AIM: To investigate differences in ocular biological parameters and refractive status among children with unilateral congenital ptosis.METHODS:This was a retrospective cohort study enrolling patients with unilateral congenital ptosis in the Department of Ophthalmology, Xi'an Children's Hospital between August 2018 and March 2025, with the contralateral healthy eyes serving as the control group. All patients underwent a detailed ophthalmic examination to assess the degree of ptosis and evaluate refractive errors. Biometric measurements were performed using the IOL Master 700 biometer, including axial length(AL), central corneal thickness(CCT), anterior chamber depth(ACD), lens thickness(LT), and astigmatism(AST).RESULTS:A total of 100 eyes from 100 children(affected eye group)with unilateral congenital ptosis were enrolled, and their 100 contralateral normal eyes without ptosis were set as the control group(healthy eyes group). Among the subjects, there were 67 males(67%)and 33 females(33%), with a mean age of 6.43±2.47 y; 45 affected eyes were the right eye and 55 were the left eye. Among the 100 patients, mild, moderate, and severe ptosis accounted for 7%, 21%, and 72%, respectively. The incidence of amblyopia in patients with unilateral congenital ptosis was 32%, all of which occurred in the affected eye. Compared with the healthy eye group, K2(total)and K2(severe ptosis)in eyes with severe ptosis were significantly lower(P<0.05), indicating that the cornea in the ptotic eye was flatter. In patients with moderate ptosis, the affected eye had a significantly greater corneal thickness(CCT)compared to the healthy eye(P<0.05), indicating that the corneas of eyes with moderate ptosis were thicker. The incidence of against-the-rule and oblique astigmatism in the affected eye group(39%)was significantly higher than that in the healthy eye group(14%); there was a significant difference in the corneal astigmatism axis between the affected and healthy eye groups(P<0.01). There were no differences in refractive status or biological parameters such as AL, K1, AST, ACD, and LT between the affected and healthy eyes.CONCLUSION:Congenital ptosis can affect refractive errors, lead to oblique and against-the-rule astigmatism, increase the prevalence of amblyopia, and also result in corneal thickening and flattening. However, it has minimal effects on AL, LT, and ACD.

The development of Traditional Chinese Medicine(TCM)medical alliances plays a pivotal role in enhancing grassroots TCM service capabilities and meeting public demand for TCM healthcare.However,challenges persist in establishing these alliances,including insufficient Party leadership at primary TCM institutions and deficiencies in clinical services,talent de-velopment,and emergency care capacity.This study examines innovative Party building approaches in public hospitals within the new era context,analyzing practical cases of alliance development.Our findings demonstrate that integrating Party building into the governance structure of medical alliances not only strengthens Party leadership at primary TCM institutions but also significant-ly promotes TCM service development.Systematic analysis of case hospital practices reveals several key insights.Firstly,strengthening top-level design through Party committee leadership is crucial.Secondly,addressing the most pressing public healthcare concerns with genuine commitment forms the foundation.Thirdly,deep integration of Party building with core medical services represents the essential approach.Lastly,policy-responsive innovation based on consolidated achievements serves as the key driver.

Body weight abnormalities, including overweight, obesity, and underweight, have become a dual public health challenge in Chinese adults: overweight and obesity lead to a variety of chronic complications, while underweight increases the risks of malnutrition, sarcopenia, and organ dysfunction. To systematically address these issues, multidisciplinary experts in endocrinology, sports science, nutrition, and psychiatry from various regions have held multiple weight management seminars. Based on the latest epidemiological data and clinical evidence, they expanded the guideline to include assessment and intervention strategies for underweight, in addition to the core content of obesity management. This guideline outlines the etiological mechanisms, evaluation methods, and multidimensional management strategies for overweight and obesity, covering key areas such as diagnosis and assessment, medical nutrition therapy, exercise prescription, pharmacological intervention, and psychological support. It is intended to provide a scientific and standardized approach to weight management across the adult population, aiming to curb the rising prevalence of obesity, mitigate complications associated with abnormal body weight, and improve nutritional status and overall quality of life.

