Using Real-time PCR technology, a highly specific and sensitive method for detecting DNA residues of Escherichia coli host cells in levodopa was established, validated, and preliminarily applied. Escherichia coli strain MB6 16S ribosomal RNA gene was selected as the target gene to design multiple pairs of primers and the target fragment by specific amplification of PCR was obtained. The target fragment was cloned into the pLENTI-BSD-CON vector and the recombinant plasmid was constructed and named pLENTI-BSD-CON-E.coli-16S. A quantitative PCR detection method (SYBR Green method) with magnetic bead extraction and purification methods was established with the reference standard of the recombinant plasmid. Furthermore, the established method was validated, including linear and range, accuracy, precision, specificity, and quantification limit, and applied to the detection of levodopa raw materials. Meanwhile, the detection method was compared with the Taqman probe method by the commercial kit. The primer sequences of the quantitative PCR detection method (SYBR Green method) were TTCGATGCAACGCGAAGAAC (forward) and GTGTAGCCCTGGTCGTAAGG (reverse). The standard curve of DNA was in the range of 10 fg/μL to 3 ng/μL with good linearity (R2≥ 0.98). The quantitative limit was 10 fg/μL. In addition, the detection recovery rate was in the range of 59.7% to 80.7%, with RSD at less than 15%. Nine batches of levodopa were detected by this method, and the amount of E.coli DNA residue was below the limit. The developed qPCR method can be used for quantitative detection of residual DNA in biological products produced by E.coli as host cells, such as levodopa . The results indicate that the sensitivity of the detection method for recombinant plasmid construction standards is superior than the reagent kit detection method.

To analyze the current quality of treatment for hospitalized cancer patients in Beijing, identify major issues in treatment practices, and propose improvements.

Surgical innovation is an important part of surgical research and practice. The evaluation of surgical innovation through the stages is similar to those for drug development, but with important differences. The Idea, Development, Exploration, Assessment, and Long-term follow-up (IDEAL) Framework and Recommendations represent a new paradigm for the evaluation of surgical intervention and devices which was developed in 2009. The IDEAL is a five-stage framework involving the nature stages of surgical innovation, together with recommendations for surgical research pathway. The Framework and Recommendations were updated and published in 2019, which added a pre-IDEAL stage if necessary. The updated IDEAL also underlines the purpose, key question and ethical issues for each stage. In the first paper of IDEAL Framework and Recommendations series, we conducted a comprehensive introduction of IDEAL (e.g. the development, updates and application of IDEAL) to promote the dissemination and application of IDEAL in China.

Adherence to reporting guidelines contributes to report methodology and outcomes of research distinctly and transparently. There are some checklists with specific study types related to surgery on the EQUATOR Network’s website. However, the IDEAL framework focuses on stepwise evaluation of surgical innovation through all stages with some key elements, which those existing guidelines may not mention. This likely results in the inaccuracy in reporting in studies attempting to follow the IDEAL recommendations and suggests a pressing need for IDEAL reporting guidelines. Considering these limitations, the IDEAL developed the IDEAL reporting guidelines between October 2018 and May 2019. The paper aimed to provide interpretation of IDEAL reporting guideline, and promote its understanding and use among Chinese researchers.

