Objective: To explore the nonlinear dynamic effects of social capital, adverse childhood experiences (ACEs) and depressive symptoms on suicidal behavior among vocational high school students, so as to provide theoretical basis and practical references for formulating suicide prevention strategies. Methods: A convenience sampling method was employed to include 668 students from a vocational high school from Wuhan in March 2023. Social capital was used as the asymmetry variable, while ACEs and depressive symptoms were used as bifurcation variables, a cusp catastrophe model was constructed to analyze the nonlinear changes in suicidal behavior among vocational high school students, and its fit was compared with linear and Logistic regression models. Results: Among students in the health vocational high school in Wuhan, only suicidal ideation accounted for 8.5%, only suicide attempt for 18.6%, neither accounted for 31.9%, and both for 41.0%. Gender, left behind experience, family economic status, parental parenting styles, depressive symptoms, social capital, and ACEs were all related factors influencing suicidal behavior among vocational high school students ( χ 2/H=19.03, 13.33, 21.11, 46.70, 144.38, 24.61, 118.77, all P <0.05). Violin plots showed a bimodal distribution of suicidal behavior, indicating nonlinear variation characteristics. The cusp catastrophe model results showed that social capital was negatively correlated with suicidal behavior, but the relationship was bifurcated by ACEs ( α social capital = -0.006 , β ACEs =0.075) and depressive symptoms ( α social capital =-0.013, β depressive =0.028) (all P <0.05). When both ACEs and depressive symptoms coexisted, the impact of ACEs was stronger ( β ACEs =0.077, β depressive =0.014) (both P <0.05). The cusp catastrophe model fitted ( R 2=0.886, 0.881, 0.882) better than the linear ( R 2=0.258, 0.219, 0.258) and Logistic regression models ( R 2= 0.242, 0.211 , 0.176). Gender stratified analysis results showed that bifurcation effect of ACEs was stronger in males than in females( β boys =0.224, β girls =0.086); in females, both ACEs and depressive symptoms had a bifurcation effect, with the former showing a stronger effect ( β ACEs =0.062, β depressive =0.015) (all P <0.05). Conclusions Suicidal behavior among vocational high school students exhibits nonlinear characteristics. Improving social capital to reducing ACEs and depressive symptoms may contribute to decreasing adolescent suicidal behaviors.

Objective: To explore the application method and clinical efficacy of endoscopic and computerized navigation technology in maxillofacial foreign body removal surgery, and to provide a reference for the clinical application of this technology. Methods: This study, which was approved by the Medical Ethics Committee of the hospital, retrospectively analyzed the data of five patients with maxillofacial foreign bodies who were admitted to Sun Yat-sen Memorial Hospital, Sun Yat-sen University from January 2018 to December 2024. All patients underwent preoperative CT scanning. Intraoperatively, endoscopic and computer navigation techniques were used in combination or separately according to the location, size, and adjacency of the foreign body to important neurovascular vessels. The foreign body was precisely localized by endoscopic magnification and direct visualization, and the optimal surgical path was designed and verified under the real-time guidance of computerized navigation to accurately remove the foreign body. The type of foreign body, location, length and diameter, duration of surgery, length of incision, success rate of foreign body removal, postoperative complications, and follow-up were recorded and analyzed. Results: The foreign body was successfully removed in all five patients with a success rate of 100%. The intraoperative computerized navigation system was accurate in positioning, and the alignment stability was not significantly affected by mandibular movement; the endoscope provided good illumination and exposure of the operative field. All surgical incisions were small, and no serious complications, such as foreign body residue, important neurovascular injury, or infection, occurred after surgery. One month after the operation, the patients were followed up and recovered well. Conclusion The combination of endoscopy and computer navigation or separately assisted technology can provide a clear field and real-time positioning for maxillofacial foreign body removal, effectively avoiding important anatomical structures, thus realizing safe and complete foreign body removal with minimized trauma. This assistive technology significantly improves the accuracy and safety of the operation and has clinical promotion value.