Objective:To screen the optimal machine learning model for predicting the recurrence condition of hepatocellular carcinoma (HCC) at different time points post-surgery, based on the cutoff value of the Ki67 positive proliferation index condition calculated from recurrence-free survival and combined with various clinical features.Methods:retrospective study included initially treated patients with solitary HCC who underwent radical surgery at the Fifth Medical Center of the PLA General Hospital from January 2013 to March 2023. Data included general clinical data, preoperative laboratory parameters, and surgical pathology information about the subjects. The postoperative recurrence status was assessed by querying the medical record system or by telephone follow-up. The Ki67 positive index cutoff value was determined by the X-tile software based on the patient's recurrence-free survival status and time analysis. Survival rates were calculated using the Kaplan-Meier method, and survival curves were plotted. The study population was randomly divided into training and testing groups in a 7:3 ratio using a computer-generated random number method. The minimum redundancy maximum relevance (mRMR) method was used for feature variable selection. Predictive models for postoperative HCC recurrence conditions in patients with HCC were constructed using random forest, support vector machine, logistic regression, and gradient boosting decision tree machine learning algorithms. Inter-group comparisons for continuous data were performed using the t-test or Mann-Whitney U test. Inter-group comparisons of enumeration data were performed using the Pearson χ2 test, continuity-corrected χ2 test, or Fisher's exact test. Results:The cutoff values for the Ki67 positivity index were 0.3 and 0.5 in 510 cases, with a follow-up time ranging from 1.2 to 11.4 years (median: 6.2 years). The recurrence-free survival time was between 1 and 135 months (median: 32 months), with recurrence-free survival rates post-surgery at 1, 2, 3, and 5 years were 87.5%, 77.1%, 61.2%, and 54.5%, respectively. The top five variables predicted HCC recurrence and non-recurrence conditions following surgical follow-up at 6 months, 1 year, 2 years, and beyond 2 years, in accordance with information obtained by the mRMR screen out. The Ki67 positivity index screened a successfully constructed machine learning model to predict HCC recurrence and non-recurrence conditions following surgical follow-up at 6 months, 1 year, 2 years, and beyond 2 years. The machine learning model based on the gradient boosting decision tree algorithm had the best prediction performance among them (areas under the receiver operating characteristic curves for predicting HCC recurrence within six months in the training and validation sets were 0.996 and 0.946, and accuracies were 0.972 and 0.935, respectively).Conclusion:A machine learning model was successfully constructed using the Ki67 positivity index combined with four readily available clinical features to predict HCC recurrence. The machine learning model based on the gradient boosting decision tree algorithm demonstrated the best performance in terms of predicting HCC recurrence within six months after surgery.