Objective:To investigate the therapeutic effect of different prone position ventilation (PPV) on patients with severe acute respiratory distress syndrome (ARDS) at high altitude.Methods:The severe ARDS patients who met the Berlin standard admitted to the department of intensive care unit (ICU) of Qinghai Provincial People's Hospital from January 2017 to January 2020 were enrolled. The patients with classic PPV treatment (i.e. alternate prone supine position, about 16 hours per day) were included in the discontinuous PPV group; the patients with modified PPV treatment (i.e. alternate left and right prone positions 20°-30°, every 4 hours and continuous treatment for 24 hours per day) were included in the continuous PPV group. The oxygenation index (PaO 2/FiO 2), mechanics of breathing, ventilator parameters before treatment and 72 hours after treatment, and mechanical ventilation time, the length of ICU stay, and related complications between the two groups were analyzed. Results:Eighteen cases were treated with continuous PPV and 20 cases were treated with discontinuous PPV. There were no significant differences in gender, age, acute physiology and chronic health evaluation Ⅱ (APACHEⅡ), PaO 2/FiO 2, lung compliance, driving pressure (ΔP) and positive end expiratory pressure (PEEP) before treatment between the two groups. Compared with before treatment, PaO 2/FiO 2 in discontinuous PPV group and continuous PPV group was increased significantly after 72-hour treatment [mmHg (1 mmHg = 0.133 kPa): 99.7±15.4 vs. 55.5±6.3, 121.8±25.3 vs. 55.1±7.1, both P < 0.05], lung compliance was improved significantly (mL/cmH 2O: 36.8±2.4 vs. 28.0±2.0, 43.4±6.7 vs. 27.7±2.1, both P < 0.05), and ΔP was decreased significantly [cmH 2O (1 cmH 2O = 0.098 kPa): 10.5 (10.0, 12.0) vs. 13.0 (12.3, 14.0), 10.0 (8.0, 12.0) vs. 13.0 (12.0, 14.0), both P < 0.05], PEEP was also decreased [cmH 2O: 12 (12, 14) vs. 14 (13, 14), 10 (8, 10) vs. 14 (12, 15), both P < 0.05], and the indexes in continuous PPV group were improved more significantly than those in discontinuous PPV group [PaO 2/FiO 2 (mmHg): 121.8±25.3 vs. 99.7±15.4, lung compliance (mL/cmH 2O): 43.4±6.7 vs. 36.8±2.4, ΔP (cmH 2O): 10.0 (8.0, 12.0) vs. 10.5 (10.0, 12.0), PEEP (cmH 2O): 10 (8, 10) vs. 12 (12, 14), all P < 0.05]. The duration of mechanical ventilation and the length of ICU stay in the continuous PPV group were significantly shorter than those in the intermittent PPV group [days: 6.0 (5.0, 7.3) vs. 8.0 (7.0, 9.0), 9.7±1.5 vs. 12.1±2.2, both P < 0.01]. During the PPV treatment, there were 3 cases of cheek skin damage and 2 cases of ear skin damage in the continuous PPV group, and 3 cases of facial skin damage in the intermittent PPV group. There was no significant difference in the incidence of complications between the two groups ( χ2 = 0.321, P = 0.571). All patients were repaired normally after PPV, without adverse consequences. Conclusion:Continuous PPV is more effective than discontinuous PPV in the treatment of severe ARDS patients at high altitude, and the related complications are did not increased in prolonged time of PPV.

Objective:To explore the clinical significance of recurrent laryngeal nerve inlet zone(RLNIZ) lymph node metastasis in papillary thyroid cancer(PTC).Methods:The clinical data of the clinicopathologic characteristics of 738 cases with papillary thyroid cancer at our centers from Jul 2017 to Jun 2018 was retrospectively reviewed. 108 cases with RLNIZ lymph node dissection for pathological examination were included. The relationship between metastasis of RLNIZ lymph node and clinicopathologic characteristics was analyzed.Results:RLNIZ lymph node was detected in 12.3%(91/738)cases, the mean lymph node number in RLNIZ was 1.5±0.7, and 30.8%(28/91) cases suffered RLNIZ lymph node metastasis. RLNIZ lymph node metastasis(LNM) is associated with tumor size( P=0.028), capsular invasion( P=0.019), No. of central compartment LNM( P<0.001) and lateral neck LNM( P<0.001). No. of central compartment LNM was found to be the independent risk factor of RLNIZ lymph node metastasis. The incidence of dysphagia and inferior parathyroid damage was 0.9%(1/108)respectively. Conclusions:RLNIZ lymph node metastasis is common among PTC patients , therefore, RLNIZ lymph node should be routinely removed especially in patients with tumor size over 1cm、suspected capsular invasion and lateral neck lymph node metastasis confirmed by preoperative imaging examination.

