ObjectiveTo identify the pathogen species responsible for the wilt disease of Tetradium ruticarpum in Chongqing， investigate there biological characteristics， and screen effective fungicides， so as to provide a theoretical basis for disease control in production. MethodsThe pathogen was isolated via the tissue culture method. Pathogenicity was verified according to Koch's postulates. The pathogen was identified based on morphological characteristics and multi-gene phylogenetic analysis. The mycelial growth rate method was used for biological characterization of the pathogen and fungicide screening. ResultsThe pathogen colonies were nearly circular with irregular edges， white， short， velvety aerial hyphae， and pale purple undersides. Macroconidia were colorless， sickle-shaped， with 3-5 septa， while microconidia were transparent， elliptical， aseptate or with 1-2 septa. Multi-gene phylogenetic analysis showed that the pathogen clustered in the same clade as Fusarium fujikuroi with 100% support， which， combined with morphological characteristics， identified the pathogen causing wilt of T. ruticarpum in Chongqing as F. fujikuroi. The optimal conditions for the mycelial growth of F. fujikuroi were mung bean agar （MBA） with glucose as the carbon source， beef extract and yeast powder as nitrogen sources， 28 ℃， pH 7.0， and alternating light/dark conditions. The optimal conditions for sporulation were potato dextrose agar （PDA） with glucose as the carbon source， beef extract as the nitrogen source， 28 ℃， pH 7.0， and complete darkness. Among chemical fungicides， phenazine-1-carboxylic acid exhibited the strongest inhibitory effect on F. fujikuroi. Shenqinmycin and tetramycin were the most effective bio-fungicides. ConclusionThis study is the first to report F. fujikuroi as the causal agent of wilt disease in T. rutaecarpa. The chemical fungicide phenazine-1-carboxylic acid and the bio-fungicides shenqinmycin and tetramycin showed strong inhibitory effects against F. fujikuroi.

Abstract The prevention and control of myopia in Chinese children and adolescents has become a major public health issue. While maintaining increased outdoor activity as a cornerstone intervention, there is an urgent need to explore new complementary approaches that can be effectively implemented in both indoor and outdoor settings. In recent years, environmental spatial frequency has gained increasing attention as one of the key environmental factors influencing the development and progression of myopia. Both animal studies and human research have confirmed that indoor environments lacking mid to high spatial frequency components, often characterized as "visually impoverished", can promote axial elongation and myopia through mechanisms such as disruption of retinal neural signaling, impaired accommodative function, and altered expression of related molecules. Based on the scientific consensus, it is recommended that "enriching of environmental spatial frequency" should be integrated into the myopia prevention and control framework. Following the principles of schoolled organization, family cooperation, community involvement, and student participation, specific measures are put forward in three areas：optimizing school visual settings, improving home spatial environments, and promoting healthy visual behavior. The aim is to create "visually friendly" indoor environments as an important supplement to outdoor activity, thereby providing a novel perspective and strategy for comprehensively advancing myopia prevention and control among children and adolescents.

Colorectal cancer （CRC） is one of the most common cancers， with its incidence ranking high among cancers. It stands as the second leading cause of cancer-related death worldwide. In the early stages， CRC lacks specific symptoms， and most patients are diagnosed at advanced stages， making it a major research focus in the field of gastrointestinal tumors. Currently， clinical CRC treatments face several common challenges， including high surgical risks， frequent metastasis and recurrence， drug resistance， and significant side effects from chemotherapy and radiation therapy. With the development and application of traditional Chinese medicine （TCM）， it has been found that TCM and its active ingredients can effectively inhibit CRC cell proliferation， invasion， migration， and angiogenesis， and promote apoptosis and autophagy， thereby slowing the progression of CRC. This has become a key focus of CRC treatment research. Salvia Miltiorrhiza has multiple pharmacological effects， including activating blood circulation to dispel blood stasis， unlocking meridians to relieve pain， clearing heat to calm irritability， and cooling blood to reduce abscesses. It contains a variety of chemical components， including diterpenoids， phenolic acids， flavonoids， polysaccharides， nitrogen-containing compounds， steroids， and lactone compounds. This review summarized the molecular mechanisms of Salvia miltiorrhiza and its active ingredients in the treatment of CRC. It is found that these ingredients exert anti-CRC effects through various molecular mechanisms， including cell cycle arrest， promotion of apoptosis， inhibition of cell invasion and migration， induction of autophagy， suppression of tumor angiogenesis， and remodeling of the tumor microenvironment. The review aims to provide new insights for the drug development and clinical application of Salvia miltiorrhiza in CRC treatment.

