ObjectiveThe nucleolar protein PES1 (Pescadillo homolog 1) plays critical roles in ribosome biogenesis and cell cycle regulation, yet its involvement in cellular senescence remains poorly understood. This study aimed to comprehensively investigate the functional consequences of PES1 suppression in cellular senescence and elucidate the molecular mechanisms underlying its regulatory role. MethodsInitially, we assessed PES1 expression patterns in two distinct senescence models: replicative senescent mouse embryonic fibroblasts (MEFs) and doxorubicin-induced senescent human hepatocellular carcinoma HepG2 cells. Subsequently, PES1 expression was specifically downregulated using siRNA-mediated knockdown in these cell lines as well as additional relevant cell types. Cellular proliferation and senescence were assessed by EdU incorporation and SA-β-gal staining assays, respectively. The expression of senescence-associated proteins (p53, p21, and Rb) and SASP factors (IL-6, IL-1β, and IL-8) were analyzed by Western blot or qPCR. Furthermore, Northern blot and immunofluorescence were employed to evaluate pre-rRNA processing and nucleolar morphology. ResultsPES1 expression was significantly downregulated in senescent MEFs and HepG2 cells. PES1 knockdown resulted in decreased EdU-positive cells and increased SA‑β‑gal-positive cells, indicating proliferation inhibition and senescence induction. Mechanistically, PES1 suppression activated the p53-p21 pathway without affecting Rb expression, while upregulating IL-6, IL-1β, and IL-8 production. Notably, PES1 depletion impaired pre-rRNA maturation and induced nucleolar stress, as evidenced by aberrant nucleolar morphology. ConclusionOur findings demonstrate that PES1 deficiency triggers nucleolar stress and promotes p53-dependent (but Rb-independent) cellular senescence, highlighting its crucial role in maintaining nucleolar homeostasis and regulating senescence-associated pathways.

OBJECTIVE To establish the HPLC fingerprint of Xintong granules and the quantitative analysis of multi- components by single-marker method （QAMS） to determine the contents of 7 components， so as to provide a scientific basis for their quality control. METHODS HPLC method was used to establish the fingerprints for 10 batches of Xintong granules （No. S1- S10）， and similarity evaluation， cluster analysis （CA） and partial least squares-discriminant analysis （PLS-DA） were performed. At the same time， the contents of seven components， including puerarin， daidzin， calycosin-7-O- β -D-glucoside， stilbene glycoside， naringin， icariin and tanshinone ⅡA， were determined by QAMS method， and were compared with the results of external standard method. RESULTS A total of 18 common peaks were marked and 7 peaks were identified in the HPLC fingerprints for 10 batches of Xintong granules， namely puerarin （peak 4）， daidzin （peak 7）， calycosin-7-O-β-D-glucoside （peak 9）， stilbene glycoside （peak 10）， naringin （peak 12）， icariin （peak 17）， and tanshinone ⅡA （peak 18）； the similarities among them were more than 0.990， and CA and PLS-DA results showed that S4-S5，S8-S10，S1-S3 and S6-S7 were clustered into three categories， respectively. Using naringin as the internal standard， the contents of puerarin， daidzin， calycosin-7-O-β-D-glucoside， stilbene glycoside， icariin and tanshinone ⅡA were determined to be 7.868 1-10.181 2， 1.709 2-2.374 1， 0.285 2-0.326 3， 1.024 1- 1.523 9， 0.140 2-0.290 4， and 0.077 1-0.219 4 mg/g， respectively， by the QAMS. These results showed no significant differences compared to those obtained by the external standard method. CONCLUSIONS Established HPLC fingerprint and QAMS method are convenient， stable and accurate， which can provide a basis for the quality evaluation of Xintong granules.

Objective: Data on syncopal donation-related vasovagal reaction (DRVR) collected from 74 blood centers between 2020 and 2023 was statistically analyzed to provide a reference for developing preventive strategies against syncopal DRVR. Methods: Data on blood donation adverse reactions and basic information of donors from 2020 to 2023 were collected through the information management system at monitoring sentinel sites. Statistical analysis was performed on the following aspects of syncopal DRVR: characteristics of donors who experienced syncope, reported incidence, triggers, duration, presence and occurrence time of syncope-related trauma, clinical management including outpatient and inpatient treatment, and severity grading. Results: From 2020 to 2023, 45 966 donation-related adverse reactions were recorded. Of these, 1 665 (3.72%) cases were syncopal DRVR. The incidence of syncopal DRVR decreased with age, being the highest in the 18-22 age group. Incidence was significantly higher in female donors than male donors, in first-time donors than repeat donors, and in university and individual donors than group donors (all P<0.05). There was no statistically significant difference among different blood donation locations (P>0.05). The top three triggers were tension, fatigue, and needle phobia or fear of blood. Among syncopal DRVR cases, 60.36% occurred during blood collection, 87.63% lasted for less than 60 seconds, and 5.05% were accompanied by trauma. Notably, 57.14% of these traumas occurred after donor had left the blood collection site. Syncope severity was graded based on required treatment: grade 1 (fully recovered without treatment, 95.50%); grade 2 (recovered after outpatient treatment, 4.02%); and grade 3 (recovered after inpatient treatment, 0.48%). Conclusion: By analyzing the data of syncopal DRVR cases, it is possible to provide a reference for formulating blood donor safety policies.

