1.Treatment of Recurrent Pediatric Cough and Asthma Based on the Theory of "Mutual Dependence of Ascending and Descending" from the Perspectives of Deficiency,Phlegm,and Blood Stasis
Yu LIU ; Ying DING ; Yongbin YAN ; Xuran GUO ; Linlin LIU
Journal of Traditional Chinese Medicine 2025;66(9):963-967
Guided by the theory of "mutual dependence of ascending and descending", recurrent pediatric cough and asthma are considered to result from the imbalance of the ascending and descending of zang-fu organ qi, which is closely associated with deficiency, phlegm, and blood stasis. In clinical practice, the disease is treated based on differentiation during the initial stage, progression stage, and stable stage. In the initial stage, the pathogenesis is attributed to lung deficiency complicated by external pathogens and liver qi rising to attack the lung; the treatment should focus on restraining the lung and calming the liver, using the self-formulated Longchai Yuchuan Fomulation (龙柴愈喘方). During the progression stage, the disorder is due to the spleen failing to ascend clear qi and the kidney failing to grasp qi, leading to phlegm formation from deficiency; treatment should focus on tonifying spleen yang, supplementing kidney qi, and resolving phlegm and fluid retention, using a modified combination of Linggui Zhugan Decoction (苓桂术甘汤) and Jinkui Shenqi Pill (金匮肾气丸). In the stable stage, qi deficiency leads to poor consolidation, with phlegm turbidity and blood stasis; the treatment should aim at tonifying qi, transforming phlegm, and dispelling blood stasis, using a modified version of Guizhi Fuling Pill (桂枝茯苓丸).
2.Objective characteristics of tongue manifestation in different stages of damp-heat syndrome in diabetic kidney disease
Zhaoxi DONG ; Yang SHI ; Jiaming SU ; Yaxuan WEN ; Zheyu XU ; Xinhui YU ; Jie MEI ; Fengyi CAI ; Xinyue ZANG ; Yan GUO ; Chengdong PENG ; Hongfang LIU
Journal of Beijing University of Traditional Chinese Medicine 2025;48(3):398-411
Objective:
To investigate the objective characteristics of tongue manifestation in different stages of damp-heat syndrome in diabetic kidney disease (DKD).
Methods:
A cross-sectional study enrolled 134 patients with DKD G3-5 stages who met the diagnostic criteria for damp-heat syndrome in DKD. The patients were treated at Dongzhimen Hospital, Beijing University of Chinese Medicine, from May 2023 to January 2024. The patients were divided into three groups: DKD G3, DKD G4, and DKD G5 stage, with 53, 33, and 48 patients in each group, respectively. Clinical general data (gender, age, and body mass index) and damp-heat syndrome scores were collected from the patients. The YZAI-02 traditional Chinese medicine (TCM) AI Tongue Image Acquisition Device was used to capture tongue images from these patients. The accompanying AI Open Platform for TCM Tongue Diagnosis of the device was used to analyze and extract tongue manifestation features, including objective data on tongue color, tongue quality, coating color, and coating texture. Clinical data and objective tongue manifestation characteristics were compared among patients with DKD G3-5 based on their DKD damp-heat syndrome status.
Results:
No statistically significant difference in gender or body mass index was observed among the three patient groups. The DKD G3 stage group had the highest age (P<0.05). The DKD G3 stage group had a lower score for symptoms of poor appetite and anorexia(P<0.05) than the DKD G5 group. No statistically significant difference was observed in damp-heat syndrome scores among the three groups. Compared with the DKD G5 stage group, the DKD G3 stage group showed a decreased proportion of pale color at the tip and edges of the tongue (P<0.05). The DKD G4 stage group exhibited an increased proportion of crimson at the root of the tongue, a decreased proportion of thick white tongue coating at the root, a decreased proportion of pale color at the tip and edges of the tongue, an increased hue value (indicating color tone) of the tongue color in the middle, an increased brightness value (indicating color lightness) of the tongue coating color in the middle, and an increased thickness of the tongue coating (P<0.05). No statistically significant difference was observed in other tongue color proportions, color chroma values, body characteristics, coating color proportions, coating color chroma values, and coating texture characteristics among the three groups.