Objective: To investigate the distribution characteristics of ABO and Rh blood group antigen phenotypes among blood donors in the Yantai, Shandong. Methods: Blood samples from 310 180 voluntary blood donors in Yantai collected from January 2019 to December 2023 were tested for ABO and Rh blood group antigens using standard serological methods. RhD-negative samples were further typed for C, c, E, and e antigens. Population genetic analysis of blood groups was performed: allele frequencies were inferred from ABO phenotypes, and Rh allele/haplotype frequencies were estimated based on the proportion of RhD-negative donors and CcEe antigen typing, followed by Hardy-Weinberg equilibrium testing. Results: The phenotypic distribution frequency of ABO blood groups was B(32.72%)>O(28.93%)>A(27.65%)>AB(10.70%). The inferred allele frequencies were r(53.74%)>q(24.78%)>p(21.48%), consistent with Hardy-Weinberg equilibrium (P>0.05). A total of 1 872 Rh-negative donors (0.603%) were identified. The most common Rh phenotypes were ccdee (59.56%) and Ccdee (30.18%). The distribution of Rh antigen phenotypes deviated significantly from Hardy-Weinberg equilibrium (χ =37.15, P<0.001), with the cde haplotype showing the highest frequency. There was no statistically significant difference in ABO blood group distribution between RhD-positive and RhD-negative donors (P>0.05). Conclusion: The ABO blood group distribution among voluntary blood donors in Yantai is generally stable and consistent with population genetic equilibrium, whereas the Rh antigen phenotype distribution deviates from equilibrium, indicating potential underlying genetic structural differences.

Objective To introduce the causes of accidents and the diagnosis and treatment of two patients with radiation-induced skin injury admitted to our hospital in 2023, and to provide a reference for the clinical treatment of subsequent radiation-induced skin injury. Methods The clinical treatment process of two patients with acute skin injury caused by external radiation exposure were summarized and analyzed. Results The exposure history of the two patients was reconstructed, the flaw detection scenario was simulated, the biological dose and hand skin exposure dose were estimated, and the infrared thermal imaging device was used for dynamic monitoring. A comprehensive analysis was conducted based on clinical manifestations and other data. The diagnosis of “Xie” was excessive exposure combined with acute radiation-induced skin injury on both hands (Grade IV for the right hand palm, index finger, and middle finger and Grade II for the left hand little finger). The diagnosis of “Hao” was acute radiation-induced skin injury on both hands (Grade I). The two patients received different clinical treatment measures: “Xie” was treated with both local and systemic therapies, while “Hao” was mainly treated with systemic therapy. Conclusion After systematic and effective treatment, the radiation-induced skin injuries healed in both patients.

