1.Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood.
Juan YE ; Feng YE ; Ling HOU ; Wei WU ; Xiao-Ping LUO ; Yan LIANG
Chinese Journal of Contemporary Pediatrics 2025;27(1):94-100
OBJECTIVES:
To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.
METHODS:
A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.
RESULTS:
All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.
CONCLUSIONS
This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Male
;
Female
;
Child
;
Retrospective Studies
;
Glucokinase/genetics*
;
Adolescent
;
Child, Preschool
;
Glucose Tolerance Test
2.Hyperglycemia in pediatric age: could it be maturity onset diabetes of the young? Case reports and review of the literature
Mafalda CASCAIS ; Ester PEREIRA ; Alexandra VIEIRA ; Margarida VENÂNCIO ; Lina RAMOS ; Pascoal MOLEIRO
Annals of Pediatric Endocrinology & Metabolism 2019;24(4):262-266
Maturity Onset Diabetes of the Young (MODY) includes a clinically and genetically heterogeneous group of diabetes subtypes with MODY-2 being the second most prevalent form. We report 2 cases of MODY-2 identified during the investigation of asymptomatic hyperglycemia. A 12-year-old girl with a familiar history of diabetes (mother, maternal aunt, and maternal grandfather) was referred due to hypercholesterolemia, abnormal fasting glucose (114 mg/dL), and increased levels of glycated haemoglobin (HbA(1c)) (6%) presenting with negative β-cell antibodies. A glucokinase (GCK) heterozygous missense mutation c.364C>T (p.Leu122Phe) in exon 4 was identified in the index patient and in the 3 family members. An obese 9-year-old boy was investigated for elevated fasting glycemic levels (99–126 mg/dL), HbA(1c) rise (6.6%–7.6%), and negative β-cell antibodies. The patient's father, paternal aunt, and paternal grandfather had a history of diabetes during their childhood. A GCK heterozygous missense mutation c.698G>A (p.Cys233Tyr) in exon 7 was identified in the index patient. This variant was only described in another family strongly affected by both MODY and classic autoimmune mediated diabetes, contrary to our case. MODY-2 should be suspected in the presence of early onset of persistent mild fasting hyperglycemia and negative β-cell antibodies associated with a positive family history of diabetes. These cases illustrate the challenging aspects of MODY diagnosis due to possible phenotypic overlap with other types of diabetes. The diagnosis requires a high level of suspicion and GCK genetic screening should be performed in the presence of compatible features. An early diagnosis allows for appropriate management, genetic counselling, and the identification of affected family members.
Antibodies
;
Child
;
Diabetes Mellitus, Type 2
;
Diagnosis
;
Early Diagnosis
;
Exons
;
Fasting
;
Fathers
;
Female
;
Genetic Testing
;
Glucokinase
;
Glucose
;
Grandparents
;
Humans
;
Hypercholesterolemia
;
Hyperglycemia
;
Male
;
Mutation, Missense
3.New Perspectives in Pediatric Nonalcoholic Fatty Liver Disease: Epidemiology, Genetics, Diagnosis, and Natural History
Pediatric Gastroenterology, Hepatology & Nutrition 2019;22(6):501-510
Nonalcoholic fatty liver disease (NAFLD) is the most common cause of chronic liver disease in children. The global prevalence of pediatric NAFLD from general populations is 7.6%. In obese children, the prevalence is higher in Asia. NAFLD has a strong heritable component based on ethnic difference in the prevalence and clustering within families. Genetic polymorphisms of patatin-like phospholipase domain–containing protein 3 (PNPLA3), transmembrane 6 superfamily member 2, and glucokinase regulatory protein (GCKR) are associated with the risk of NAFLD in children. Variants of PNPLA3 and GCKR are more common in Asians. Alterations of the gut microbiome might contribute to the pathogenesis of NAFLD. High fructose intake increases the risk of NAFLD. Liver fibrosis is a poor prognostic factor for disease progression to cirrhosis. Magnetic resonance spectroscopy and magnetic resonance proton density fat fraction are more accurate for steatosis quantification than ultrasound. Noninvasive imaging methods to assess liver fibrosis, such as transient elastography, shear-wave elastography, and magnetic resonance elastography are useful in predicting advanced fibrosis, but they need further validation. Longitudinal follow-up studies into adulthood are needed to better understand the natural history of pediatric NAFLD.