Background Fine particulate matter (PM_2.5) monitoring stations may generate missing data for a certain period of time due to various factors. This data loss will adversely affect air quality assessment and pollution control decision-making. Objective To propose an inverse distance weighted (IDW) spatiotemporal interpolation method based on particle swarm optimization (PSO) to interpolate and fill missing PM_2.5 spatiotemporal sequence data and increase interpolation accuracy. Methods An interpolation experiment was designed into two parts. The first part used hourly PM_2.5 observational data from four moments on January 1, 2017 in the Yangtze River Delta region. The second part employed daily PM_2.5 observational data from the first 10 d of January 2017 in the Beijing-Tianjin-Hebei region. Interpolation accuracy was evaluated using four metrics: root mean square error (RMSE), mean absolute error (MAE), mean absolute percentage error (MAPE), and mean relative error (MRE). Results IDW spatiotemporal interpolation method optimized with PSO significantly improved the accuracy of filling missing PM_2.5 spatiotemporal sequence data. In the hourly-scale experiment conducted in the Yangtze River Delta region, compared to a distance index of 2, the accuracy metrics RMSE, MAE, MAPE, and MRE generated by the proposed method improved on average by 0.17 μg·m⁻³, 0.27 μg·m⁻³, 0.17%, and 0.01%, respectively. The PM_2.5 spatial field maps generated for four moments based on this method clearly illustrated the spatiotemporal distribution characteristics of hourly PM_2.5 concentrations in the Yangtze River Delta region. In the daily-scale experiment conducted in the Beijing-Tianjin-Hebei region, the PSO-optimized distance index outperformed the traditional method, with interpolation accuracy improvements of approximately 0.215 μg·m⁻³, 0.283 μg·m⁻³, 0.174%, and 0.014%, respectively. Furthermore, the seasonal PM_2.5 spatial field maps generated by this method revealed the spatiotemporal distribution characteristics of PM_2.5 concentrations in the Beijing-Tianjin-Hebei region across different seasons, further validating the effectiveness and applicability of this method. Conclusion The IDW spatiotemporal interpolation method optimized with PSO is highly accurate and reliable for interpolating the missing data in the Yangtze River Delta region and the Beijing-Tianjin-Hebei region, providing valuable insights for air pollution control and public health protection.

Insulin-like growth factor 2 (IGF2) is a critical endocrine mediator implicated in male reproductive physiology. To investigate the correlation between IGF2 protein levels and various aspects of male infertility, specifically focusing on sperm quality, inflammation, and DNA damage, a cohort of 320 male participants was recruited from the Women's Hospital, Zhejiang University School of Medicine (Hangzhou, China) between 1 st January 2024 and 1 st March 2024. The relationship between IGF2 protein concentrations and sperm parameters was assessed, and Spearman correlation and linear regression analysis were employed to evaluate the independent associations between IGF2 protein levels and risk factors for infertility. Enzyme-linked immunosorbent assay (ELISA) was used to measure IGF2 protein levels in seminal plasma, alongside markers of inflammation (tumor necrosis factor-alpha [TNF-α] and interleukin-1β [IL-1β]). The relationship between seminal plasma IGF2 protein levels and DNA damage marker phosphorylated histone H2AX (γ-H2AX) was also explored. Our findings reveal that IGF2 protein expression decreased notably in patients with asthenospermia and teratospermia. Correlation analysis revealed nuanced associations between IGF2 protein levels and specific sperm parameters, and low IGF2 protein concentrations correlated with increased inflammation and DNA damage in sperm. The observed correlations between IGF2 protein levels and specific sperm parameters, along with its connection to inflammation and DNA damage, underscore the importance of IGF2 in the broader context of male reproductive health. These findings lay the groundwork for future research and potential therapeutic interventions targeting IGF2-related pathways to enhance male fertility.
Humans ; Male ; Insulin-Like Growth Factor II/metabolism* ; Infertility, Male/genetics* ; DNA Damage ; Adult ; Inflammation/metabolism* ; Spermatozoa/metabolism* ; Semen Analysis ; Semen/metabolism* ; Tumor Necrosis Factor-alpha/metabolism* ; Histones/metabolism* ; Interleukin-1beta/metabolism*

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

Paraplegia caused by spinal cord injury is a serious neurological complication, for which surgery is currently the main treatment method. Due to different surgical approaches, patients are usually expected to maintain a passive prone position for a long time or switch between the supine and prone positions. Affected by multiple factors such as neurogenic sensory disorders, pathological changes in muscle tone and operative duration, the risk of intraoperative acquired pressure injury (IAPI) is significantly increased. Current clinical prevention strategies for IAPI in these patients predominantly focus on localized pressure relief during positioning, lacking systematic, standardized comprehensive prevention protocols or evidence-based guidelines. To address it, Department of Nursing, Orthopedics Branch, China International Exchange and Promotive Association for Medical and Health Care, Spinal Trauma Professional Committee, Orthopedics Branch, Chinese Medical Doctor Association, Nursing Group of Spine and Spinal Cord Professional Committee of Chinese Association of Rehabilitation Medicine organized experts in relevant fields to formulate Guideline for the prevention of intraoperative acquired pressure injury in paraplegic patients with spinal cord injury ( version 2025), based on evidence-based medical evidence and latest research results and clinical practice at home and abroad. Eleven recommendations were put forward from the aspects of preoperative risk assessment, intraoperative prevention strategies, postoperative handover and monitoring, and supportive mechanisms for IAPI prevention, aiming to standardize the prevention measures and management strategies of IAPI in paraplegic patients with spinal cord injury and accelerate the recovery of patients and improve the therapeutic effect.