ObjectiveTo identify potential influencing factors of urate crystal deposition at ankle/foot in patients with hyperuricemia （HUA）， and to analyze the predictive value of inflammatory indicators for urate crystal deposition in patients with different traditional Chinese medicine （TCM） syndromes， so as to provide potential reference for clinical risk assessment and individualized TCM intervention. MethodsA retrospective study was carried out with the enrollment of 231 HUA patients from The Third Affiliated People's Hospital of Fujian University of Traditional Chinese Medicine between January 2021 and December 2024. The enrolled patients were further divided into a crystal deposition-positive group （143 cases） and a crystal deposition-negative group （88 cases） according to the results of dual-energy computed tomography （CT）. Sociodemographic data， living habits， serum uric acid levels， and inflammatory indicators of the enrolled patients were collcted， and TCM syndrome differentiation was performed. Furthermore， univariate analysis was used to compare inter-group differences in clinical characteristics. MMultivariate Logistic regression was applied to identify the influencing factors of urate crystal deposition. In addition， the receiver operating characteristic （ROC） curves were plotted to evaluate the predictive efficacy of inflammatory indicators for crystal deposition across different TCM syndromes. ResultsThere were statistically significant inter-group differences in the proportion of males， age， body mass index， proportion of mental labor， rate of low water intake， and rate of high-sugar beverage consumption （P<0.05），whereas no significant difference in low exercise intensity was found between the two groups. Furthermore， compared with the negative group， the positive group had higher serum uric acid level， neutrophil-to-lymphocyte ratio （NLR）， and platelet-to-lymphocyte ratio （PLR）， but lower systemic immune-inflammation index （SIRI） （P<0.05）. Regarding the distribution of TCM syndromes， the positive group was dominated by the dampness-heat accumulation syndrome （55/143，38.46%）， while the negative group was mainly characterized by the phlegm-turbidity obstruction syndrome （44/88，50.00%）. Multivariate Logistic regression analysis revealed that high-sugar beverage consumption， elevated NLR， and elevated PLR were risk factors for urate crystal deposition ［odd ratio （OR） = 8.002， 5.377， 1.034， respectively； 95% CI 1.572-40.732， 2.179-13.270， 1.013-1.054，all P<0.05］， while SIRI was a protective factor （OR = 0.869， 95% CI 0.778-0.971， P<0.05）. In the positive group， patients with the dampness-heat accumulation syndrome exhibited the highest NLR， while the lowest PLR and SIRI， showing statistically significant differences with those of other syndromes （all P<0.05）. In addition， ROC curve analysis indicated that for the dampness-heat accumulation syndrome， the combined "NLR + PLR" model had an area under the curve （AUC） of 0.901 （95% CI 0.850-0.951， P<0.01）， with a sensitivity of 89.1% and a specificity of 79.5%； for the blood stasis-heat obstruction syndrome， the combined "NLR + PLR" model had an AUC of 0.880 （95% CI 0.825-0.934， P<0.01）， with a sensitivity of 100.0% and a specificity of 67.3%； for the liver-kidney Yin-deficiency syndrome， the single PLR model had an AUC of 0.842 （95% CI 0.731-0.952， P<0.01）， with a sensitivity of 83.3% and a specificity of 84.0%. ConclusionUrate crystal deposition in HUA patients exhibits intimate associations with high-sugar beverage consumption as well as elevated NLR and PLR levels. Meanwhile， TCM syndrome differentiation has potential correlation with inflammatory characteristics. The inflammatory indicator-based prediction model constructed based on TCM syndromes exhibits good predictive value.