Conclusion
Tongue features differ in different stages of DKD damp-heat syndrome in multiple dimensions, enabling the inference that during the DKD G5 stage, the degree of qi and blood deficiency in the kidneys, heart, lungs, liver, gallbladder, spleen, and stomach is prominent. Dampness is more likely to accumulate in the lower jiao, particularly in the kidneys, whereas heat evil in the spleen and stomach is the most severe. These insights provide novel ideas for the clinical treatment of DKD.
3.Study on toxicity-reducing and efficacy-enhancing effects of Polygala tenuifolia compatibility on sand-ironing Strychnos nux-vomica
Yi SUI ; Guo FENG ; Gang LIU ; Keyan LIU ; Xuehao WEI ; Minggang TENG ; Wei LI ; Caiyao HAN ; Yan LEI
China Pharmacy 2025;36(10):1197-1201
OBJECTIVE To explore the effects of Polygala tenuifolia compatibility on toxicity, anti-inflammatory and analgesic efficacy of sand-ironing Strychnos nux-vomica (SS). METHODS The preparation of SS single decoction, SS-P. tenuifolia core-removed (PC) (1∶2.5) or (1∶5) combined decoction, and SS-PC (1∶5) mixture were carried out to investigate their median lethal dose (LD50). Using aspirin as positive control, the number of writhing movements, analgesic rate, pain latency, ear swelling degree and inflammation inhibition rate induced by the above-mentioned medicinal liquids in mice were compared. The contents of the active and toxic components, strychnine and brucine, in the above-mentioned medicinal liquids were also determined. RESULTS The LD50 values of SS single decoction, SS-PC (1∶2.5) combined decoction, SS-PC (1∶5) combined decoction and SS- PC (1∶5) mixture were 302.00, 614.47, 1 445.44 and 1 778.28 mg/kg, respectively. Compared with control group, the number of writhing movements and ear swelling degree in the mice of the above-mentioned medicinal liquid groups were reduced or decreased significantly (P<0.05 or P<0.01); pain latency [at 90 and 120 minutes in the SS single decoction group, at 60 and 90 minutes in the SS-PC (1∶2.5) combined decoction group, and at 60,90, 120 minutes in the SS-PC (1∶5) combined decoction group and SS-PC (1∶5) mixture group] was significantly prolonged (P<0.05 or P<0.01); analgesic rates of the respective medicinal liquids were 39.30%, 70.87%, 80.00% and 82.46%, and inflammation inhibition rates were 38.08%,TD 57.89%, 76.47% and 50.46%; analgesic and anti-inflammatory effects of combined decoction and mixture were generally better than those of the single decoction (P<0.05 or P<0.01). In the above-mentioned four medicinal liquids, the total contents of strychnine were 0.71%, 0.42%, 0.47% and 0.64%, and the total contents of brucine were 0.88%, 0.63%, 0.57% and 0.88%, respectively. CONCLUSIONS The combination of P. tenuifolia can reduce the toxicity of SS and enhance its anti-inflammatory and analgesic effects. Moreover, there is a tendency for the toxicity-reducing and efficacy-enhancing effects to increase with the increasing dosage of P. tenuifolia. Additionally, the combined decoction of SS and P. tenuifolia can reduce the contents of the active and toxic components, strychnine and brucine, in SS.
4.Ablation of IGFBP5 expression alleviates neurogenic erectile dysfunction by inducing neurovascular regeneration
Jiyeon OCK ; Guo Nan YIN ; Fang-Yuan LIU ; Yan HUANG ; Fitri Rahma FRIDAYANA ; Minh Nhat VO ; Ji-Kan RYU
Investigative and Clinical Urology 2025;66(1):74-86
Purpose:
To investigate the therapeutic potential of eliminating insulin-like growth factor-binding protein 5 (IGFBP5) expression in improving erectile function in mice with cavernous nerve injury (CNI)-induced erectile dysfunction (ED).
