OBJECTIVE To observe the in vitro induced drug resistance mechanisms of polymyxin B-resistant Acin-etobacter baumannii and explore the in vitro antimicrobial activity of polymyxin B combined with melatonin.METHODS Totally 10 strains of polymyxin B-sensitive A.baumannii were clinically isolated from the Affiliated Li Huili Hospital of Ningbo university between Jan.2021 to Dec.2021 and were induced to the polymyxin B-resistant strains by means of in vitro induction method.The drug resistance mechanisms of the polymyxin B-resistant A.baumannii strains were explored by polymerase chain reaction(PCR)combined with sequencing analysis.The minimum inhibitory concentrations(MICs)of the single and joint use of polymyxin B and melatonin were detected by using broth microdilution checkerboard.The antibacterial effect of polymyxin combined with melatonin was e-valuated by calculating fractional inhibitory concentration index(FICI).The strains that showed the remarkable synergistic effect for the antimicrobial activity were chosen to determine the time-kill curves.RESULTS Among the polymyxin B-induced drug-resistant A.baumannii strains,there were gene mutations at various loci of polymyxin resistance genes pmrB,lpxA and lpxD.The MIC of polymyxin B against A.baumannii strains declined after the combined use of polymyxin B and melatonin.The combined use of the two drugs that showed synergistic effect for antimicrobial activity accounted for 80.00％(8/10),the additive effect 20.00％(2/10).The time-kill curve showed that the combined use of polymyxin B and melatonin showed remarkable antibacterial effect at the 24th hour.CONCLUSIONS The drug resistance gene mutations that are mediated by chromosomes are the major drug resist-ance mechanisms of the A.baumannii strains to polymyxin B.The combined use of polymyxin B and melatonin may reverse the drug resistance of the A.baumannii to polymyxin B.

Aim To compare the observation results of atomic force microscopy(AFM)and scanning electron microscopy(SEM),and to summarize the main problems and solutions of AFM in observing biological macromolecules,using the observa-tion subjects of protein samples purified by our research group.Methods The protein samples were diluted to 15 nmol·L-1 with PBS,fixed on glass slides,silicon wafers,and mica sheets,dried,and made into solid-phase observation samples.SEM sam-ples were plated with platinum before observation.The surface structures of proteins were observed using AFM and SEM,sample heights were calculated,and differences in results were com-pared.Results Protein samples with positive charges tended to shift to the right during observation due to the repulsion of the AFM probe;mica sheets could effectively eliminate the positive charge of proteins to avoid sample movement;PBS provided a stable environment for protein samples,but the crystallization of PBS salts interfered with probe operation and imaging clarity;SEM samples needed to be plated with platinum before observa-tion and could not achieve the precision of AFM.Conclusions Both AFM and SEM can directly observe protein structures in vitro,with AFM providing higher precision results;when protein sample stability permits,ultrapure water is preferred as the sol-vent carrier,and volatile liquids such as ethanol can also serve as solvent carriers.The application of AFM offers a new approach for pharmacological studies on interactions between biological macromolecules.

Body weight abnormalities, including overweight, obesity, and underweight, have become a dual public health challenge in Chinese adults: overweight and obesity lead to a variety of chronic complications, while underweight increases the risks of malnutrition, sarcopenia, and organ dysfunction. To systematically address these issues, multidisciplinary experts in endocrinology, sports science, nutrition, and psychiatry from various regions have held multiple weight management seminars. Based on the latest epidemiological data and clinical evidence, they expanded the guideline to include assessment and intervention strategies for underweight, in addition to the core content of obesity management. This guideline outlines the etiological mechanisms, evaluation methods, and multidimensional management strategies for overweight and obesity, covering key areas such as diagnosis and assessment, medical nutrition therapy, exercise prescription, pharmacological intervention, and psychological support. It is intended to provide a scientific and standardized approach to weight management across the adult population, aiming to curb the rising prevalence of obesity, mitigate complications associated with abnormal body weight, and improve nutritional status and overall quality of life.