ObjectiveTo explore the effect of serum containing Zhenwutang on myocardial mast cell apoptosis induced by angiotensin Ⅱ （AngⅡ） and the mechanism of the correlation between apoptosis and mitochondrial autophagy. MethodsIn this experiment， AngⅡ and serum containing Zhenwutang with different concentrations were used to interfere with H9C2 cardiomyocytes for 24 h， and the survival rate of H9C2 cardiomyocytes was detected by cell counting kit-8 （CCK-8） to screen the optimal concentration for the experiment. Enzyme-linked immunosorbent assay （ELISA） was used to detect the content of B-type natriuretic peptide （BNP） in cell culture supernatant， and immunofluorescence was used to detect the cell surface area to verify the construction of the myocardial mast cell model. Subsequently， the experiment was divided into a blank group （20% blank serum）， a model group （20% blank serum + 5×10^-5 mol·L^-1 AngⅡ）， low-， medium-， and high-dose （5%， 10% and 20%） serum containing Zhenwutang groups， an autophagy inhibitor group （1×10^-4 mol·L^-1 3-MA）， and autophagy inducer group （1×10^-7 mol·L^-1 rapamycin）. The apoptosis level of H9C2 cells and the changes of mitochondrial membrane potential were detected by flow cytometry. The lysosomal probe （Lyso Tracker） and mitochondrial probe （Mito Tracker） co-localization was employed to detect autophagy. Real-time fluorescence quantitative polymerase chain reaction （Real-time PCR） was used to detect Caspase-3， Caspase-9， B-cell lymphoma 2 （Bcl-2）， Bcl-2-related X protein （Bax）， and cytochrome C （Cyt C） in apoptosis-related pathways and the relative mRNA expression of ubiquitin ligase （Parkin）， phosphatase and tensin homolog （PTEN）-induced kinase 1 （PINK1）， and p62 protein in mitochondrial autophagy-related pathways. Western blot was used to detect cleaved Caspase-3， cleaved Caspase-9， Bax， Bcl-2， and Cyt C in apoptosis-related pathways， phosphorylated ubiquitin ligase （p-Parkin）， phosphorylated PTEN-induced kinase 1 （p-PINK1）， p62， and Bcl-2 homology domain protein Beclin1 in mitochondrial autophagy-related pathways， and the change of microtubule-associated protein 1 light chain 3 （LC3） Ⅱ/Ⅰ ratio. ResultsCCK-8 showed that when the concentration of AngⅡ was 5×10^-5 mol·L^-1， the cell activity was the lowest， and there was no cytotoxicity. At this concentration， the surface area of cardiomyocytes was significantly increased （P<0.01）， and the content of BNP in the supernatant of culture medium was significantly increased （P<0.05）. Therefore， AngⅡ with a concentration of 5×10^-5 mol·L^-1 was selected for the subsequent modeling of myocardial mast cells. Compared with the blank group， the model group and the autophagy inhibitor 3-MA group had a significantly increased apoptosis rate （P<0.01） and significantly decreased mitochondrial membrane potential （P<0.01）. The results of immunofluorescence co-localization showed that compared with the blank group， the model group had a significantly decreased number of red and green fluorescence spots. The results of Real-time PCR showed that compared with that in the blank group， the relative mRNA expression of Bax， Caspase-3， Caspase-9， Cyt C， and p62 in the model group was significantly up-regulated （P<0.01）， while the relative mRNA expression of Bcl-2， Parkin， and PINK1 was significantly down-regulated （P<0.01）. In addition， the relative protein expression of Bax， cleaved Caspase-3， cleaved Caspase-9， Cyt C， and p62 was significantly up-regulated （P<0.01）. The LC3Ⅱ/Ⅰ was significantly decreased， and the relative protein expression of Bcl-2， p-Parkin， p-PINK1， and Beclin1 was significantly down-regulated （P<0.01）. Compared with the model group， the serum containing Zhenwutang groups and the autophagy inducer group had significantly decreased apoptosis rate （P<0.01）， and the decrease ratio of mitochondrial membrane potential is significantly lowered （P<0.01） in a dose-dependent manner. Additionally， both red and green fluorescence spots became more in these groups. In the 3-MA group， the number of red and green fluorescence spots decreased significantly. The relative mRNA expression of Bax， Caspase-3， Caspase-9， Cyt C， and p62 was significantly down-regulated （P<0.05， P<0.01）， while that of Bcl-2， Parkin， and PINK1 was significantly up-regulated （P<0.01）. In the serum containing Zhenwutang groups， the relative protein expression levels of Bax， cleaved Caspase-3， cleaved Caspase-9， Cyt C， and p62 were significantly down-regulated （P<0.05，P<0.01）. The LC3Ⅱ/Ⅰ was significantly increased， and the relative protein expression levels of Bcl-2， p-Parkin， p-PINK1， and Beclin1 were significantly up-regulated （P<0.01）. ConclusionThe serum containing Zhenwutang can reduce the apoptosis of myocardial mast cells and increase mitochondrial autophagy. This is related to the inhibition of intracellular Bax/Bcl-2/Caspase-3 apoptosis pathway and regulation of Parkin/PINK1 mitochondrial autophagy pathway.