Materials and Methods:
Eight-week-old male C57BL/6 mice were divided into four groups: a sham-operated group and three CNI-induced ED groups. The CNI-induced ED groups were treated with intracavernous injections 3 days before the CNI procedure.These injections included phosphate-buffered saline, scrambled control short hairpin RNA (shRNA), or shRNA targeting mouse IGFBP5 lentiviral particles. One week after CNI, erectile function was evaluated and the penile tissue was then harvested for histological examination and western blot analysis. Additionally, the major pelvic ganglia (MPG) and dorsal root ganglia (DRG) were cultured for ex vivo neurite outgrowth assays.
Results:
Following CNI, IGFBP5 expression in the cavernous tissues significantly increased, reaching its peak at day 7. First, ablation of IGFBP5 expression promotes neurite sprouting in MPG and DRG when exposed to lipopolysaccharide. Second, ablating IGFBP5 expression in CNI-induced ED mice improved erectile function, likely owing to increased neurovascular contents, including endothelial cells, pericytes, and neuronal processes. Third, ablating IGFBP5 expression in CNI-induced ED mice promoted neurovascular regeneration by increasing cell proliferation, reducing apoptosis, and decreasing Reactive oxygen species production. Finally, western blot analysis demonstrated that IGFBP5 ablation attenuated the JNK/c-Jun signaling pathway, activated the PI3K/AKT signaling pathway, and increased vascular endothelial growth factor and neurotrophic factor expression.
Conclusions
Ablating IGFBP5 expression enhanced neurovascular regeneration and ultimately improved erectile function in CNI-induced ED mice.
5.Comparison of decompression effects between spine endoscopy hybrid technique and uniportal endoscopic surgery in treatment of lumbar spinal stenosis with bilateral symptom
Song GUO ; Xinhua LI ; Meijun YAN ; Yanbin LIU ; Zhong LIU ; Kewei LI ; Pengcheng LIU ; Beiting ZHANG ; Qiang FU
Chinese Journal of Tissue Engineering Research 2025;29(3):517-523
BACKGROUND:Spinal canal decompression using uniportal endoscopic surgery is a new minimally invasive surgery in the treatment of lumbar spinal stenosis.However,this technique needs a steep learning curve and high requirements for surgical equipment and instruments,which limits its clinical application.We previously use the spinal endoscopy as a monitoring endoscopy and combined with unilateral biportal endoscopy to propose a hybrid technique of spinal endoscopy to achieve coaxial endoscopic operation and hands-separate operation. OBJECTIVE:To compare the clinical outcome of hybrid technique and uniportal endoscopic surgery in treatment of lumbar spinal stenosis with bilateral lower limb pain symptoms. METHODS:Ninety patients diagnosed of lumbar spinal stenosis with bilateral symptoms were included and retrospectively analyzed at First People's Hospital,Shanghai Jiao Tong University from August 2020 to August 2022.44 cases were included in group A(hybrid technique group),while 46 cases were included in group B(uniportal endoscopic surgery).The nerve decompression was observed during the surgery.Operation time,hospital stay time,and expenses were recorded in both groups.The visual analog scale scores of lower back pain and both lower extremities pain,Oswestry disability index scores of quality of life and excellent and good rate of modified Macnab criteria were recorded and compared at preoperative,postoperative 3 days,and postoperative 3 and 6 months. RESULTS AND CONCLUSION:(1)The operation time of group A was significantly shorter than that of group B(P<0.05).(2)The lower back pain and lower extremity pain of the severe side at postoperative 3 days,and 3 and 6 months were significantly relieved in both groups(P<0.05).The visual analog scale score of lower extremity pain on the mild side was significantly decreased at postoperative 3 days,3 and 6 months than preoperative score in the group A(P<0.05).The visual analog scale score of lower extremity pain on the mild side was significantly decreased at postoperative 3 days than preoperative score in the group B(P<0.05).The visual analog scale scores of lower extremity pain on the mild side at postoperative 3 and 6 months did not show significant difference than preoperative score in the group B.The comparison between the two groups showed that there was no significant difference in the visual analog scale scores of postoperative lower back pain and lower extremity pain of the severe side(P>0.05).The visual analog scale scores of lower extremity pain on the mild side in the group A were significantly lower than those of group B at postoperative 3 and 6 months(P<0.05).(3)The Oswestry disability index scores of both groups at postoperative 3 day were significantly lower than preoperative score(P<0.05),and there was no significant difference between the two groups 3 days after operation.Oswestry disability index scores of group A at postoperative 3 and 6 months were significantly decreased than preoperative score(P<0.05).The Oswestry disability index scores of group B at postoperative 3 and 6 months did not show significant differences than preoperative score(P>0.05).The comparison between the two groups showed the Oswestry disability index scores of group A were significantly lower than group B at postoperative 3 and 6 months(P<0.05).(4)The results of modified Macnab showed that the excellent and good rate of group A was significantly higher than that of group B(95%,78%,P<0.05).(5)It is indicated that the hybrid technique is a new spinal endoscopy technique,which has the advantages of less trauma and faster recovery as a minimally invasive surgery.The clinical outcome of hybrid technique is superior to that of uniportal endoscopic surgery in the treatment of lumbar spinal stenosis with bilateral symptoms.Additionally,it also has the advantages of good operational flexibility and high decompression efficiency as an open surgery.