ObjectiveThe proteome of biological evidence contains rich genetic information, namely single amino acid polymorphisms (SAPs) in protein sequences. However, due to the lack of efficient and convenient analysis tools, the application of SAP in public security still faces many challenges. This paper aims to meet the application requirements of SAP analysis for forensic biological evidence’s proteome data. MethodsThe software is divided into three modules. First, based on a built-in database of common non-synonymous single nucleotide polymorphisms (nsSNPs) and SAPs in East Asian populations, the software integrates and annotates newly identified exonic nsSNPs as SAPs, thereby constructing a customized SAP protein sequence database. It then utilizes a pre-installed search engine—either pFind or MaxQuant—to perform analysis and output SAP typing results, identifying both reference and variant types, along with their corresponding imputed nsSNPs. Finally, SAPTyper compares the proteome-based typing results with the individual’s exome-derived nsSNP profile and outputs the comparison report. ResultsSAPTyper accepts proteomic DDA mass spectrometry raw data (DDA acquisition mode) and exome sequencing results of nsSNPs as input and outputs the report of SAPs result. The pFind and Maxquant search engines were used to test the proteome data of 2 hair shafts of2 individuals, and both obtained SAP results. It was found that the results of the Maxquant search engine were slightly less than those of pFind. This result shows that SAPTyper can achieve SAP fingding function. Moreover, the pFind search engine was used to test the proteome data of 3 hair shafts from 1 European person and 1 African person in the literature. Among the sites fully matched by the literature method, sites detected by SAPTyper are also included; for semi-matching sites, that is, nsSNPs are heterozygous, both literature method and SAPTyper method had the risk of missing detection for one type of the allele. Comparing the analysis results of SAPTyper with the SAP test results reported in the literature, it was found that some imputed nsSNP sites identified by the literature method but not detected by SAPTyper had a MAF of less than 0.1% in East Asian populations, and therefore they were not included in the common nsSNP database of East Asian populations constructed by this software. Since the database construction of this software is based on the genetic variation information of East Asian populations, it is currently unable to effectively identify representative unique common variation sites in European or African populations, but it can still identify SAP sites shared by these populations and East Asian populations. ConclusionAn automated SAP analysis algorithm was developed for East Asian populations, and the software named SAPTyper was developed. This software provides a convenient and efficient analysis tool for the research and application of forensic proteomic SAP and has important application prospects in individual identification and phenotypic inference based on SAP.

Eight butyl-phthalides, senkyunolide K(1), senkyunolide N(2), butylphthalide(3), senkyunolide I(4), senkyunolide H(5),(Z)-butylidenephthalide(6),(Z)-ligustilide(7), and 3-butylidene-7-hydroxyphthalide(8) were isolated from the aerial part of Ligusticum sinense by column chromatography on silica gel column, ODS, Sephadex LH-20 and semi-preparative HPLC. Their structures were elucidated on the basis of spectroscopic and chemical data, especially NMR and MS. Compound 1 was a new butyl-phthalide and compounds 2-8 were isolated from the aerial part of L. sinense for the first time. Furthermore, the inhibitory activities of compounds 1-8 against the nitric oxide(NO) production induced by lipopolysaccharide(LPS) in mouse RAW264.7 macrophages in vitro were evaluated. The results showed that compounds 1-8 exerted inhibitory activities on NO production with IC_(50) of 19.34-42.16 μmol·L~(-1).
Animals ; Mice ; Nitric Oxide/biosynthesis* ; Ligusticum/chemistry* ; Benzofurans/isolation & purification* ; Drugs, Chinese Herbal/isolation & purification* ; Macrophages/immunology* ; RAW 264.7 Cells ; Molecular Structure

