1.Transcriptome sequencing reveals molecular mechanism of seed dormancy release of Zanthoxylum nitidum.
Chang-Qian QUAN ; Dan-Feng TANG ; Jian-Ping JIANG ; Yan-Xia ZHU
China Journal of Chinese Materia Medica 2025;50(1):102-110
The transcriptome sequencing based on Illumina Novaseq 6000 Platform was performed with the untreated seed embryo(DS), stratified seed embryo(SS), and germinated seed embryo(GS) of Zanthoxylum nitidum, aiming to explore the molecular mechanism regulating the seed dormancy and germination of Z. nitidum and uncover key differentially expressed genes(DEGs). A total of 61.41 Gb clean data was obtained, and 86 386 unigenes with an average length of 773.49 bp were assembled. A total of 29 290 DEGs were screened from three comparison groups(SS vs DS, GS vs SS, and GS vs DS), and these genes were annotated on 134 Kyoto Encyclopedia of Genes and Genomes(KEGG) pathways. KEGG enrichment analysis revealed that the plant hormone signal transduction pathway is the richest pathway, containing 226 DEGs. Among all DEGs, 894 transcription factors were identified, which were distributed across 34 transcription factor families. These transcription factors were also mainly concentrated in plant hormone signal transduction and mitogen-activated protein kinase(MAPK) signaling pathways. Further real-time quantitative polymerase chain reaction(RT-qPCR) validation of 12 DEGs showed that the transcriptome data is reliable. During the process of seed dormancy release and germination, a large number of DEGs involved in polysaccharide degradation, protein synthesis, lipid metabolism, and hormone signal transduction were expressed. These genes were involved in multiple metabolic pathways, forming a complex regulatory network for dormancy and germination. This study lays a solid foundation for analyzing the molecular mechanisms of seed dormancy and germination of Z. nitidum.
Zanthoxylum/metabolism*
;
Plant Dormancy/genetics*
;
Seeds/metabolism*
;
Gene Expression Regulation, Plant
;
Plant Proteins/metabolism*
;
Transcriptome
;
Gene Expression Profiling
;
Germination
;
Transcription Factors/metabolism*
;
Plant Growth Regulators/genetics*
;
Signal Transduction
2.Mechanism of Quanduzhong Capsules in treating knee osteoarthritis from perspective of spatial heterogeneity.
Zhao-Chen MA ; Zi-Qing XIAO ; Chu ZHANG ; Yu-Dong LIU ; Ming-Zhu XU ; Xiao-Feng LI ; Zhi-Ping WU ; Wei-Jie LI ; Yi-Xin YANG ; Na LIN ; Yan-Qiong ZHANG
China Journal of Chinese Materia Medica 2025;50(8):2209-2216
This study aims to systematically characterize the targeted effects of Quanduzhong Capsules on cartilage lesions in knee osteoarthritis by integrating spatial transcriptomics data mining and animal experiments validation, thereby elucidating the related molecular mechanisms. A knee osteoarthritis model was established using Sprague-Dawley(SD) rats, via a modified Hulth method. Hematoxylin and eosin(HE) staining was employed to detect knee osteoarthritis-associated pathological changes in knee cartilage. Candidate targets of Quanduzhong Capsules were collected from the HIT 2.0 database, followed by bioinformatics analysis of spatial transcriptomics datasets(GSE254844) from cartilage tissues in clinical knee osteoarthritis patients to identify spatially specific disease genes. Furthermore, a "formula candidate targets-spatially specific genes in cartilage lesions" interaction network was constructed to explore the effects and major mechanisms of Quanduzhong Capsules in distinct cartilage regions. Experimental validation was conducted through immunohistochemistry using animal-derived biospecimens. The results indicated that Quanduzhong Capsules effectively inhibited the degenerative changes in the cartilage of affected joints in rats, which was associated with the regulation of Quanduzhong Capsules on the thioredoxin-interacting protein(TXNIP)-NOD-like receptor family pyrin domain containing 3(NLRP3)-bone morphogenetic protein receptor type 2(BMPR2)-fibronectin 1(FN1)-matrix metallopeptidase 2(MMP2) signal axis in the articular cartilage surface and superficial zones, subsequently inhibiting cartilage matrix degradation leading to oxidative stress and inflammatory diffusion. In summary, this study clarifies the spatially specific targeted effects and protective mechanisms of Quanduzhong Capsules within pathological cartilage regions in knee osteoarthritis, providing theoretical and experimental support for the clinical application of this drug in the targeted therapy on the inflamed cartilage.
