observed in the HG and IRE-1α activator groups. Podocyte morphology and ER expansion were improved in AS-IV and IRE-1α inhibitor groups compared with HG group. Cellular immunofluorescence showed that compared with the normal group, the fluorescence intensity of GRP78 and IRE-1α in the HG and IRE-1α activator groups were significantly increased whereas decreased in AS-IV and IRE-1α inhibitor groups (P<0.05). Compared with the normal group, the mRNA and protein expressions of GRP78, IRE-1α, NF-κ Bp65, IL-1β, NLRP3, caspase-1 and GSDMD-N in the HG group was increased (P<0.05). Compared with HG group, the expression of above indices was decreased in the AS-IV and IRE-1α inhibitor groups, and the expression in the IRE-1α activator group was increased (P<0.05). The expression of nephrin was decreased in the HG group, and increased in AS-IV and IRE-1α inhibitor groups (P<0.05). The in vivo experiment results revealed that compared to the normal group, the levels of blood glucose, triglyceride, total cholesterol, BUN, blood creatinine and urinary protein in the DN group were higher (P<0.05). Compared with DN group, the above indices in AS-IV and IRE-1α inhibitor groups were decreased (P<0.05). HE staining revealed glomerular hypertrophy, mesangial widening and mesangial cell proliferation in the renal tissue of the DN group. Compared with the DN group, the above pathological changes in renal tissue of AS-IV and IRE-1α inhibitor groups were alleviated. Quantitative RT-PCR and Western blot results of GRP78, IRE-1α, NF-κ Bp65, IL-1β, NLRP3, caspase-1 and GSDMD-N were consistent with immunofluorescence analysis. CONCLUSION AS-IV could reduce ERS and inflammation, improve podocyte pyroptosis, thus exerting a podocyte-protective effect in DN, through regulating IRE-1α/NF-κ B/NLRP3 signaling pathway.
Podocytes/metabolism* ; Animals ; Diabetic Nephropathies/metabolism* ; Saponins/therapeutic use* ; Triterpenes/therapeutic use* ; Signal Transduction/drug effects* ; NF-kappa B/metabolism* ; Protein Serine-Threonine Kinases/metabolism* ; Male ; Rats, Sprague-Dawley ; NLR Family, Pyrin Domain-Containing 3 Protein/metabolism* ; Endoribonucleases/metabolism* ; Endoplasmic Reticulum Chaperone BiP ; Rats ; Diabetes Mellitus, Experimental/complications* ; Endoplasmic Reticulum/metabolism* ; Multienzyme Complexes

Hearing loss is the most prevalent disabling disease. Cochlear implantation（CI） serves as the primary intervention for severe to profound hearing loss. This consensus systematically explores the value of genetic diagnosis in the pre-operative assessment and efficacy prognosis for CI. Drawing upon domestic and international research and clinical experience, it proposes an evidence-based medicine three-tiered prognostic classification system（Favorable, Marginal, Poor）. The consensus focuses on common hereditary non-syndromic hearing loss（such as that caused by mutations in genes like GJB2, SLC26A4, OTOF, LOXHD1） and syndromic hereditary hearing loss（such as Jervell & Lange-Nielsen syndrome and Waardenburg syndrome）, which are closely associated with congenital hearing loss, analyzing the impact of their pathological mechanisms on CI outcomes. The consensus provides recommendations based on multiple round of expert discussion and voting. It emphasizes that genetic diagnosis can optimize patient selection, predict prognosis, guide post-operative rehabilitation, offer stratified management strategies for patients with different genotypes, and advance the application of precision medicine in the field of CI.
Humans ; Cochlear Implantation ; Prognosis ; Hearing Loss/surgery* ; Consensus ; Connexin 26 ; Mutation ; Sulfate Transporters ; Connexins/genetics*

Glioblastoma (GBM) is a highly aggressive primary brain tumor characterized by poor prognosis. Conventional chemo-radiotherapy demonstrates limited therapeutic efficacy and is often accompanied by significant side effects, largely due to factors such as drug resistance, radiation resistance, the presence of the blood-brain barrier (BBB), and the activation of DNA damage repair mechanisms. There is a pressing need to enhance treatment efficacy, with BRD4 identified as a promising target for increasing GBM sensitivity to therapy. Lacking small molecule inhibitors, BRD4 can be degraded using PROteolysis Targeting Chimera (PROTAC), thereby inhibiting DNA damage repair. To deliver PROTAC, SIAIS171142 (SIS) effectively, we designed a responsive nanocapsule, MPL_(SS)P@SIS, featuring GBM-targeting and GSH-responsive drug release. Modified with 1-methyl-l-tryptophan (MLT), nanocapsules facilitate targeted delivery of SIS, downregulating BRD4 and sensitizing GBM cells to radiotherapy and chemotherapy. After intravenous administration, MPL_(SS)P@SIS selectively accumulates in tumor tissue, enhancing the effects of radiotherapy and temozolomide (TMZ) by increasing DNA damage and oxidative stress. GSH activates the nanocapsules, triggering BRD4 degradation and hindering DNA repair. In mouse models, the nanosensitizer, combined with TMZ and X-ray irradiation, efficiently inhibited the growth of GBM. These findings demonstrate a novel PROTAC-based sensitization strategy targeting BRD4, offering a promising approach for effective GBM therapy.