Asia
;
Asian Continental Ancestry Group
;
Child
;
Diagnosis
;
Disease Progression
;
Elasticity Imaging Techniques
;
Epidemiology
;
Fibrosis
;
Follow-Up Studies
;
Fructose
;
Gastrointestinal Microbiome
;
Genetics
;
Glucokinase
;
Humans
;
Liver Cirrhosis
;
Liver Diseases
;
Magnetic Resonance Spectroscopy
;
Microbiota
;
Natural History
;
Non-alcoholic Fatty Liver Disease
;
Phospholipases
;
Polymorphism, Genetic
;
Prevalence
;
Protons
;
Ultrasonography
4.A novel mutation W257R in gene discovered from a Chinese patient with maturity onset diabetes of the young.
Pingping HONG ; Bingjie GUO ; Li LIN ; Xihua LIN ; Jiaqiang ZHOU
Journal of Zhejiang University. Medical sciences 2019;48(2):200-203
Maturity onset diabetes of the young (MODY) is a monogenic autosomal dominant inherited disease. Its clinical manifestations are asymptomatic with slightly elevated fasting blood glucose and few complications. This paper reports a novel mutation W257R in glucokinase () gene from a Chinese patient with MODY. Heterozygous mutation c.769T>C (p.W257R) in exon 7 of gene (Chr744187343) was found in the proband, her father and brother. This W257R mutation was first reported in Chinese population.
China
;
Diabetes Mellitus, Type 2
;
genetics
;
Female
;
Glucokinase
;
genetics
;
Humans
;
Male
;
Mutation
;
Pedigree
5.A Journey to Understand Glucose Homeostasis: Starting from Rat Glucose Transporter Type 2 Promoter Cloning to Hyperglycemia.
Diabetes & Metabolism Journal 2018;42(6):465-471
My professional journey to understand the glucose homeostasis began in the 1990s, starting from cloning of the promoter region of glucose transporter type 2 (GLUT2) gene that led us to establish research foundation of my group. When I was a graduate student, I simply thought that hyperglycemia, a typical clinical manifestation of type 2 diabetes mellitus (T2DM), could be caused by a defect in the glucose transport system in the body. Thus, if a molecular mechanism controlling glucose transport system could be understood, treatment of T2DM could be possible. In the early 70s, hyperglycemia was thought to develop primarily due to a defect in the muscle and adipose tissue; thus, muscle/adipose tissue type glucose transporter (GLUT4) became a major research interest in the diabetology. However, glucose utilization occurs not only in muscle/adipose tissue but also in liver and brain. Thus, I was interested in the hepatic glucose transport system, where glucose storage and release are the most actively occurring.
Adipogenesis
;
Adipose Tissue
;
Animals
;
Brain
;
Clone Cells*
;
Cloning, Organism*
;
Diabetes Mellitus, Type 2
;
Glucokinase
;
Gluconeogenesis
;
Glucose Transport Proteins, Facilitative*
;
Glucose Transporter Type 2*
;
Glucose*
;
Glycolysis
;
Homeostasis*
;
Humans
;
Hyperglycemia*
;
Liver
;
Promoter Regions, Genetic
;
Rats*
;
Transcription Factors
6.Identification of Maturity-Onset Diabetes of the Young Caused by Glucokinase Mutations Detected Using Whole-Exome Sequencing.
Eun Hee CHO ; Jae Woong MIN ; Sun Shim CHOI ; Hoon Sung CHOI ; Sang Wook KIM
Endocrinology and Metabolism 2017;32(2):296-301
Glucokinase maturity-onset diabetes of the young (GCK-MODY) represents a distinct subgroup of MODY that does not require hyperglycemia-lowering treatment and has very few diabetes-related complications. Three patients from two families who presented with clinical signs of GCK-MODY were evaluated. Whole-exome sequencing was performed and the effects of the identified mutations were assessed using bioinformatics tools, such as PolyPhen-2, SIFT, and in silico modeling. We identified two mutations: p.Leu30Pro and p.Ser383Leu. In silico analyses predicted that these mutations result in structural conformational changes, protein destabilization, and thermal instability. Our findings may inform future GCK-MODY diagnosis; furthermore, the two mutations detected in two Korean families with GCK-MODY improve our understanding of the genetic basis of the disease.
Computational Biology
;
Computer Simulation
;
Diabetes Complications
;
Diabetes Mellitus, Type 2*
;
Diagnosis
;
Glucokinase*
;
Humans
7.Increased glucose metabolism and alpha-glucosidase inhibition in Cordyceps militaris water extract-treated HepG2 cells.