Animals
;
Osteoarthritis, Knee/metabolism*
;
Drugs, Chinese Herbal/administration & dosage*
;
Rats, Sprague-Dawley
;
Rats
;
Male
;
Humans
;
Capsules
;
Female
;
Disease Models, Animal
3.Development and Initial Validation of the Multi-Dimensional Attention Rating Scale in Highly Educated Adults.
Xin-Yang ZHANG ; Karen SPRUYT ; Jia-Yue SI ; Lin-Lin ZHANG ; Ting-Ting WU ; Yan-Nan LIU ; Di-Ga GAN ; Yu-Xin HU ; Si-Yu LIU ; Teng GAO ; Yi ZHONG ; Yao GE ; Zhe LI ; Zi-Yan LIN ; Yan-Ping BAO ; Xue-Qin WANG ; Yu-Feng WANG ; Lin LU
Chinese Medical Sciences Journal 2025;40(2):100-110
OBJECTIVES:
To report the development, validation, and findings of the Multi-dimensional Attention Rating Scale (MARS), a self-report tool crafted to evaluate six-dimension attention levels.
METHODS:
The MARS was developed based on Classical Test Theory (CTT). Totally 202 highly educated healthy adult participants were recruited for reliability and validity tests. Reliability was measured using Cronbach's alpha and test-retest reliability. Structural validity was explored using principal component analysis. Criterion validity was analyzed by correlating MARS scores with the Toronto Hospital Alertness Test (THAT), the Attentional Control Scale (ACS), and the Attention Network Test (ANT).
RESULTS:
The MARS comprises 12 items spanning six distinct dimensions of attention: focused attention, sustained attention, shifting attention, selective attention, divided attention, and response inhibition.As assessed by six experts, the content validation index (CVI) was 0.95, the Cronbach's alpha for the MARS was 0.78, and the test-retest reliability was 0.81. Four factors were identified (cumulative variance contribution rate 68.79%). The total score of MARS was correlated positively with THAT (r = 0.60, P < 0.01) and ACS (r = 0.78, P < 0.01) and negatively with ANT's reaction time for alerting (r = -0.31, P = 0.049).
CONCLUSIONS
The MARS can reliably and validly assess six-dimension attention levels in real-world settings and is expected to be a new tool for assessing multi-dimensional attention impairments in different mental disorders.
Humans
;
Adult
;
Male
;
Attention/physiology*
;
Female
;
Middle Aged
;
Reproducibility of Results
;
Young Adult
;
Psychometrics
4.Progress in investigating astrocyte heterogeneity after spinal cord injury based on single-cell sequencing technology.
Lei DU ; Yan-Jun ZHANG ; Tie-Feng GUO ; Lin-Zhao LUO ; Ping-Yi MA ; Jia-Ming LI ; Sheng TAN
China Journal of Orthopaedics and Traumatology 2025;38(5):544-548
In recent years, the study of single-cell transcriptome sequencing technology in the heterogeneity of astrocytes (astrocytes) after spinal cord injury (SCI) has provided new perspectives on post-traumatic nerve regeneration and repair. To provide a review on the research progress of single-cell sequencing technology in astrocytes after spinal cord injury (SCI), and to more comprehensively and deeply elaborate the application of single-cell sequencing technology in the field of astrocytes after SCI. Single-cell sequencing technology can analyse the transcriptomes of individual cells in a high-throughput manner, thus revealing fine differences in cell types and states. By using single-cell sequencing technology, the heterogeneity of astrocytes after SCI and their association with nerve regeneration and repair were revealed. In conclusion, the application of single-cell sequencing technology provides an important tool to reveal the heterogeneity of astrocytes after SCI, to further explore the mechanisms of astrocytes in SCI, and to develop intervention strategies targeting their regulatory mechanisms in order to improve the therapeutic efficacy of SCI. The discovery of changes in astrocyte transcriptome dynamics has improved researchers' understanding of spinal cord injury lesion progression and provided new insights into the treatment of spinal cord injury at different time points. To date, all of these findings need to be validated by more basic research and sufficient clinical trials. In the future, single-cell sequencing technology, through interdisciplinary collaboration with bioinformatics, computer science, tissue engineering, and clinical medicine, is expected to open a new window for the treatment of spinal cord injury.