ObjectiveThis study employs a special conformational engineering (CE) technology to construct an α-chymotrypsin-like active center, which includes a catalytic triad, an oxyanion hole, and a substrate-binding site, on silver nanoparticles (AgNPs), thereby creating an AgNP-based artificial hydrolase with high catalytic activity. This study provides a new approach for the design of highly efficient artificial enzymes and enzyme-mimicking. MethodsAgNPs were chosen as the scaffold to build the an α-chymotrypsin-like active center. A special CE procedure enables the designed peptide, Triad5, to adopt an α‑helical conformation on AgNPs, with the key catalytic residues located on one side of the α-helix forming a catalytic active center with a catalytic triad, an oxyanion hole, and a substrate-binding site. The CE procedure consists of three steps, including conformation induction via trifluoroethanol (TFE), conformation stabilization on AgNPs via Ag-S bonds, and TFE removal via lyophilization. Circular dichroism (CD) spectra were used to confirm the formation and stabilization of the α-helix conformation. Mutations of the key residues combined with stopped-flow kinetic experiments were used to demonstrate the indispensability of each key residue and the synergistic effects among the catalytic triad, the oxyanion hole, and the substrate-binding site. ResultsCD spectra show that the designed Triad5 alone is in random coil conformation; when conjugated on AgNPs, Triad5 still remains largely unstructured; but after the CE treatment, Triad5 adopts a typical α-helical conformation on AgNPs as designed, thus produces an AgNP-based artificial hydrolase, Silverzyme. Silverzyme exhibits extremely high hydrolytic activity towards p-nitrophenyl acetate (p-NPA), with an extremely high catalytic turnover number per active site of 3.5 s^-1, which is even higher than that of α-chymotrypsin. As a comparison, the AgNP-Triad5 conjugate without CE treatment shows much lower catalytic activity than Silverzyme, highlighting the important role of the right conformation of the active center for the catalytic activity and the power of the CE treatment. When the key residues of the catalytic triad of Silverzyme were mutated to alanine, the overall catalytic efficiency of this mutant dropped by about 2 orders of magnitude, unambiguously demonstrating the key role of the designed catalytic triad. Similarly, when the residues for the oxyanion hole were deleted, the mutant with the intact catalytic triad also showed significantly decreased catalytic activity, highlighting the indispensable role of the oxyanion hole for the catalytic activity. Unexpectedly, when both the catalytic triad and the oxyanion hole were kept intact, a slight change of the binding site also resulted in significantly decreased catalytic activity, indicating that the designed binding site is at the right position to align the substrate in the right orientation in the active center for catalytic hydrolysis. These results confirm the synergy among the catalytic triad, the oxyanion hole, and the substrate-binding site, indicating successful mimicking of the active center of α-chymotrypsin. Moreover, Silverzyme shows better thermal stability than α-chymotrypsin, and can even hydrolyze the tough non-activated ester diethyl phthalate, a priority pollutant by the United States Environmental Protection Agency (USEPA). ConclusionThis study successfully mimicked the complex catalytic active center of α-chymotrypsin using a conformational engineering strategy, and produced a highly active artificial hydrolase with a well-defined structure and catalytic mechanism. The findings highlight the significant potential of conformational engineering.