Dae Jung KIM ; Yun Hwan KANG ; Kyoung Kon KIM ; Tae Woo KIM ; Jae Bong PARK ; Myeon CHOE
Nutrition Research and Practice 2017;11(3):180-189
BACKGROUND/OBJECTIVES: Recent living condition improvements, changes in dietary habits, and reductions in physical activity are contributing to an increase in metabolic syndrome symptoms including diabetes and obesity. Through such societal developments, humankind is continuously exposed to metabolic diseases such as diabetes, and the number of the victims is increasing. This study investigated Cordyceps militaris water extract (CMW)-induced glucose uptake in HepG2 cells and the effect of CMW treatment on glucose metabolism. MATERIALS/METHODS: Colorimetric assay kits were used to determine the glucokinase (GK) and pyruvate dehydrogenase (PDH) activities, glucose uptake, and glycogen content. Either RT-PCR or western blot analysis was performed for quantitation of glucose transporter 2 (GLUT2), hepatocyte nuclear factor 1 alpha (HNF-1α), phosphatidylinositol 3-kinase (PI3k), protein kinase B (Akt), phosphorylated AMP-activated protein kinase (pAMPK), phosphoenolpyruvate carboxykinase, GK, PDH, and glycogen synthase kinase 3 beta (GSK-3β) expression levels. The α-glucosidase inhibitory activities of acarbose and CMW were evaluated by absorbance measurement. RESULTS: CMW induced glucose uptake in HepG2 cells by increasing GLUT2 through HNF-1α expression stimulation. Glucose in the cells increased the CMW-induced phosphorylation of AMPK. In turn, glycolysis was stimulated, and glyconeogenesis was inhibited. Furthermore, by studying the mechanism of action of PI3k, Akt, and GSK-3β, and measuring glycogen content, the study confirmed that the glucose was stored in the liver as glycogen. Finally, CMW resulted in a higher level of α-glucosidase inhibitory activity than that from acarbose. CONCLUSION: CMW induced the uptake of glucose into HepG2 cells, as well, it induced metabolism of the absorbed glucose. It is concluded that CMW is a candidate or potential use in diabetes prevention and treatment.
Acarbose
;
alpha-Glucosidases*
;
AMP-Activated Protein Kinases
;
Blotting, Western
;
Cordyceps*
;
Food Habits
;
Glucokinase
;
Glucose Transport Proteins, Facilitative
;
Glucose*
;
Glycogen
;
Glycogen Synthase Kinase 3
;
Glycolysis
;
Hep G2 Cells*
;
Hepatocyte Nuclear Factor 1-alpha
;
Hypoglycemic Agents
;
Liver
;
Metabolic Diseases
;
Metabolism*
;
Motor Activity
;
Obesity
;
Oxidoreductases
;
Phosphatidylinositol 3-Kinase
;
Phosphoenolpyruvate
;
Phosphorylation
;
Proto-Oncogene Proteins c-akt
;
Pyruvic Acid
;
Social Conditions
;
Water*
8.Sargassum coreanum extract alleviates hyperglycemia and improves insulin resistance in db/db diabetic mice.
Mi Hwa PARK ; Young Hwa NAM ; Ji Sook HAN
Nutrition Research and Practice 2015;9(5):472-479
BACKGROUND/OBJECTIVES: The goal of this study was to examine the effect of Sargassum coreanum extract (SCE) on blood glucose concentration and insulin resistance in C57BL-KsJ-db/db mice. MATERIALS/METHODS: For 6 weeks, male C57BL/KsJ-db/db mice were administrated SCE (0.5%, w/w), and rosiglitazone (0.005%, w/w). RESULTS: A supplement of the SCE for 6 weeks induced a significant reduction in blood glucose and glycosylated hemoglobin concentrations, and it improved hyperinsulinemia compared to the diabetic control db/db mice. The glucokinase activity in the hepatic glucose metabolism increased in the SCE-supplemented db/db mice, while phosphoenolpyruvate carboxykinase and glucose-6-phosphatase activities in the SCE-supplemented db/db mice were significantly lower than those in the diabetic control db/db mice. The homeostatic index of insulin resistance was lower in the SCE-supplemented db/db mice than in the diabetic control db/db mice. CONCLUSIONS: These results suggest that a supplement of the SCE lowers the blood glucose concentration by altering the hepatic glucose metabolic enzyme activities and improves insulin resistance.
Animals
;
Blood Glucose
;
Glucokinase
;
Glucose
;
Glucose-6-Phosphatase
;
Hemoglobin A, Glycosylated
;
Humans
;
Hyperglycemia*
;
Hyperinsulinism
;
Insulin Resistance*
;
Insulin*
;
Male
;
Metabolism
;
Mice*
;
Phosphoenolpyruvate
;
Sargassum*
9.Maturity-onset diabetes of the young 2 with a novel mutation of glucokinase gene in a Chinese boy and the clinical follow-up.
