1.Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood.
Juan YE ; Feng YE ; Ling HOU ; Wei WU ; Xiao-Ping LUO ; Yan LIANG
Chinese Journal of Contemporary Pediatrics 2025;27(1):94-100
OBJECTIVES:
To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.
METHODS:
A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.
RESULTS:
All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.
CONCLUSIONS
This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Male
;
Female
;
Child
;
Retrospective Studies
;
Glucokinase/genetics*
;
Adolescent
;
Child, Preschool
;
Glucose Tolerance Test
2.New Perspectives in Pediatric Nonalcoholic Fatty Liver Disease: Epidemiology, Genetics, Diagnosis, and Natural History
Pediatric Gastroenterology, Hepatology & Nutrition 2019;22(6):501-510
Nonalcoholic fatty liver disease (NAFLD) is the most common cause of chronic liver disease in children. The global prevalence of pediatric NAFLD from general populations is 7.6%. In obese children, the prevalence is higher in Asia. NAFLD has a strong heritable component based on ethnic difference in the prevalence and clustering within families. Genetic polymorphisms of patatin-like phospholipase domain–containing protein 3 (PNPLA3), transmembrane 6 superfamily member 2, and glucokinase regulatory protein (GCKR) are associated with the risk of NAFLD in children. Variants of PNPLA3 and GCKR are more common in Asians. Alterations of the gut microbiome might contribute to the pathogenesis of NAFLD. High fructose intake increases the risk of NAFLD. Liver fibrosis is a poor prognostic factor for disease progression to cirrhosis. Magnetic resonance spectroscopy and magnetic resonance proton density fat fraction are more accurate for steatosis quantification than ultrasound. Noninvasive imaging methods to assess liver fibrosis, such as transient elastography, shear-wave elastography, and magnetic resonance elastography are useful in predicting advanced fibrosis, but they need further validation. Longitudinal follow-up studies into adulthood are needed to better understand the natural history of pediatric NAFLD.
Asia
;
Asian Continental Ancestry Group
;
Child
;
Diagnosis
;
Disease Progression
;
Elasticity Imaging Techniques
;
Epidemiology
;
Fibrosis
;
Follow-Up Studies
;
Fructose
;
Gastrointestinal Microbiome
;
Genetics
;
Glucokinase
;
Humans
;
Liver Cirrhosis
;
Liver Diseases
;
Magnetic Resonance Spectroscopy
;
Microbiota
;
Natural History
;
Non-alcoholic Fatty Liver Disease
;
Phospholipases
;
Polymorphism, Genetic
;
Prevalence
;
Protons
;
Ultrasonography
3.A novel mutation W257R in gene discovered from a Chinese patient with maturity onset diabetes of the young.
Pingping HONG ; Bingjie GUO ; Li LIN ; Xihua LIN ; Jiaqiang ZHOU
Journal of Zhejiang University. Medical sciences 2019;48(2):200-203
Maturity onset diabetes of the young (MODY) is a monogenic autosomal dominant inherited disease. Its clinical manifestations are asymptomatic with slightly elevated fasting blood glucose and few complications. This paper reports a novel mutation W257R in glucokinase () gene from a Chinese patient with MODY. Heterozygous mutation c.769T>C (p.W257R) in exon 7 of gene (Chr744187343) was found in the proband, her father and brother. This W257R mutation was first reported in Chinese population.
China
;
Diabetes Mellitus, Type 2
;
genetics
;
Female
;
Glucokinase
;
genetics
;
Humans
;
Male
;
Mutation
;
Pedigree
4.Maturity-onset diabetes of the young 2 with a novel mutation of glucokinase gene in a Chinese boy and the clinical follow-up.
Xiuzhen LI ; Li LIU ; Cuili LIANG ; Huiying SHENG ; Xiaoyuan ZHAO
Chinese Journal of Pediatrics 2014;52(11):867-871
OBJECTIVETo explore the clinical and gene mutation characteristics of a child with maturity-onset diabetes of the young 2 (MODY2).
METHODThe clinical and follow-up data of 1 patient with MODY2 were reviewed. GCK mutational analysis was performed by PCR and direct sequencing in the proband and his family members.
RESULTThe 9 years and 6 months old boy was referred to our department for short stature and mild hyperglycemia. His fasting blood glucose was elevated to 7.4-7.8 mmol/L, hemoglobin A1C 6.7%. His height was 122 cm (-2 s), weight 25 kg (-1 s), body mass index (BMI) 16.8 kg/m(2). His physical exam was unremarkable without dysmorphic features or acanthosis nigricans. The oral glucose tolerance test (OGTT) showed fasting glucose 8.17 mmol/L, insulin <2.0 mU/L, 2 h glucose 8.69 mmol/L, insulin 5.06 mU /L. The boy was treated with insulin injection for half a year. His fasting blood glucose was stable at 5.6-8.5 mmol/L, hemoglobin A1C 6.7%-6.8%. His mother's fasting blood glucose was 6.86 mmol/L, OGTT 2 h blood glucose 10.36 mmol/L, hemoglobin A1C 6.8%. GCK sequence revealed a novel GCK mutation c.34_44+15del26 in the proband and his mother, which was co-segregated with diabetes. The boy's treatment was shifted from insulin injection to diet and exercise after the diagnosis of MODY2 was confirmed. Being followed up for 2 and a half years, his fasting blood glucose was stable at 4.6-8.0 mmol/L and hemoglobin A1C 6.8%-7.1%.