Body weight abnormalities, including overweight, obesity, and underweight, have become a dual public health challenge in Chinese adults: overweight and obesity lead to a variety of chronic complications, while underweight increases the risks of malnutrition, sarcopenia, and organ dysfunction. To systematically address these issues, multidisciplinary experts in endocrinology, sports science, nutrition, and psychiatry from various regions have held multiple weight management seminars. Based on the latest epidemiological data and clinical evidence, they expanded the guideline to include assessment and intervention strategies for underweight, in addition to the core content of obesity management. This guideline outlines the etiological mechanisms, evaluation methods, and multidimensional management strategies for overweight and obesity, covering key areas such as diagnosis and assessment, medical nutrition therapy, exercise prescription, pharmacological intervention, and psychological support. It is intended to provide a scientific and standardized approach to weight management across the adult population, aiming to curb the rising prevalence of obesity, mitigate complications associated with abnormal body weight, and improve nutritional status and overall quality of life.

Background With the progression of industrialization, an increasing number of emerging contaminants are entering aquatic environments, posing significant threats to the safety of drinking water. Therefore, establishing a system for identifying unknown hazardous factors and implementing safety warning mechanisms for drinking water is of paramount importance. Among these efforts, non-target screening plays a critical role, but its effectiveness is largely constrained by the scope of coverage of sample pre-treatment methods. Objective To integrate modern chromatography/mass spectrometry techniques with advanced data mining methods to develop a non-discriminatory sample pre-treatment method for comprehensive enrichment of unknown contaminants in drinking water, laying a technical foundation for the discovery and identification of unknown organic hazardous factors in drinking water. Methods A non-discriminatory pre-treatment method based on supramolecular and solid-phase extraction was developed. The final target compounds including 333 pesticides, 194 pharmaceuticals and personal care products (PPCPs), and 59 per- and polyfluoroalkyl substances (PFASs) were used for optimizing the pre-treatment method, confirming its coverage. The impacts of different eluents on the absolute recovery rates of target compounds were compared to select the conditions with the highest recovery for sample pre-treatment. The effects of different supramolecular solvents and salt concentrations on target compound recovery were also evaluated to determine the most suitable solvent and salt concentration. Results The solid-phase extraction elution solvents, supramolecular extraction solvents, and salt concentrations were optimized based on the target compound recovery rates. The optimal recovery conditions were achieved using 2 mL methanol, 2 mL methanol (containing 1% formic acid), 2 mL ethyl acetate, 2 mL dichloromethane, hexanediol supramolecular solvent, and 426 mg salt. The detection method developed based on these conditions showed a good linear relationship for all target compounds in the range of 0.1-100.0 ng·mL⁻¹, with R² > 0.99. The method’s limit of detection ranged from 0.01 ng⁻¹ to 0.95 ng⁻¹, and 95% of target compounds were recovered in the range of 20%-120%, with relative standard deviation (RSD) less than 30%, indicating good precision. Conclusion The combined pre-treatment method of solid-phase extraction and supramolecular solvent extraction can effectively enrich contaminants in drinking water across low, medium, and high polarities, enabling broad-spectrum enrichment of diverse trace contaminants in drinking water. It provides technical support for broad-spectrum, high-throughput screening and identification of organic pollutants in drinking water, and also serves as a reference for establishing urban drinking water public safety warning systems.