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

BACKGROUND: Based on the China-VHD database, this study sought to develop and validate a Valvular Heart Disease- specific Age-adjusted Comorbidity Index (VHD-ACI) for predicting mortality risk in patients with VHD. METHODS & RESULTS: The China-VHD study was a nationwide, multi-centre multi-centre cohort study enrolling 13,917 patients with moderate or severe VHD across 46 medical centres in China between April-June 2018. After excluding cases with missing key variables, 11,459 patients were retained for final analysis. The primary endpoint was 2-year all-cause mortality, with 941 deaths (10.0%) observed during follow-up. The VHD-ACI was derived after identifying 13 independent mortality predictors: cardiomyopathy, myocardial infarction, chronic obstructive pulmonary disease, pulmonary artery hypertension, low body weight, anaemia, hypoalbuminaemia, renal insufficiency, moderate/severe hepatic dysfunction, heart failure, cancer, NYHA functional class and age. The index exhibited good discrimination (AUC, 0.79) and calibration (Brier score, 0.062) in the total cohort, outperforming both EuroSCORE II and ACCI (P < 0.001 for comparison). Internal validation through 100 bootstrap iterations yielded a C statistic of 0.694 (95% CI: 0.665-0.723) for 2-year mortality prediction. VHD-ACI scores, as a continuous variable (VHD-ACI score: adjusted HR (95% CI): 1.263 (1.245-1.282), P < 0.001) or categorized using thresholds determined by the Yoden index (VHD-ACI ≥ 9 vs. < 9, adjusted HR (95% CI): 6.216 (5.378-7.184), P < 0.001), were independently associated with mortality. The prognostic performance remained consistent across all VHD subtypes (aortic stenosis, aortic regurgitation, mitral stenosis, mitral regurgitation, tricuspid valve disease, mixed aortic/mitral valve disease and multiple VHD), and clinical subgroups stratified by therapeutic strategy, LVEF status (preserved vs. reduced), disease severity and etiology. CONCLUSION The VHD-ACI is a simple 13-comorbidity algorithm for the prediction of mortality in VHD patients and providing a simple and rapid tool for risk stratification.

This consensus will introduce the characteristics of fillers used in the surgical cavities of domestic nasal surgery patients based on relevant literature and expert opinions. It will also provide recommendations for the selection of cavity fillers for different nasal diseases, with chronic sinusitis as a representative example.
Humans ; Nasal Cavity/surgery* ; Nasal Surgical Procedures ; China ; Consensus ; Sinusitis/surgery* ; Dermal Fillers

Iron overload is strongly associated with heart disease. Ferroptosis is a new form of regulated cell death indicated in cardiac ischemia-reperfusion (I/R) injury. However, the specific molecular mechanism of myocardial injury caused by iron overload in the heart is still unclear, and the involvement of ferroptosis in iron overload-induced myocardial injury is not fully understood. In this study, we observed that ferroptosis participated in developing of iron overload and I/R-induced cardiomyopathy. Mechanistically, we discovered that Parkin inhibited iron overload-induced ferroptosis in cardiomyocytes by promoting the ubiquitination of long-chain acyl-CoA synthetase 4 (ACSL4), a crucial protein involved in ferroptosis-related lipid metabolism pathways. Additionally, we identified p53 as a transcription factor that transcriptionally suppressed Parkin expression in iron-overloaded cardiomyocytes, thereby regulating iron overload-induced ferroptosis. In animal studies, cardiac-specific Parkin knockout mice (Myh6-CreER ^T2 /Parkin ^fl/fl ) fed a high-iron diet presented more severe myocardial damage, and the high iron levels exacerbated myocardial I/R injury. However, the ferroptosis inhibitor Fer-1 significantly suppressed iron overload-induced ferroptosis and myocardial I/R injury. Moreover, Parkin effectively protected against impaired mitochondrial function and prevented iron overload-induced mitochondrial lipid peroxidation. These findings unveil a novel regulatory pathway involving p53-Parkin-ACSL4 in heart disease by inhibiting of ferroptosis.

Coronavirus-related diseases pose a significant challenge to the global health system. Given the diversity of coronaviruses and the unpredictable nature of disease outbreaks, the traditional "one bug, one drug" paradigm struggles to address the growing number of emerging crises. Therefore, there is an urgent need for therapeutic agents with broad-spectrum anti-coronavirus activity. Here, we provide evidence that ATV006, an anti-SARS-CoV-2 nucleoside analog targeting RNA-dependent RNA polymerase (RdRp), has broad antiviral activity against human and animal coronaviruses. Using mouse hepatitis virus (MHV) and human coronavirus NL63 (HCoV-NL63) as a model, we show that ATV006 has potent prophylactic and therapeutic activity against murine coronavirus infection in vivo. Remarkably, ATV006 successfully inhibits viral replication in mice even when administered 96 h after infection. Due to its oral bioavailability and potency against multiple coronaviruses, ATV006 has the potential to become a useful antiviral agent against SARS-CoV-2 and other circulating and emerging coronaviruses in humans and animals.