CONCLUSIONThe clinical features of MODY2 are persistent and stable fasting hyperglycemia over a period of months or years and small blood glucose increment (less than 3 mmol/L) after an OGTT (2 h glucose-fasting glucose). We identified a novel c.34_44+15del26 mutation in GCK which co-segregated with diabetes phenotype in this family.
Asian Continental Ancestry Group ; genetics ; Blood Glucose ; Child ; Diabetes Mellitus, Type 2 ; diagnosis ; genetics ; Fasting ; Follow-Up Studies ; Glucokinase ; genetics ; Glucose Tolerance Test ; Glycated Hemoglobin A ; Humans ; Hyperglycemia ; Insulin ; Male ; Mutation ; Phenotype
5.Establishment of hypoglycemic agent screening method based on human glucokinase.
Chou-Fei WU ; Yang XU ; Yong TAO ; Ji-Yan YANG
Biomedical and Environmental Sciences 2009;22(1):62-69
OBJECTIVETo establish a reliable platform for screening glucokinase activators (GKAs) in vitro.
METHODSPancreatic glucokinase (PGK) protein expressed in a prokaryotic expression system as a histidine-tagged fusion protein from Homo sapiens was produced. Then, response surface methodology (RSM) was used to optimize the microplate-based GKA screening platform. In the first step of optimization with Plackett-Burman design (PBD), initial pH, reaction time and MgCl2 were found to be important factors affecting the activity ratio of GKA (RO-28-1675) significantly. In the second step, a 2(3) full factorial central composite design (CCD) and RSM were applied to the optimal condition determination of each significant variable. A second-order polynomial was determined by a multiple regression analysis of the experimental data.
RESULTSThe following optimal values for the critical factors were obtained: initial pH 0 (7.0), reaction time-0.63 (13.7 min) and MgCl2 0.11 (2.11 mmol/L) with a predicted value of the maximum activity ratio of 34.1%.
CONCLUSIONUnder the optimal conditions, the practical activity ratio is 34.8%. The determination coefficient (R2) is 0.9442, ensuring adequate credibility of the model. LLAE3, extracted from Folium nelumbinis in our laboratory, has prominently activated effects on PGK.
Analysis of Variance ; Drug Discovery ; methods ; Enzyme Activators ; analysis ; Escherichia coli ; genetics ; Genetic Vectors ; Glucokinase ; metabolism ; Humans ; Hydrogen-Ion Concentration ; Hypoglycemic Agents ; analysis ; Kinetics ; Time Factors
6.Effects of berberine on expression of hepatocyte nuclear factor 4alpha and glucokinase activity in mouse primary hepatocytes.
Zhong-Qing YAN ; San-Hua LENG ; Fu-Er LU ; Xiao-Hong LU ; Hui DONG ; Zhi-Qiang GAO
China Journal of Chinese Materia Medica 2008;33(18):2105-2109
OBJECTIVETo observe the expression of hepatocyte nuclear factor 4alpha (HNF4alpha) and the activity of key enzyme glucokinase (GK) in glucose metabolism, and further to investigate the possible mechanism of berberine in treating type 2 diabetes.
METHODMouse primary hepatocytes were isolated by an improved single two-step perfusion method. The murine hepatocytes were cultured and incubated with berberine (0, 1, 3, 10, 30, 100 micromol x L(-1)) and 1 mmol x L(-1) metformin for 24 h respectively. The mRNA expression of HNF4alpha were quantified by RT-PCR and the protein expression of HNF4alpha were quantified by Western-blot. And the activity of GK were detected with enzyme kinetics method.
RESULTAs compared with the negative control group, at a certain concentration range, the expression of HNF4alpha mRNA and protein and the activity of GK were promoted by berberine. Both of them reached the top at the concentration of 30 micromol x L(-1) (P<0.01). But the metformin made no difference with the negative control group on the expression of HNF4alpha and the activity of GK.
CONCLUSIONIt is suggested that the effects of berberine on improving glucose metabolism can be mechanically associated with its up-regulating the HNF4a expression and inducing the activity of hepatic glucokinase.
Animals ; Berberine ; pharmacology ; Cell Survival ; drug effects ; Cells, Cultured ; Gene Expression Regulation ; drug effects ; Glucokinase ; genetics ; metabolism ; Hepatocyte Nuclear Factor 4 ; genetics ; metabolism ; Hepatocytes ; cytology ; drug effects ; metabolism ; Male ; Mice ; Plant Extracts ; pharmacology
7.Research progress in hirudin fusion protein--review.