ObjectiveTo establish the fingerprints of 15 batches of Hengzhi Kechuan capsules， to quantitatively analyze 10 index components， and to evaluate the quality uniformity of samples from different batches. MethodsThe fingerprints and quantitative analysis of Hengzhi Kechuan capsules were established by a combination method of high performance liquid chromatography coupled with diode array detector and charged aerosol detector（HPLC-DAD-CAD）， adenosine， guanosine， vanillic acid， safflomin A， agarotetrol， naringin， hesperidin， militarine， ginsenoside Rb₁， and glycyrrhizic acid were selected as quality attribute indexes. A total of 15 batches of Hengzhi Kechuan capsules from 2022 to 2024（3 boxes per batch） were qualitatively and quantitatively analyzed， and the quality uniformity level of the manufacturers was characterized by parameters of intra-batch consistency（P_A） and inter-batch consistency（P_B）. The homogeneity and difference of quality attribute indexes of samples from different years were analyzed by heatmap clustering analysis. ResultsHPLC fingerprints and quantitative method of Hengzhi Kechuan capsules were established， and the methods could be used for qualitative and quantitative analysis of this preparation， which was found to be stable and reliable by method validation. The similarity of fingerprints of 15 batches of samples was 0.887-0.975， a total of 13 common peaks were calibrated， and 10 common peaks were designated， all of which were quality attribute index components. The results of quantitative analysis showed that the contents of the above 10 ingredients in the samples were 0.038-0.078， 0.115-0.251， 0.007-0.018， 0.291-0.673， 0.122-0.257， 0.887-1.905， 1.841-3.364， 1.412-2.450， 2.207-3.112， 0.650-1.161， respectively. And the contents of ginsenoside Rb₁ and glycyrrhizic acid met the limit requirements in the 2020 edition of Chinese Pharmacopoeia. For the samples from 15 batches， the P_A values of the 10 index components were all <10%， indicating good intra-batch homogeneity， and the P_B values ranged from 33.86% to 92.97%， suggesting that the inter-batch homogeneity was poor. Heatmap clustering analysis showed that the samples from different years were clustered into separate categories， and adenosine， guanosine， safflomin A， naringin， hesperidin and agarotetrol were the main differential components. ConclusionThe intra-annual quality uniformity of Hengzhi Kechuan capsules is good and the inter-annual quality uniformity is insufficient， which may be related to the quality difference of Pinellinae Rhizoma Praeparatum， Carthami Flos， Citri Sarcodactylis Fructus， Citri Reticulatae Pericarpium， Aquilariae Lignum Resinatum， Citri Fructus， etc. In this study， the fingerprint and multi-indicator determination method of Hengzhi Kechuan capsules was established， which can be used for more accurate and efficient quality control and standardization enhancement.

