Colorectal cancer (CRC) is the third most commonly diagnosed malignancy and the second leading cause of cancer-related mortality worldwide. Despite therapeutic advancements over recent decades, the prognosis for patients with metastatic CRC (mCRC) remains poor. Approximately 2%-4% of mCRC cases exhibit human epidermal growth factor receptor 2 (HER2) amplification or overexpression, defining a distinct molecular subtype. This HER2-positive status is strongly associated with primary resistance to anti-epidermal growth factor receptor (EGFR) therapies, which are the standard of care for patients with RAS wild-type tumors. Beyond its well-established role in breast and gastric cancers, HER2 has emerged as a pivotal biomarker and actionable therapeutic target in mCRC. However, selecting appropriate treatment strategies remains challenging due to patient heterogeneity and diverse molecular subtypes. This review systematically summarizes the molecular biology, diagnostic strategies, and advances in targeted therapies for HER2-positive mCRC. On the diagnostic front, we discuss the applications of immunohistochemistry (IHC), fluorescence in situ hybridization (FISH), next-generation sequencing (NGS), and circulating tumor DNA (ctDNA) detection technologies. We highlight discrepancies in diagnostic criteria across key clinical trials—such as HERACLES, DESTINY, and MOUNTAINEER—underscoring the urgent need for standardized, CRC-specific definitions to ensure consistent patient selection and comparability of efficacy data across studies. Although NGS enables comprehensive genomic profiling, its cost-effectiveness relative to traditional methods must be carefully considered. Therapeutically, we summarize clinical trial data for HER2-directed agents, including tyrosine kinase inhibitors (TKIs) such as tucatinib and lapatinib, monoclonal antibodies like trastuzumab, bispecific antibodies, and antibody-drug conjugates (ADCs) such as trastuzumab deruxtecan. We review dual-targeting strategies and note recent FDA approvals that represent significant milestones in second-line treatment. Additionally, we explore the potential of combining immune checkpoint inhibitors with HER2-targeted therapies to enhance antitumor immunity through mechanisms including antibody-dependent cellular cytotoxicity (ADCC) and modulation of the tumor microenvironment. ADCs enable precise delivery of cytotoxic payloads, reducing off-target toxicity while effectively inhibiting oncogenic pathways. A substantial portion of this review is dedicated to dissecting the molecular mechanisms underlying primary and acquired resistance to HER2-targeted therapies—persistent challenges that limit clinical benefit. These mechanisms include reactivation of downstream signaling pathways such as PI3K/AKT/mTOR and MAPK, concurrent mutations in genes like KRAS or BRAF, and alterations in HER2 expression that compromise treatment efficacy. For instance, specific HER2 mutations (e.g., L755S) can reduce drug binding affinity, while ctDNA monitoring facilitates early detection of emerging resistance clones during disease progression, thereby enabling timely therapeutic adjustments. Tumor heterogeneity and dynamic interactions with the microenvironment further complicate resistance patterns observed in clinical practice. HER2-targeted therapy represents a new frontier in precision oncology for mCRC, offering renewed hope for improving patient outcomes. Realizing this potential will require continued optimization of diagnostic algorithms and treatment workflows. Future efforts must focus on overcoming resistance, validating liquid biopsy approaches for dynamic monitoring, and establishing unified clinical guidelines. HER2 has become an essential biomarker for stratifying mCRC patients beyond traditional RAS and BRAF status, underscoring the shift from empiric treatment to biomarker-driven precision medicine. International, multidisciplinary collaboration will be critical to validate emerging biomarkers and refine treatment algorithms globally.

Objective To verify the efficacy of a domestic human DNA quantification kit based on real-time fluorescence quantitative PCR in detecting the total human DNA concentration,male DNA concen-tration in mixed male/female DNA samples,the degree of DNA degradation and inhibitor tolerance.Methods Samples with different concentrations,different male/female ratios,different concentrations of inhibitors,and different degradation degrees were tested using the domestic human DNA quantification kit based on real-time fluorescence quantitative PCR.This kit was compared with a similar product on the market and was applied to the detection of DNA from real cases.Results This human DNA quan-tification kit can effectively detect human DNA as low as 0.001 65 ng/μL,and 6.25 pg/μL of male DNA in mixed samples with a male-to-female ratio of 1∶15 000.Even when the sample contains as high as 400 ng/μL of humic acid or 1 000 μmol/L of hemin alone,the DNA concentration can still be accurately detected.The degradation index can effectively characterize the degradation degree of the sample.This kit has been successfully applied in forensic practice.Conclusion This human DNA quan-tification kit is accurate and reliable in detection.It can accurately reflect the degradation of DNA and inhibitor tolerance.It has good performance in quantitative accuracy,determination of the male/female ratio in mixed samples,and inhibitor tolerance.It has application potential in forensic case examination.