Objective:To explore the expression and clinical significance of miR-143 in papillary thyroid cancer (PTC) .Methods:Tumor samples and adjacent tissues from 52 patients with PTC were obtained from Jan. 1st, 2018 to Mar. 31st, 2018 in Thyroid Surgery Department of the Affiliated Yantai Yuhuangding Hospital of Qingdao University. Quantitative reverse-transcriptase PCR (RT-qPCR) was used to measure the expression of miR-143 in those subjects. In addition, the relationship between the expression levels of miR-143 and the clinicopathological characteristics was analyzed.Results:RT-qPCR indicated that the expression of miR-143 was down-regulated in PTC, which was significantly lower than that in adjacent tissues ( t=-21.39, 95% CI: 18.20-15.07, P<0.001) . Low expression of miR-143 was related to the number of lymph node metastasis ≥3 in central compartment ( t=10.13, P=0.012) and lateral neck lymph node metastasis ( t=-4.67, P<0.001) . Conclusion:Downregulation of miR-143 in PTC is linked to the metastasis of PTC and may be a potential target for therapeutic intervention.

Exposure of airborne particulate matter (PM) with an aerodynamic diameter less than 2.5 lm (PM2.5) is epidemiologically associated with lung dysfunction and respiratory symptoms, including pulmonary fibrosis. However, whether epigenetic mechanisms are involved in PM2.5-induced pulmonary fibrosis is currently poorly understood. Herein, using a PM2.5-induced pulmonary fibrosis mouse model, we found that PM2.5 exposure leads to aberrant mRNA 5-methylcytosine (m5C) gain and loss in fibrotic lung tissues. Moreover, we showed the m5C-mediated regulatory map of gene functions in pulmonary fibrosis after PM2.5 exposure. Several genes act as m5C gain-upregulated factors, probably critical for the development of PM2.5-induced fibrosis in mouse lungs. These genes, including Lcn2, Mmp9, Chi3l1, Adipoq, Atp5j2, Atp5l, Atpif1, Ndufb6, Fgr, Slc11a1, and Tyrobp, are highly related to oxidative stress response, inflammatory responses, and immune system processes. Our study illustrates the first epitranscrip-tomic RNA m5C profile in PM2.5-induced pulmonary fibrosis and will be valuable in identifying biomarkers for PM2.5 exposure-related lung pathogenesis with translational potential.

Objective: To explore the clinical significance of metastasis of lymph nodes between sternocleidomastoid and sternohyoid muscle (LNSS) in papillary thyroid cancer (PTC). Methods: A total of 175 patients with PTC who underwent thyroidectomy with LNSS dissection were retrospectively analyzed. Univariate and multivariate Logistic regression analyses were used to determine the independent risk factors for LNSS metastasis in PTC. Results: The rate of detectable LNSS was 70.9% (124/175) and metastasis rate was 7.4% (13/175). Of 13 cases with LNSS metastasis, 10 with the coexistence of cervical lymph node metastasis. Univariate Logistic regression analysis showed that multiple focal cancer, tumor located in the lower pole of thyroid, belt-shaped muscle invasion, lateral cervical lymph node metastasis, cN+ , the number of cervical lymph nodes with metastasis and the number of lymph nodes with metastasis in level Ⅳwere the risk factors for LNSS metastasis (P<0.05). Multivariate Logistic regression analysis suggested that tumor located in the lower pole of thyroid and the number of cervical lymph nodes with metastasis >6 were the independent risk factors for LNSS metastasis (P<0.05). Given the number of cervical lymph nodes with metastasis as a predictor for the LNSS metastasis, the sensitivity was 92.3%, the specificity was 66.7% and the accuracy rate was 68.6%. Conclusions LNSS metastasis is commom in PTC, with a metastasis rate of 7.4%. PTC in the lower pole of thyroid and the number of cervical lymph nodes with metastasis > 6 are independent risks for LNSS metastasis.