Objective To explore the construction of α-1,3-galactosyltransferase (GGTA1) gene-knockout (GTKO) Diannan miniature pigs and the kidney xenotransplantation from pigs to rhesus macaques, and to assess the effectiveness of GTKO pigs. Methods The GTKO Diannan miniature pigs were constructed using the CRISPR/Cas9 gene-editing system and somatic cell cloning technology. The phenotype of GTKO pigs was verified through polymerase chain reaction, Sanger sequencing and immunofluorescence staining. Flow cytometry was used to detect antigen-antibody (IgM) binding and complement-dependent cytotoxicity. Kidney xenotransplantation was performed from GTKO pigs to rhesus macaques. The humoral immunity, cellular immunity, coagulation and physiological indicators of the recipient monkeys were monitored. The function and pathological changes of the transplanted kidneys were analyzed using ultrasonography, hematoxylin-eosin staining, immunohistochemical staining and immunofluorescence staining. Results Single-guide RNA (sgRNA) targeting exon 4 of the GGTA1 gene in Diannan miniature pigs was designed. The pGL3-GGTA1-sgRNA1-GFP vector was transfected into fetal fibroblasts of Diannan miniature pigs. After puromycin selection, two cell clones, C59# and C89#, were identified as GGTA1 gene-knockout clones. These clones were expanded to form cell lines, which were used as donor cells for somatic cell nuclear transfer. The reconstructed embryos were transferred into the oviducts of trihybrid surrogate sows, resulting in 13 fetal pigs. Among them, fetuses F04 and F11 exhibited biallelic mutations in the GGTA1 gene, and F04 had a normal karyotype. Using this GTKO fetal pig for recloning and transferring the reconstructed embryos into the oviducts of trihybrid surrogate sows, seven surviving piglets were obtained, all of which did not express α-Gal epitope. The binding of IgM from the serum of rhesus monkey 20# to GTKO pig PBMC was reduced, and the survival rate of GTKO pig PBMC in the complement-dependent cytotoxicity assay was higher than that of wild-type pig. GTKO pig kidneys were harvested and perfused until completely white. After the left kidney of the recipient monkey was removed, the pig kidney was heterotopically transplanted. Following vascular anastomosis and blood flow restoration, the pig kidney rapidly turned pink without hyperacute rejection (HAR). Urine appeared in the ureter 6 minutes later, indicating successful kidney transplantation. The right kidney of the recipient was then removed. Seven days after transplantation, the transplanted kidney had good blood flow, the recipient monkey's serum creatinine level was stable, and serum potassium and cystatin C levels were effectively controlled, although they increased 10 days after transplantation. Seven days after transplantation, the levels of white blood cells, lymphocytes, monocytes and eosinophils in the recipient monkey increased, while platelet count and fibrinogen levels decreased. The activated partial thromboplastin time, thrombin time and prothrombin time remained relatively stable but later showed an upward trend. The recipient monkey survived for 10 days. At autopsy, the transplanted kidney was found to be congested, swollen and necrotic, with a small amount of IgG deposition in the renal tissue, and a large amount of IgM, complement C3c and C4d deposition, as well as CD68⁺ macrophage infiltration. Conclusions The kidneys of GTKO Diannan miniature pigs may maintain normal renal function for a certain period in rhesus macaques and effectively overcome HAR, confirming the effectiveness of GTKO pigs for xenotransplantation.

Using Real-time PCR technology, a highly specific and sensitive method for detecting DNA residues of Escherichia coli host cells in levodopa was established, validated, and preliminarily applied. Escherichia coli strain MB6 16S ribosomal RNA gene was selected as the target gene to design multiple pairs of primers and the target fragment by specific amplification of PCR was obtained. The target fragment was cloned into the pLENTI-BSD-CON vector and the recombinant plasmid was constructed and named pLENTI-BSD-CON-E.coli-16S. A quantitative PCR detection method (SYBR Green method) with magnetic bead extraction and purification methods was established with the reference standard of the recombinant plasmid. Furthermore, the established method was validated, including linear and range, accuracy, precision, specificity, and quantification limit, and applied to the detection of levodopa raw materials. Meanwhile, the detection method was compared with the Taqman probe method by the commercial kit. The primer sequences of the quantitative PCR detection method (SYBR Green method) were TTCGATGCAACGCGAAGAAC (forward) and GTGTAGCCCTGGTCGTAAGG (reverse). The standard curve of DNA was in the range of 10 fg/μL to 3 ng/μL with good linearity (R2≥ 0.98). The quantitative limit was 10 fg/μL. In addition, the detection recovery rate was in the range of 59.7% to 80.7%, with RSD at less than 15%. Nine batches of levodopa were detected by this method, and the amount of E.coli DNA residue was below the limit. The developed qPCR method can be used for quantitative detection of residual DNA in biological products produced by E.coli as host cells, such as levodopa . The results indicate that the sensitivity of the detection method for recombinant plasmid construction standards is superior than the reagent kit detection method.