Objective To gain insights into the biological characteristics of different populations of Culex tritaeniorhynchus within and around the Yellow Sea wetland from the perspective of the occurrence of resistance, we investigated the levels of resistance to deltamethrin and kdr gene mutation in the wetland and its peripheral areas. Methods Specimens were collected from Cx. tritaeniorhynchus populations at two monitoring sites in the Rare Bird National Nature Reserve and Tiaozi Ni Wetland Scenic Area, and also from two populations in Yancheng City and the Liuhe District of Nanjing, and the resistance of these mosquitoes to deltamethrin was determined using the CDC biotest bottle method. For each concentration of deltamethrin assessed, a random subset of exposed specimens was selected for amplification of the kdr gene fragment, followed by Sanger sequencing to identify and analyze resistance-associated mutations. Results The LC50 levels of deltamethrin among mosquitoes from the four populations in Luhe, Yancheng, the Rare Bird National Nature Reserve and the Tiaozi Ni Wetland Scenic Area were 2.048 5, 7.798 2, 3.473 3, and 17.695 5 mg/mL, respectively, with corresponding concentrations of deltamethrin ranging from 0.005 to 5.000,0.050 to 50.000,0.050 to 25.000 and 0.050 to 50.000 mg/mL, respectively. Furthermore, the ranges of the KT50 values were 11.76-107.43, 67.05-216.30,29.77-107.43 and 28.40-329.51 min; the 1-h knockdown rates were 34.58%-99.15%, 9.52%-43.80%, 55.09%-73.01%, and 10.09%-68.07%; and the 24-h mortality rates were 12.15%-67.52%,9.52%-79.56%,13.17%-82.21%, and 11.01%-78.99%, respectively. With respect to kdr gene mutation, we assayed a total of 63,70,59, and 57 mosquitoes for the four populations, for which we detected L1014F mutation frequencies of 14.29%, 35.00%, 20.34%, and 31.58%, respectively, with a majority of these mutations being heterozygous for resistance. In addition, five adult mosquitoes were identified has having synonymous mutations at site 1011[i. e. , AAT(asparagine)mutation to AAC(asparagine)]. Conclusions Our findings revealed the clear resistance of Cx. tritaeniorhynchus to deltamethrin in the Yancheng region of the Yellow Sea wetland, and the resistance phenotype and kdr frequency of Cx. tritaeniorhynchus in the wetland environment were comparable to those of Cx. tritaeniorhynchus in the wetland environment, thereby indicating that the resistance of different populations of Cx. tritaeniorhynchus was homogeneous under the pressure of different insecticide selection within and around the wetland. However, the underlying mechanisms need to be further studied.

Purpose: To investigate the therapeutic potential of eliminating insulin-like growth factor-binding protein 5 (IGFBP5) expression in improving erectile function in mice with cavernous nerve injury (CNI)-induced erectile dysfunction (ED). Materials and Methods: Eight-week-old male C57BL/6 mice were divided into four groups: a sham-operated group and three CNI-induced ED groups. The CNI-induced ED groups were treated with intracavernous injections 3 days before the CNI procedure.These injections included phosphate-buffered saline, scrambled control short hairpin RNA (shRNA), or shRNA targeting mouse IGFBP5 lentiviral particles. One week after CNI, erectile function was evaluated and the penile tissue was then harvested for histological examination and western blot analysis. Additionally, the major pelvic ganglia (MPG) and dorsal root ganglia (DRG) were cultured for ex vivo neurite outgrowth assays. Results: Following CNI, IGFBP5 expression in the cavernous tissues significantly increased, reaching its peak at day 7. First, ablation of IGFBP5 expression promotes neurite sprouting in MPG and DRG when exposed to lipopolysaccharide. Second, ablating IGFBP5 expression in CNI-induced ED mice improved erectile function, likely owing to increased neurovascular contents, including endothelial cells, pericytes, and neuronal processes. Third, ablating IGFBP5 expression in CNI-induced ED mice promoted neurovascular regeneration by increasing cell proliferation, reducing apoptosis, and decreasing Reactive oxygen species production. Finally, western blot analysis demonstrated that IGFBP5 ablation attenuated the JNK/c-Jun signaling pathway, activated the PI3K/AKT signaling pathway, and increased vascular endothelial growth factor and neurotrophic factor expression. Conclusions Ablating IGFBP5 expression enhanced neurovascular regeneration and ultimately improved erectile function in CNI-induced ED mice.