Spinal Cord Injuries/metabolism*
;
Astrocytes/cytology*
;
Single-Cell Analysis/methods*
;
Humans
;
Animals
;
Transcriptome
;
Nerve Regeneration
5.Correlation of IGF2 levels with sperm quality, inflammation, and DNA damage in infertile patients.
Jing-Gen WU ; Cai-Ping ZHOU ; Wei-Wei GUI ; Zhong-Yan LIANG ; Feng-Bin ZHANG ; Ying-Ge FU ; Rui LI ; Fang WU ; Xi-Hua LIN
Asian Journal of Andrology 2025;27(2):204-210
Insulin-like growth factor 2 (IGF2) is a critical endocrine mediator implicated in male reproductive physiology. To investigate the correlation between IGF2 protein levels and various aspects of male infertility, specifically focusing on sperm quality, inflammation, and DNA damage, a cohort of 320 male participants was recruited from the Women's Hospital, Zhejiang University School of Medicine (Hangzhou, China) between 1 st January 2024 and 1 st March 2024. The relationship between IGF2 protein concentrations and sperm parameters was assessed, and Spearman correlation and linear regression analysis were employed to evaluate the independent associations between IGF2 protein levels and risk factors for infertility. Enzyme-linked immunosorbent assay (ELISA) was used to measure IGF2 protein levels in seminal plasma, alongside markers of inflammation (tumor necrosis factor-alpha [TNF-α] and interleukin-1β [IL-1β]). The relationship between seminal plasma IGF2 protein levels and DNA damage marker phosphorylated histone H2AX (γ-H2AX) was also explored. Our findings reveal that IGF2 protein expression decreased notably in patients with asthenospermia and teratospermia. Correlation analysis revealed nuanced associations between IGF2 protein levels and specific sperm parameters, and low IGF2 protein concentrations correlated with increased inflammation and DNA damage in sperm. The observed correlations between IGF2 protein levels and specific sperm parameters, along with its connection to inflammation and DNA damage, underscore the importance of IGF2 in the broader context of male reproductive health. These findings lay the groundwork for future research and potential therapeutic interventions targeting IGF2-related pathways to enhance male fertility.
Humans
;
Male
;
Insulin-Like Growth Factor II/metabolism*
;
Infertility, Male/genetics*
;
DNA Damage
;
Adult
;
Inflammation/metabolism*
;
Spermatozoa/metabolism*
;
Semen Analysis
;
Semen/metabolism*
;
Tumor Necrosis Factor-alpha/metabolism*
;
Histones/metabolism*
;
Interleukin-1beta/metabolism*
6.Clinical sub-phenotypes of acute kidney injury in children and their association with prognosis.
Lian FENG ; Min LI ; Zhen JIANG ; Jiao CHEN ; Zhen-Jiang BAI ; Xiao-Zhong LI ; Guo-Ping LU ; Yan-Hong LI
Chinese Journal of Contemporary Pediatrics 2025;27(1):47-54
OBJECTIVES:
To investigate the clinical sub-phenotype (SP) of pediatric acute kidney injury (AKI) and their association with clinical outcomes.
METHODS:
General status and initial values of laboratory markers within 24 hours after admission to the pediatric intensive care unit (PICU) were recorded for children with AKI in the derivation cohort (n=650) and the validation cohort (n=177). In the derivation cohort, a least absolute shrinkage and selection operator (LASSO) regression analysis was used to identify death-related indicators, and a two-step cluster analysis was employed to obtain the clinical SP of AKI. A logistic regression analysis was used to develop a parsimonious classifier model with simplified metrics, and the area under the curve (AUC) was used to assess the value of this model. This model was then applied to the validation cohort and the combined derivation and validation cohort. The association between SPs and clinical outcomes was analyzed with all children with AKI as subjects.
RESULTS:
In the derivation cohort, two clinical SPs of AKI (SP1 and SP2) were identified by the two-step cluster analysis using the 20 variables screened by LASSO regression, namely SPd1 group (n=536) and SPd2 group (n=114). The simplified classifier model containing eight variables (P<0.05) had an AUC of 0.965 in identifying the two clinical SPs of AKI (P<0.001). The validation cohort was clustered into SPv1 group (n=156) and SPv2 group (n=21), and the combined derivation and validation cohort was clustered into SP1 group (n=694) and SP2 group (n=133). After adjustment for confounding factors, compared with the SP1 group, the SP2 group had significantly higher incidence rates of multiple organ dysfunction syndrome and death during the PICU stay (P<0.001), and SP2 was significantly associated with the risk of death within 28 days after admission to the PICU (P<0.001).