Xiuzhen LI ; Li LIU ; Cuili LIANG ; Huiying SHENG ; Xiaoyuan ZHAO
Chinese Journal of Pediatrics 2014;52(11):867-871
OBJECTIVETo explore the clinical and gene mutation characteristics of a child with maturity-onset diabetes of the young 2 (MODY2).
METHODThe clinical and follow-up data of 1 patient with MODY2 were reviewed. GCK mutational analysis was performed by PCR and direct sequencing in the proband and his family members.
RESULTThe 9 years and 6 months old boy was referred to our department for short stature and mild hyperglycemia. His fasting blood glucose was elevated to 7.4-7.8 mmol/L, hemoglobin A1C 6.7%. His height was 122 cm (-2 s), weight 25 kg (-1 s), body mass index (BMI) 16.8 kg/m(2). His physical exam was unremarkable without dysmorphic features or acanthosis nigricans. The oral glucose tolerance test (OGTT) showed fasting glucose 8.17 mmol/L, insulin <2.0 mU/L, 2 h glucose 8.69 mmol/L, insulin 5.06 mU /L. The boy was treated with insulin injection for half a year. His fasting blood glucose was stable at 5.6-8.5 mmol/L, hemoglobin A1C 6.7%-6.8%. His mother's fasting blood glucose was 6.86 mmol/L, OGTT 2 h blood glucose 10.36 mmol/L, hemoglobin A1C 6.8%. GCK sequence revealed a novel GCK mutation c.34_44+15del26 in the proband and his mother, which was co-segregated with diabetes. The boy's treatment was shifted from insulin injection to diet and exercise after the diagnosis of MODY2 was confirmed. Being followed up for 2 and a half years, his fasting blood glucose was stable at 4.6-8.0 mmol/L and hemoglobin A1C 6.8%-7.1%.
CONCLUSIONThe clinical features of MODY2 are persistent and stable fasting hyperglycemia over a period of months or years and small blood glucose increment (less than 3 mmol/L) after an OGTT (2 h glucose-fasting glucose). We identified a novel c.34_44+15del26 mutation in GCK which co-segregated with diabetes phenotype in this family.
Asian Continental Ancestry Group ; genetics ; Blood Glucose ; Child ; Diabetes Mellitus, Type 2 ; diagnosis ; genetics ; Fasting ; Follow-Up Studies ; Glucokinase ; genetics ; Glucose Tolerance Test ; Glycated Hemoglobin A ; Humans ; Hyperglycemia ; Insulin ; Male ; Mutation ; Phenotype
10.Study of the mechanisms underlying increased glucose absorption in Smilax china L. leaf extract-treated HepG2 cells.
Yun Hwan KANG ; Dae Jung KIM ; Kyoung Kon KIM ; Sung Mee LEE ; Myeon CHOE
Journal of Nutrition and Health 2014;47(3):167-175
PURPOSE: Previous studies have shown that treatment with Smilax china L. leaf extract (SCLE) produces antidiabetic effects due to alpha-glucosidase inhibition. In this study, we examined the mechanism underlying these antidiabetic effects by examining glucose uptake in HepG2 cells cultured with SCLE. METHODS: Glucose uptake and glucokinase activity were examined using an assay kit. Expression of glucose transporter (GLUT)-2, GLUT-4, and HNF-1alpha was measured by RT-PCR or western blot. RESULTS: Treatment with SCLE resulted in enhanced glucose uptake in HepG2 cells, and this effect was especially pronounced when cells were cultured in an insulin-free medium. SCLE induced an increase in expression of GLUT-2 but not GLUT-4. The increase in the levels of HNF-1alpha, a GLUT-2 transcription factor, in total protein extract and nuclear fraction suggest that the effects of SCLE may occur at the level of GLUT-2 transcription. In addition, by measuring the change in glucokinase activity following SCLE treatment, we confirmed that SCLE stimulates glucose utilization by direct activation of this enzyme. CONCLUSION: These results demonstrate that the potential antidiabetic activity of SCLE is due at least in part to stimulation of glucose uptake and an increase in glucokinase activity, and that SCLE-stimulated glucose uptake is mediated through enhancement of GLUT-2 expression by inducing expression of its transcription factor, HNF-1alpha.
Absorption*
;
alpha-Glucosidases
;
Blotting, Western
;
China*
;
Glucokinase
;
Glucose Transport Proteins, Facilitative
;
Glucose*
;
Hep G2 Cells*
;
Hepatocyte Nuclear Factor 1-alpha
;
Smilax*
;
Transcription Factors

Result Analysis
Print
Save
E-mail