This study aims to systematically characterize the targeted effects of Quanduzhong Capsules on cartilage lesions in knee osteoarthritis by integrating spatial transcriptomics data mining and animal experiments validation, thereby elucidating the related molecular mechanisms. A knee osteoarthritis model was established using Sprague-Dawley(SD) rats, via a modified Hulth method. Hematoxylin and eosin(HE) staining was employed to detect knee osteoarthritis-associated pathological changes in knee cartilage. Candidate targets of Quanduzhong Capsules were collected from the HIT 2.0 database, followed by bioinformatics analysis of spatial transcriptomics datasets(GSE254844) from cartilage tissues in clinical knee osteoarthritis patients to identify spatially specific disease genes. Furthermore, a "formula candidate targets-spatially specific genes in cartilage lesions" interaction network was constructed to explore the effects and major mechanisms of Quanduzhong Capsules in distinct cartilage regions. Experimental validation was conducted through immunohistochemistry using animal-derived biospecimens. The results indicated that Quanduzhong Capsules effectively inhibited the degenerative changes in the cartilage of affected joints in rats, which was associated with the regulation of Quanduzhong Capsules on the thioredoxin-interacting protein(TXNIP)-NOD-like receptor family pyrin domain containing 3(NLRP3)-bone morphogenetic protein receptor type 2(BMPR2)-fibronectin 1(FN1)-matrix metallopeptidase 2(MMP2) signal axis in the articular cartilage surface and superficial zones, subsequently inhibiting cartilage matrix degradation leading to oxidative stress and inflammatory diffusion. In summary, this study clarifies the spatially specific targeted effects and protective mechanisms of Quanduzhong Capsules within pathological cartilage regions in knee osteoarthritis, providing theoretical and experimental support for the clinical application of this drug in the targeted therapy on the inflamed cartilage.
Animals ; Osteoarthritis, Knee/metabolism* ; Drugs, Chinese Herbal/administration & dosage* ; Rats, Sprague-Dawley ; Rats ; Male ; Humans ; Capsules ; Female ; Disease Models, Animal

OBJECTIVES: To report the development, validation, and findings of the Multi-dimensional Attention Rating Scale (MARS), a self-report tool crafted to evaluate six-dimension attention levels. METHODS: The MARS was developed based on Classical Test Theory (CTT). Totally 202 highly educated healthy adult participants were recruited for reliability and validity tests. Reliability was measured using Cronbach's alpha and test-retest reliability. Structural validity was explored using principal component analysis. Criterion validity was analyzed by correlating MARS scores with the Toronto Hospital Alertness Test (THAT), the Attentional Control Scale (ACS), and the Attention Network Test (ANT). RESULTS: The MARS comprises 12 items spanning six distinct dimensions of attention: focused attention, sustained attention, shifting attention, selective attention, divided attention, and response inhibition.As assessed by six experts, the content validation index (CVI) was 0.95, the Cronbach's alpha for the MARS was 0.78, and the test-retest reliability was 0.81. Four factors were identified (cumulative variance contribution rate 68.79%). The total score of MARS was correlated positively with THAT (r = 0.60, P < 0.01) and ACS (r = 0.78, P < 0.01) and negatively with ANT's reaction time for alerting (r = -0.31, P = 0.049). CONCLUSIONS The MARS can reliably and validly assess six-dimension attention levels in real-world settings and is expected to be a new tool for assessing multi-dimensional attention impairments in different mental disorders.
Humans ; Adult ; Male ; Attention/physiology* ; Female ; Middle Aged ; Reproducibility of Results ; Young Adult ; Psychometrics

Image 1.

In recent years, the study of single-cell transcriptome sequencing technology in the heterogeneity of astrocytes (astrocytes) after spinal cord injury (SCI) has provided new perspectives on post-traumatic nerve regeneration and repair. To provide a review on the research progress of single-cell sequencing technology in astrocytes after spinal cord injury (SCI), and to more comprehensively and deeply elaborate the application of single-cell sequencing technology in the field of astrocytes after SCI. Single-cell sequencing technology can analyse the transcriptomes of individual cells in a high-throughput manner, thus revealing fine differences in cell types and states. By using single-cell sequencing technology, the heterogeneity of astrocytes after SCI and their association with nerve regeneration and repair were revealed. In conclusion, the application of single-cell sequencing technology provides an important tool to reveal the heterogeneity of astrocytes after SCI, to further explore the mechanisms of astrocytes in SCI, and to develop intervention strategies targeting their regulatory mechanisms in order to improve the therapeutic efficacy of SCI. The discovery of changes in astrocyte transcriptome dynamics has improved researchers' understanding of spinal cord injury lesion progression and provided new insights into the treatment of spinal cord injury at different time points. To date, all of these findings need to be validated by more basic research and sufficient clinical trials. In the future, single-cell sequencing technology, through interdisciplinary collaboration with bioinformatics, computer science, tissue engineering, and clinical medicine, is expected to open a new window for the treatment of spinal cord injury.
Spinal Cord Injuries/metabolism* ; Astrocytes/cytology* ; Single-Cell Analysis/methods* ; Humans ; Animals ; Transcriptome ; Nerve Regeneration