CONCLUSIONS
This study establishes a parsimonious classifier model and identifies two clinical SPs of AKI with different clinical features and outcomes.The SP2 group has more severe disease and worse clinical prognosis.
Humans
;
Acute Kidney Injury/diagnosis*
;
Prognosis
;
Male
;
Female
;
Child
;
Child, Preschool
;
Phenotype
;
Infant
;
Logistic Models
;
Adolescent
7.Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood.
Juan YE ; Feng YE ; Ling HOU ; Wei WU ; Xiao-Ping LUO ; Yan LIANG
Chinese Journal of Contemporary Pediatrics 2025;27(1):94-100
OBJECTIVES:
To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.
METHODS:
A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.
RESULTS:
All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.
CONCLUSIONS
This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Male
;
Female
;
Child
;
Retrospective Studies
;
Glucokinase/genetics*
;
Adolescent
;
Child, Preschool
;
Glucose Tolerance Test
8.Exosomes derived from mesenchymal stem cells alleviate white matter damage in neonatal rats by targeting the NLRP3 inflammasome.
Chao WANG ; Yan-Ping ZHU ; BAYIERCAICIKE ; Yu-Qing FENG ; Yan-Mei WANG
Chinese Journal of Contemporary Pediatrics 2025;27(9):1119-1127
OBJECTIVES:
To investigate whether mesenchymal stem cell-derived exosomes (MSC-Exo) alleviate white matter damage (WMD) in neonatal rats by targeting the nucleotide-binding oligomerization domain-like receptor protein 3 (NLRP3).
METHODS:
Three-day-old Sprague-Dawley rats were randomly assigned to four groups: Sham, hypoxia-ischemia (HI), MSC-Exo, and MCC950 (NLRP3 inhibitor) (n=24 per group). The WMD model was established by unilateral common carotid artery ligation combined with hypoxia. Exosomes (1×108 particles/μL) were transplanted into the lateral ventricle using stereotaxic guidance. Fourteen days after modeling, hematoxylin-eosin staining was used to observe pathological changes in brain tissue, and transmission electron microscopy was used to assess myelinated axons. Western blotting was performed to detect the expression of myelin basic protein (MBP), NLRP3, caspase-1, and interleukin-1β (IL-1β). Immunohistochemistry was used to measure NLRP3, caspase-1, and IL-1β expression. Twenty-eight days post-modeling, behavioral changes were evaluated using the Morris water maze.
RESULTS:
In the HI group, marked inflammatory cell infiltration, extensive vacuolation, and decreased numbers of myelinated axons were observed compared to the Sham group. The MSC-Exo group showed reduced inflammatory infiltration, fewer vacuoles, and increased myelinated axons compared to the HI group, while the MCC950 group showed nearly normal cell morphology. Compared to the Sham group, the HI group exhibited decreased MBP expression, fewer platform crossings, shorter time in the target quadrant, increased expression of NLRP3, caspase-1, and IL-1β, and longer escape latency (all P<0.05). Compared to the HI group, the MSC-Exo and MCC950 groups showed increased MBP expression, more platform crossings, longer target quadrant stay, and reduced NLRP3, caspase-1, and IL-1β expression, as well as shorter escape latency (all P<0.05).
CONCLUSIONS
MSC-Exo may attenuate white matter damage in neonatal rats by targeting the NLRP3 inflammasome and promoting oligodendrocyte maturation.
Animals
;
NLR Family, Pyrin Domain-Containing 3 Protein/antagonists & inhibitors*
;
Rats, Sprague-Dawley
;
White Matter/pathology*
;
Inflammasomes/physiology*
;
Rats
;
Animals, Newborn
;
Mesenchymal Stem Cells
;
Interleukin-1beta/analysis*
;
Male
;
Caspase 1/analysis*
;
Hypoxia-Ischemia, Brain/therapy*
;
Myelin Basic Protein/analysis*
9.The Expression and Clinical Significance of TCP1 in Newly Diagnosed Acute Myeloid Leukemia Patients.
Jia-Jia LI ; Yan-Ping WU ; Lin LIU ; Meng-Meng ZHANG ; Meng WANG ; Ping-Ping ZHANG ; Feng ZHANG
Journal of Experimental Hematology 2025;33(2):339-343
OBJECTIVE:
To detect the expression level of T-complex polypeptide 1 (TCP1) in the bone marrow of newly diagnosed acute myeloid leukemia (AML) patients, and explore its correlation with clinical characteristics and prognosis.