OBJECTIVES: Intracranial aneurysm (IA) has an insidious onset, and once ruptured, it carries high rates of mortality and disability. Cardiometabolic factors may be associated with the formation and rupture of IA. This study aims to summarize the application of Mendelian randomization (MR) methods in research on cardiometabolic factors and IA, providing insights for further elucidation of IA etiology and pathogenesis. METHODS: Literature about MR-based IA studies published up to February 21, 2024, was retrieved from PubMed, Embase, Web of Science, CNKI, and Wanfang. Two researchers independently performed literature screening, data extraction, and quality assessment. A narrative synthesis approach was used to conduct a qualitative systematic review of the included studies. RESULTS: A total of 11 MR-based studies on IA published between 2017 to 2024 were included, of which 4 were rated as high quality. These studies investigated the associations between blood pressure, blood lipids, blood glucose, obesity-related indicators, and inflammatory cytokines with IA and its subtypes, though issues of duplication were noted. Four MR studies based on the same European population but using different instrumental variable selection criteria, as well as another MR study in a different European cohort, consistently identified blood pressure as a risk factor for IA and its subtypes. Findings for blood lipids, blood glucose, obesity-related indicators, and inflammatory cytokines were inconsistent across MR studies. CONCLUSIONS Blood pressure appears to increase the risk of IA and its subtypes. Associations between other cardiometabolic factors and IA/subtypes require further in-depth investigation. Given the inherent limitations of MR studies, causal inferences should be made cautiously in combination with other lines of evidence.
Humans ; Mendelian Randomization Analysis ; Intracranial Aneurysm/etiology* ; Risk Factors ; Blood Pressure ; Blood Glucose ; Obesity/complications* ; Cardiometabolic Risk Factors ; Lipids/blood*

Using Real-time PCR technology, a highly specific and sensitive method for detecting DNA residues of Escherichia coli host cells in levodopa was established, validated, and preliminarily applied. Escherichia coli strain MB6 16S ribosomal RNA gene was selected as the target gene to design multiple pairs of primers and the target fragment by specific amplification of PCR was obtained. The target fragment was cloned into the pLENTI-BSD-CON vector and the recombinant plasmid was constructed and named pLENTI-BSD-CON-E.coli-16S. A quantitative PCR detection method (SYBR Green method) with magnetic bead extraction and purification methods was established with the reference standard of the recombinant plasmid. Furthermore, the established method was validated, including linear and range, accuracy, precision, specificity, and quantification limit, and applied to the detection of levodopa raw materials. Meanwhile, the detection method was compared with the Taqman probe method by the commercial kit. The primer sequences of the quantitative PCR detection method (SYBR Green method) were TTCGATGCAACGCGAAGAAC (forward) and GTGTAGCCCTGGTCGTAAGG (reverse). The standard curve of DNA was in the range of 10 fg/μL to 3 ng/μL with good linearity (R2≥ 0.98). The quantitative limit was 10 fg/μL. In addition, the detection recovery rate was in the range of 59.7% to 80.7%, with RSD at less than 15%. Nine batches of levodopa were detected by this method, and the amount of E.coli DNA residue was below the limit. The developed qPCR method can be used for quantitative detection of residual DNA in biological products produced by E.coli as host cells, such as levodopa . The results indicate that the sensitivity of the detection method for recombinant plasmid construction standards is superior than the reagent kit detection method.

Objective: To explore the association between the Internet usage characteristics and suicidal ideation among vocational high school students, so as to provide a theoretical basis for precise intervention of suicide among vocational high school students. Methods: A total of 1 781 students were recruited from three vocational high schools in Wuhan and Xianning in March 2023 by using the cluster random sampling method. The Columbia-Suicide Severity Rating Scale and Revised Chen Internet Addiction Scale were used to measure suicidal ideation and Internet addiction, respectively. LASSO regression model was used to select influential factors related to suicidal ideation, and the gradient boosting decision tree algorithm XGBoost was used to develop prediction models and evaluate predictive performance. By calculating the SHAP values, the contribution of each influential factor was quantified. Results: The prevalence of suicidal ideation among vocational high school students was 42.22% and prevalence of Internet addiction was 26.39%. LASSO regression results indicated that age, gender, experience of being left behind, parental relationship, holding a class cadre position, using the Internet for learning, Internet use during dawn, morning and late night, Internet addiction, and depressive symptoms were all the influential factors of suicidal ideation among vocational high school students ( β= -0.05 , 0.29, 0.09, 0.27, 0.10, -0.01, 0.09, 0.05, 0.24, 0.28, 0.78, all P <0.05). The AUC of the prediction model was 0.75. The results based on SHAP values indicated that all influential factors identified through multivariate analysis contributed positively to the model predictions ( SHAP >0). Among these, depressive symptoms and parental relationship had the greatest impact on suicidal ideation ( SHAP =0.77, 0.26), and the joint effect of features with higher contribution could improve the prediction probability. Conclusions Depressive symptoms, parental relationships, Internet addiction, and time of Internet use are most important risk factors of suicidal behaviors for vocational high school students. Thus, effective interventions should be conducted to reduce their suicidal ideation.