Insulin-like growth factor 2 (IGF2) is a critical endocrine mediator implicated in male reproductive physiology. To investigate the correlation between IGF2 protein levels and various aspects of male infertility, specifically focusing on sperm quality, inflammation, and DNA damage, a cohort of 320 male participants was recruited from the Women's Hospital, Zhejiang University School of Medicine (Hangzhou, China) between 1 st January 2024 and 1 st March 2024. The relationship between IGF2 protein concentrations and sperm parameters was assessed, and Spearman correlation and linear regression analysis were employed to evaluate the independent associations between IGF2 protein levels and risk factors for infertility. Enzyme-linked immunosorbent assay (ELISA) was used to measure IGF2 protein levels in seminal plasma, alongside markers of inflammation (tumor necrosis factor-alpha [TNF-α] and interleukin-1β [IL-1β]). The relationship between seminal plasma IGF2 protein levels and DNA damage marker phosphorylated histone H2AX (γ-H2AX) was also explored. Our findings reveal that IGF2 protein expression decreased notably in patients with asthenospermia and teratospermia. Correlation analysis revealed nuanced associations between IGF2 protein levels and specific sperm parameters, and low IGF2 protein concentrations correlated with increased inflammation and DNA damage in sperm. The observed correlations between IGF2 protein levels and specific sperm parameters, along with its connection to inflammation and DNA damage, underscore the importance of IGF2 in the broader context of male reproductive health. These findings lay the groundwork for future research and potential therapeutic interventions targeting IGF2-related pathways to enhance male fertility.
Humans ; Male ; Insulin-Like Growth Factor II/metabolism* ; Infertility, Male/genetics* ; DNA Damage ; Adult ; Inflammation/metabolism* ; Spermatozoa/metabolism* ; Semen Analysis ; Semen/metabolism* ; Tumor Necrosis Factor-alpha/metabolism* ; Histones/metabolism* ; Interleukin-1beta/metabolism*

OBJECTIVES: To investigate the clinical sub-phenotype (SP) of pediatric acute kidney injury (AKI) and their association with clinical outcomes. METHODS: General status and initial values of laboratory markers within 24 hours after admission to the pediatric intensive care unit (PICU) were recorded for children with AKI in the derivation cohort (n=650) and the validation cohort (n=177). In the derivation cohort, a least absolute shrinkage and selection operator (LASSO) regression analysis was used to identify death-related indicators, and a two-step cluster analysis was employed to obtain the clinical SP of AKI. A logistic regression analysis was used to develop a parsimonious classifier model with simplified metrics, and the area under the curve (AUC) was used to assess the value of this model. This model was then applied to the validation cohort and the combined derivation and validation cohort. The association between SPs and clinical outcomes was analyzed with all children with AKI as subjects. RESULTS: In the derivation cohort, two clinical SPs of AKI (SP1 and SP2) were identified by the two-step cluster analysis using the 20 variables screened by LASSO regression, namely SP_d1 group (n=536) and SP_d2 group (n=114). The simplified classifier model containing eight variables (P<0.05) had an AUC of 0.965 in identifying the two clinical SPs of AKI (P<0.001). The validation cohort was clustered into SP_v1 group (n=156) and SP_v2 group (n=21), and the combined derivation and validation cohort was clustered into SP1 group (n=694) and SP2 group (n=133). After adjustment for confounding factors, compared with the SP1 group, the SP2 group had significantly higher incidence rates of multiple organ dysfunction syndrome and death during the PICU stay (P<0.001), and SP2 was significantly associated with the risk of death within 28 days after admission to the PICU (P<0.001). CONCLUSIONS This study establishes a parsimonious classifier model and identifies two clinical SPs of AKI with different clinical features and outcomes.The SP2 group has more severe disease and worse clinical prognosis.
Humans ; Acute Kidney Injury/diagnosis* ; Prognosis ; Male ; Female ; Child ; Child, Preschool ; Phenotype ; Infant ; Logistic Models ; Adolescent

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test