METHODS:
The bone marrow samples from 80 newly diagnosed AML patients and 30 iron deficiency anemia (IDA) patients were collected, and real time fluorescence quantitative PCR was used to detect the expression level of TCP1 . The clinical data of AML patients were collected, and the correlation of TCP1 expression with clinical characteristics and prognosis of patients were analyzed. The impact of TCP1 on overall survival (OS) of AML patients was identified by using Kaplan-Meier curve analysis. Cox regression analysis was used to identify the factors affecting prognosis of AML patients.
RESULTS:
Compared with IDA patients, the expression of TCP1 was significantly increased in AML patients (P < 0.01). The high expression group of TCP1 showed a higher proportion of patients with ≥60 years and non-remission after treatment, more accompanied by TET2 mutation and poor prognosis but shorter OS compared to the low expression group (all P < 0.05). The results of multivariate Cox regression analysis showed that age, chromosomal abnormalities, therapeutic efficacy and TCP1 expression were independent risk factors affecting prognosis of AML patients (all P < 0.05).
CONCLUSION
TCP1 is significantly upregulated in AML patients, and its expression is associated with partial clinical features and poor prognosis. It can serve as a prognostic indicator and potential therapeutic target for AML patients.
Gene Expression Regulation, Leukemic
;
Leukemia, Myeloid, Acute/metabolism*
;
Humans
;
Gene Expression Profiling
;
Bone Marrow/metabolism*
;
Anemia, Iron-Deficiency/metabolism*
;
Polymerase Chain Reaction
;
Prognosis
;
Kaplan-Meier Estimate
;
Proportional Hazards Models
;
Multivariate Analysis
;
Risk Factors
;
Chaperonin Containing TCP-1
10.Clinical Analysis of Primary Cutaneous CD8+ Aggressive Epidermotropic Cytotoxic T-Cell Lymphoma.
Ping CHENG ; Jun GUAN ; Yan FENG ; Hui CHENG
Journal of Experimental Hematology 2025;33(3):777-783
OBJECTIVE:
To report the clinical characteristics, diagnosis, treatment and prognosis of one patient with primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma (CD8+ PCAECTL), and to strengthen the understanding of this extremely rare type of lymphoma.
METHODS:
The clinical manifestations, diagnosis, treatment course, and prognosis of one patient with CD8+ PCAECTL admitted to our hospital were retrospectively analyzed.
RESULTS:
The patient is a 42-year-old female, with infiltrative skin rash on naso-facial and back as the main clinical manifestations. After pathological examination of the affected skin tissue, immunohistochemistry, molecular biology, and imaging, the diagnosis was confirmed as CD8+ PCAECTL, T3aN0M0 stage. Alternating chemotherapy with CHOP/HD-MTX (methotrexate, 6 g/m2) regimen was administered, and achieved complete remission (CR) after 4 cycles. After undergoing chemotherapy with DHAP regimen (cisplatin 100 mg/m2, d 1 + cytarabine 2 g/m2, q 12h, d 2 + dexamethasone 40 mg/d, d 1-4), the patient was mobilized for peripheral blood stem cells using recombinant human granulocyte colony-stimulating factor (G-CSF), and a sufficient number of CD34+ cells were successfully collected. Preconditioning was conducted with the BEAM regimen, followed by consolidation therapy with autologous hematopoietic stem cell transplantation (AHSCT). The patient remained in a disease-free survival state after 20 months of follow-up post-AHSCT.
CONCLUSION
CD8+ PCAECTL is extremely rare in clinical practice, with insidious onset and difficult early diagnosis. It is mainly characterized by the proliferation of epidermotropic CD8+ cytotoxic T cells and aggressive clinical course. At present, there is still no unified standard for the optimal treatment regimen, and the prognosis is very poor. Consolidation therapy with AHSCT after achieving remission through induction chemotherapy can improve the survival and prognosis of the CD8+ PCAECTL patients.
Humans
;
Female
;
Adult
;
Antineoplastic Combined Chemotherapy Protocols/therapeutic use*
;
Lymphoma, T-Cell, Cutaneous/diagnosis*
;
Retrospective Studies
;
Prognosis
;
CD8-Positive T-Lymphocytes
;
Skin Neoplasms/diagnosis*
;
T-Lymphocytes, Cytotoxic

Result Analysis
Print
Save
E-mail