Chuan-Ling ZHANG ; Ai-Ping YU ; Ji-De JIN ; Chu-Tse WU
Journal of Experimental Hematology 2007;15(1):215-218
Natural hirudin extracted from the secretion of medical leech salivary gland is a single-chain peptide containing 65 aminoacid residues with molecular weight of 7000 D, and exists in three isomers of HV1, HV2 and HV3. Hirudin possesses three disulfide bridges forming the structure of core cyclic peptides, which binds to the catalytic site of thrombin so as to inhibit the catalysis of thrombin. Its c-terminus rich in acidic aminoacid residues possesses hydrophilicity, and is free on the molecular surface, and can bind with fibrin recognition site of hirudin. The minimal segment of 12 - 16 C-terminal acidic residues keeps the minimal activity of anti-thrombosis. Thus, hirudin, as a potent and specific inhibitor of thrombin, can be used to protect from and to treat clinically thrombosis. As it has some disadvantages such as short half-life, bleeding side-effect and mono-function, and so on, hirudin has been fused with some other functional proteins in recent years. The obtained fusion proteins can prolong the half life of hirudin, or relieve it bleeding side effect, or bring new functions, such as thrombolysis, inhibiting the platelet aggregation, targeting specifically. The research progress in hirudin fusion protein was summarized in this review.
Anticoagulants
;
pharmacology
;
Delayed-Action Preparations
;
Drug Delivery Systems
;
Glucokinase
;
biosynthesis
;
genetics
;
pharmacology
;
Hirudins
;
biosynthesis
;
genetics
;
pharmacology
;
Humans
;
Platelet Aggregation Inhibitors
;
pharmacology
;
Recombinant Fusion Proteins
;
biosynthesis
;
genetics
;
pharmacology
;
Urokinase-Type Plasminogen Activator
;
biosynthesis
;
genetics
;
pharmacology
8.Mutation screening of GCK gene in Chinese early-onset diabetes population.
Tai-shan ZHENG ; Song-hua WU ; Zhen YANG ; Hui-juan LU ; Kun-san XIANG
Chinese Journal of Medical Genetics 2005;22(6):671-674
OBJECTIVETo investigate the prevalence of mutations and sequence variations of glucokinase gene GCK in Chinese early-onset diabetes population.
METHODSThe study was conducted in 174 unrelated Chinese residents, including 80 nondiabetic controls, 94 probands of early-onset diabetes pedigree. Direct sequencing was performed to screen all 10 exons of glucokinase gene, including promoter and exon/intron junctions.
RESULTSNo mutations were identified in coding region, but several previously reported sequence variants were identified. 5'-untranslated region of exon 1a, 84 bp upstream of the translation initiation site GGCGG to GGGGG(early-onset diabetes group G allele frequency 0.106 vs control group 0.075, P=0.355); IVS1b+12 (A-->T) (early-onset diabetes group T allele frequency 0.005 vs non-identity of this variation in control group); IVS 5+29 (G-->T) (early-onset diabetes group T allele frequency 0.027 vs control group 0.019, P=0.731); IVS 9+8 (T-->C) (early-onset diabetes group C allele frequency 0.585 vs 0.694, P=0.044). A novel variation IVS 9+49 (G-->A) (early-onset diabetes group A allele frequency 0.011 vs control 0.006, P=1.000) was identified. There were no significant relationships of the exon 1a 5'-untransted region -84 bp(C-->G), IVS 5+29 (G-->T), IVS 9+8 (T-->C) and IVS 9+49 (G-->A) variants of GCK gene to the clinical variables such as plasma glucose, insulin, C-peptide and fasting lipid profile.
CONCLUSIONThe prevalence of structural mutations in glucokinase gene responsible for early-onset diabetes appears to be rare among Chinese patients.
Adult ; Base Sequence ; DNA Mutational Analysis ; Diabetes Mellitus, Type 2 ; blood ; genetics ; Female ; Genetic Predisposition to Disease ; genetics ; Glucokinase ; genetics ; Humans ; Lipids ; blood ; Male ; Mutation ; Pedigree ; Polymerase Chain Reaction
9.Research development of Mendelian inherited diabetes.
Yan-li YANG ; Yan MENG ; Fu-de FANG
Acta Academiae Medicinae Sinicae 2005;27(3):382-387
Diabetes mellitus is a chronic syndrome of abnormal metabolism, determined by interaction of multifactorial genetic and environmental factors. Some specific types of diabetes, such as MODY, Leprechaunism, lipoatrophic diabetes, and Rabson-Mendenhall syndrome, are monogenic forms of diabetes and are inherited as a Mendelian pattern. The article reviews the research development of these Mendelian inherited diabetes will be reviewed.
Diabetes Mellitus, Type 2
;
etiology
;
genetics
;
Genetic Predisposition to Disease
;
Glucokinase
;
genetics
;
Humans
;
Mutation
;
genetics

Result Analysis
Print
Save
E-mail