6.Disease burden of chronic kidney disease attributable to high BMI in China and trend prediction in 1992-2021
Hong LIU ; Guimao YANG ; Yan SUI ; Xia ZHANG ; Xuebing CHENG ; Yaxing WU ; Xu GUO ; Yanfeng REN
Journal of Public Health and Preventive Medicine 2025;36(1):27-31
Objective To analyze the disease burden of chronic kidney diseases (CKD) attributed to high body mass index (BMI) in China from 1992 to 2021 and predict the disease burden for the next decade, and to provide evidence for the prevention and treatment of CKD. Methods Using the Global Burden of Disease (GBD) database and the Joinpoint model, the average annual percentage rate change (AAPC) of the mortality rate and disability-adjusted life year (DALY) rate was calculated to describe and analyze the CKD disease burden attributed to high BMI in China from 1992 to 2021. The ARIMA model was employed to predict and analyze the change trend of the CKD disease burden. Results From 1992 to 2021, the mortality rate and DALY rate attributed to high BMI-induced chronic kidney disease showed an upward trend. Compared to 1992, the attributed number of deaths increased by 324.38%, and DALYs increased by 268.56%; the mortality rate increased by 64.00%, and the DALY rate grew by 51.62%. From 1992 to 2021, the mortality rate and DALY rate for males were lower than those for females, but the growth rate for males exceeded that of females. From 1992 to 2021, the mortality rate and DALY rate of chronic kidney disease attributed to high BMI in China increased with age. The average annual change rate of chronic kidney disease attributed to high BMI in China from 1992 to 2021 (mortality rate: 1.40 per 100,000 (95% CI: 1.04–1.76), DALY rate: 1.43 per 100 000 (95% CI: 1.17–1.70)) was higher than thHuaiyin Normal University, Huai'anher social demographic index (SDI) regions. The ARIMA model predicted that the age-standardized mortality rate increased from 2.91 per 100 000 in 2022 to 3.05 per 100 000 in 2026, and the age-standardized DALY rate increased from 69.65 per 100 000 in 2022 to 73.58 per 100 000 in 2026. Conclusion Chronic kidney disease attributed to high BMI in China is on the rise, and it will continue to grow in the future. The focus of CKD prevention and control should be on males and the elderly, while active measures should be taken to reduce the occurrence and progression of chronic kidney disease.
7.Establishment of a Gastrointestinal-Brain Inter-Organ Multimodal Characterization System Based on Traditional Chinese Medicine Theory and Its Application in Refractory Diseases
Guanghui HAN ; Yan GUO ; Peijing RONG ; Bin CONG ; Shuangjiang LIU ; Shaoyuan LI ; Wei WEI
Journal of Traditional Chinese Medicine 2025;66(6):561-568
The concept of holism is the core idea of traditional Chinese medicine (TCM). Various organs and tissues coordinate with each other to maintain the body's life activities, with a close and mutual influence between the spleen, stomach, and the central nervous system (brain). The gut-brain axis plays an important bridging role between the digestive system and the central nervous system, achieving bidirectional information exchange between the brain and the gastrointestinal tract through complex neuroendocrine and immune mechanisms. The theory of cross-organ interaction involves the mutual influence, coordination, and integration between different organs and systems; multimodality, on the other hand, utilizes multiple sensory modalities, such as vision, hearing, and touch, to convey information. By combining TCM theory with the gut-brain axis theory, a cross-organ multimodal characterization system is established to explore its mechanism and application value in refractory diseases such as functional gastrointestinal disorders, precancerous gastrointestinal diseases, Alzheimer's disease, Parkinson's syndrome, type 2 diabetes, and depression.