Objective To explore the correlation of bilateral knee joint strength asymmetry with balance,walking ability,and motor function in hemiplegic stroke patients,providing a reference for clinical assessment of stroke patients.Methods A total of 46 hemiplegic stroke patients admitted to the Rehabilitation Medicine Department of People's Hospital of Shijiazhuang from February to December 2023 were selected.According to the Berg Balance Scale(BBS)scores,patients were divided into Group A(BBS score≤20,n=23)and Group B(BBS score>20,n=23).The peak torque and differences of bilateral knee flexors and extensors were compared between two groups.Isokinetic technology was used to assess the differences in peak torque of bilateral knee joints at 60°/s and 120°/s.BBS,Functional Ambulation Classification(FAC),and Fugl-Meyer Assessment of Lower Extremity(FMA-LE)were used to evaluate patients'balance,walking ability,and lower limb motor function.The correlation between bilateral knee joint peak torque and its difference with the scores of three functional scales was analyzed.Results The peak torque of knee flexors and extensors at 60°/s in group A was significantly lower than that in group B(P<0.05).At both 60°/s and 120°/s the differences in peak torque between the healthy and affected sides of knee flexors and extensors were greater than those in group B(P<0.05).At 60°/s,the difference in peak torque of bilateral knee extensors in hemiplegic stroke patients was negatively correlated with the scores of BBS,FAC,and FMA-LE(r=-0.569,-0.582,-0.606,P<0.01),as did the knee flexors(r=-0.534,-0.386,-0.458,P<0.05).At 120°/s,similar negative correlations were observed for both knee extensors(r=-0.304,-0.304,-0.443,P<0.05)and flexors(r=-0.337,-0.349,-0.370,P<0.05).Conclusions Bilateral knee joint strength asymmetry in hemiplegic stroke patients is negatively correlated with balance and walking ability.The difference in strength between the two sides of knee joint may be one of the clinical indicators for evaluating the motor function of stroke patients.

Objective To explore the effectiveness of drawing-based method in medical courses and their impact on students' learning habits,academic performance,and comprehensive competencies,in order to meet the demand for high-quality,interdisciplinary,and innovative talent,and provide theoretical support for integrating aesthetic education into medical training.Methods A questionnaire survey was conducted among medical students(n=310)at Dalian Medical University,covering the frequency of using drawing method and their effects on learning outcomes,innovation ability,and humanistic qualities.Data were analyzed using the Chi-square test and Fisher's exact test(P＜0.05).Results Totally 93.6％of students approved of using drawing method for learning medical courses,with 70.8％having developed a habit of drawing-based learning.Students with stronger drawing skills were more inclined to use drawing method and supported their application in teaching.The frequency of drawing-based learning was positively correlated with anatomy scores(P＜0.05).Students generally agreed that drawing method enhanced knowledge comprehension,learning interest,long-term memory,innovation ability,critical thinking,and humanistic qualities.However,students with weaker drawing skills perceived drawing method as potentially increasing learning burdens and being less efficient,but this perception significantly decreased with increased drawing frequency(P＜0.05).Conclusion Drawing methods are widely used in medical courses and effectively improve learning outcomes and comprehensive competencies.Drawing proficiency and frequency are key factors influencing students' acceptance and learning effectiveness.Future efforts should focus on promoting drawing method,strengthening students' drawing skills,and optimizing learning processes to deepen the integration of aesthetic education in medical training.