8.Analysis of Quality Uniformity of Hengzhi Kechuan Capsules Based on HPLC-DAD-CAD
Qian MA ; An LIU ; Qingxia XU ; Cong GUO ; Jun ZHANG ; Maoqing WANG ; Xiaodi KOU ; Yan LIU
Chinese Journal of Experimental Traditional Medical Formulae 2025;31(3):168-174
ObjectiveTo establish the fingerprints of 15 batches of Hengzhi Kechuan capsules, to quantitatively analyze 10 index components, and to evaluate the quality uniformity of samples from different batches. MethodsThe fingerprints and quantitative analysis of Hengzhi Kechuan capsules were established by a combination method of high performance liquid chromatography coupled with diode array detector and charged aerosol detector(HPLC-DAD-CAD), adenosine, guanosine, vanillic acid, safflomin A, agarotetrol, naringin, hesperidin, militarine, ginsenoside Rb1, and glycyrrhizic acid were selected as quality attribute indexes. A total of 15 batches of Hengzhi Kechuan capsules from 2022 to 2024(3 boxes per batch) were qualitatively and quantitatively analyzed, and the quality uniformity level of the manufacturers was characterized by parameters of intra-batch consistency(PA) and inter-batch consistency(PB). The homogeneity and difference of quality attribute indexes of samples from different years were analyzed by heatmap clustering analysis. ResultsHPLC fingerprints and quantitative method of Hengzhi Kechuan capsules were established, and the methods could be used for qualitative and quantitative analysis of this preparation, which was found to be stable and reliable by method validation. The similarity of fingerprints of 15 batches of samples was 0.887-0.975, a total of 13 common peaks were calibrated, and 10 common peaks were designated, all of which were quality attribute index components. The results of quantitative analysis showed that the contents of the above 10 ingredients in the samples were 0.038-0.078, 0.115-0.251, 0.007-0.018, 0.291-0.673, 0.122-0.257, 0.887-1.905, 1.841-3.364, 1.412-2.450, 2.207-3.112, 0.650-1.161, respectively. And the contents of ginsenoside Rb1 and glycyrrhizic acid met the limit requirements in the 2020 edition of Chinese Pharmacopoeia. For the samples from 15 batches, the PA values of the 10 index components were all <10%, indicating good intra-batch homogeneity, and the PB values ranged from 33.86% to 92.97%, suggesting that the inter-batch homogeneity was poor. Heatmap clustering analysis showed that the samples from different years were clustered into separate categories, and adenosine, guanosine, safflomin A, naringin, hesperidin and agarotetrol were the main differential components. ConclusionThe intra-annual quality uniformity of Hengzhi Kechuan capsules is good and the inter-annual quality uniformity is insufficient, which may be related to the quality difference of Pinellinae Rhizoma Praeparatum, Carthami Flos, Citri Sarcodactylis Fructus, Citri Reticulatae Pericarpium, Aquilariae Lignum Resinatum, Citri Fructus, etc. In this study, the fingerprint and multi-indicator determination method of Hengzhi Kechuan capsules was established, which can be used for more accurate and efficient quality control and standardization enhancement.
9.Detection of residual DNA in host cells of Escherichia coli in levodopa by Real-time PCR
Bingyu XU ; YAN LIU ; Xinyao GUO ; Fang YAN ; Guibin SUN
Journal of China Pharmaceutical University 2025;56(2):176-182
Using Real-time PCR technology, a highly specific and sensitive method for detecting DNA residues of Escherichia coli host cells in levodopa was established, validated, and preliminarily applied. Escherichia coli strain MB6 16S ribosomal RNA gene was selected as the target gene to design multiple pairs of primers and the target fragment by specific amplification of PCR was obtained. The target fragment was cloned into the pLENTI-BSD-CON vector and the recombinant plasmid was constructed and named pLENTI-BSD-CON-E.coli-16S. A quantitative PCR detection method (SYBR Green method) with magnetic bead extraction and purification methods was established with the reference standard of the recombinant plasmid. Furthermore, the established method was validated, including linear and range, accuracy, precision, specificity, and quantification limit, and applied to the detection of levodopa raw materials. Meanwhile, the detection method was compared with the Taqman probe method by the commercial kit. The primer sequences of the quantitative PCR detection method (SYBR Green method) were TTCGATGCAACGCGAAGAAC (forward) and GTGTAGCCCTGGTCGTAAGG (reverse). The standard curve of DNA was in the range of 10 fg/μL to 3 ng/μL with good linearity (R2≥ 0.98). The quantitative limit was 10 fg/μL. In addition, the detection recovery rate was in the range of 59.7% to 80.7%, with RSD at less than 15%. Nine batches of levodopa were detected by this method, and the amount of E.coli DNA residue was below the limit. The developed qPCR method can be used for quantitative detection of residual DNA in biological products produced by E.coli as host cells, such as levodopa . The results indicate that the sensitivity of the detection method for recombinant plasmid construction standards is superior than the reagent kit detection method.
10.The Regulatory Role of Glucose Transporter 1 on the Function of Human Umbilical Vein Endothelial Cells Under Ischemia-hypoxic Conditions
Meiling LI ; Siqi GAO ; Zhefu LIU ; Huanyan LIAO ; Fanmao LIU ; Wenhao XIA ; Jun GUO ; Yan LI
Journal of Sun Yat-sen University(Medical Sciences) 2025;46(3):444-455
Abstract: ObjectiveThe study aims to explore the effects and regulatory roles of glucose transporter 1 (GLUT1) on the proliferation, migration, adhesion, and angiogenesis of human umbilical vein endothelial cells (HUVECs) under ischemia-hypoxic conditions. MethodsIn vitro experiments were conducted to subject HUVECs to an ischemia-hypoxic-mimicking environment (1% O2, 5% CO2, 94% N2). The biological characteristics of HUVECs under normoxic and ischemia-hypoxic conditions were compared by assessing cell viability, proliferation capacity, and examining the expression changes of GLUT1, HIF-1α, and VEGFA proteins under ischemia-hypoxia using Western blot technology. Further, GLUT1 was overexpressed using plasmid transfection and the proliferation, migration, adhesion, and angiogenic capabilities of HUVECs were evaluated through scratch assays, cell adhesion assays, and tube formation assays. Mitochondrial morphological changes were observed by transmission electron microscopy,and oxygen consumption rate (OCR) was detected by Seahorse metabolic analyzer to evaluate mitochondrial function. ResultsCompared with normoxic conditions, the ischemia-hypoxic environment significantly inhibited the proliferation, cell viability, migration, and adhesion capabilities of HUVECs and impaired their angiogenic potential. The expression levels of GLUT1, HIF-1α and VEGFA proteins were also markedly reduced. However, when GLUT1 expression was upregulated, the migration, adhesion, and angiogenic capabilities of HUVECs were significantly improved, and the protein expression levels of HIF-1α, VEGFA and VEGFR were increased. Transmission electron microscopy revealed that ischemic-hypoxia leads to mitochondrial swelling and matrix damage, while GLUT1 overexpression significantly alleviates mitochondrial morphology abnormalities. OCR results suggest that GLUT1 overexpression may enhance oxidative phosphorylation of endothelial cells in ischemic-hypoxic environments to improve energy metabolism. These results suggest that GLUT1 may influence the function and angiogenic potential of HUVECs by regulating glucose metabolism and energy supply. ConclusionsThis study reveals the significant regulatory role of GLUT1 in the function of HUVECs under ischemia-hypoxic conditions, potentially through modulating cellular energy metabolism and signal transduction pathways, thereby affecting cell proliferation, migration, adhesion, and angiogenesis. These findings provide a new perspective on the role of GLUT1 in cardiovascular diseases and may offer potential targets for the development of new therapeutic strategies.


Result Analysis
Print
Save
E-mail