OBJECTIVE: Observational studies have found associations between inflammatory bowel disease (IBD) and the risk of dementia, including Alzheimer's dementia (AD) and vascular dementia (VD); however, these findings are inconsistent. It remains unclear whether these associations are causal. METHODS: We conducted a meta-analysis by systematically searching for observational studies on the association between IBD and dementia. Mendelian randomization (MR) analysis based on summary genome-wide association studies (GWASs) was performed. Genetic correlation and Bayesian co-localization analyses were used to provide robust genetic evidence. RESULTS: Ten observational studies involving 80,565,688 participants were included in this meta-analysis. IBD was significantly associated with dementia (risk ratio [ RR] =1.36, 95% CI = 1.04-1.78; I ² = 84.8%) and VD ( RR = 2.60, 95% CI = 1.18-5.70; only one study), but not with AD ( RR = 2.00, 95% CI = 0.96-4.13; I ² = 99.8%). MR analyses did not supported significant causal associations of IBD with dementia (dementia: odds ratio [ OR] = 1.01, 95% CI = 0.98-1.03; AD: OR = 0.98, 95% CI = 0.95-1.01; VD: OR = 1.02, 95% CI = 0.97-1.07). In addition, genetic correlation and co-localization analyses did not reveal any genetic associations between IBD and dementia. CONCLUSION Our study did not provide genetic evidence for a causal association between IBD and dementia risk. The increased risk of dementia observed in observational studies may be attributed to unobserved confounding factors or detection bias.
Humans ; Mendelian Randomization Analysis ; Inflammatory Bowel Diseases/complications* ; Dementia/etiology* ; Observational Studies as Topic ; Genome-Wide Association Study

Objective To compare the application effects of plankton multiplex polymerase chain reac-tion-capillary electrophoresis(PCR-CE),SYBR Green Ⅰ real-time quantitative PCR(qPCR)and microwave digestion-vacuum filtration-automated scanning electron microscopy(MD-VF-Auto SEM)in the diagnosis of drowning.Methods Lung,liver and kidney tissues from 212 drowned corpses and 30 non-drowned corpses were examined respectively by the three drowning-related plankton testing methods,and the detection rates of plankton in each tissue by three methods were compared.Results In drowned corpses,the total detection rates of PCR-CE,qPCR,and MD-VF-Auto SEM were 93.9%,96.2%,and 95.3%,respectively,with no statistically significant difference(P>0.05).The detection rate of lung tissue by MD-VF-Auto SEM(100%)was higher than those of PCR-CE and qPCR(P<0.05),and there was no significant difference in the detection rates of the three methods in liver or kidney tissues(P>0.05).In non-drowning corpses,a small number of diatoms(less than 10 cells/10 g)were detected by MD-VF-Auto SEM method,only in liver and kidney tissues,while the other two methods yielded negative results for all tissues.Conclusion All three methods have good efficacy in the examination of drowned corpses.The MD-VF-Auto SEM method directly observes diatom morpho-logical characteristics through scanning electron microscopy,and the qualitative and quantitative analy-ses are intuitive and accurate.It has great advantages in the examination of difficult degradation samples.The PCR-CE method and qPCR method have a low sample demand(0.5 g),are easy to operate and have short detection time(4-7 h).They are easy to be applied in the grassroots depart-ments and are suitable for the rapid determination of drowned corpses in routin cases.The combina-tion of the two DNA methods with the MD-VF-Auto SEM method can increase the detection rate of plankton,ensuring the reliability of examination results.This combined use is of significant importance in the application of drowning diagnosis.

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVE: To investigate the effectiveness of Xuanshen Yishen Decoction (XYD) in the treatment of hypertension. METHODS: Hospital electronic medical records from 2019-2023 were utilized to emulate a randomized pragmatic clinical trial. Hypertensive participants were eligible if they were aged ⩾40 years with baseline systolic blood pressure (BP) ⩾140 mm Hg. Patients treated with XYD plus antihypertensive regimen were assigned to the treatment group, whereas those who followed only antihypertensive regimen were assigned to the control group. The primary outcome assessed was the attainment rate of intensive BP control at discharge, with the secondary outcome focusing on the 6-month all-cause readmission rate. RESULTS: The study included 3,302 patients, comprising 2,943 individuals in the control group and 359 in the treatment group. Compared with the control group, a higher proportion in the treatment group achieved the target BP for intensive BP control [8.09% vs. 17.5%; odds ratio (OR)=2.29, 95% confidence interval (CI)=1.68 to 3.13; P<0.001], particularly in individuals with high homocysteine levels (OR=3.13; 95% CI=1.72 to 5.71; P<0.001; P for interaction=0.041). Furthermore, the 6-month all-cause readmission rate in the treatment group was lower than in the control group (hazard ratio=0.58; 95% CI=0.36 to 0.91; P=0.019), and the robustness of the results was confirmed by sensitivity analyse. CONCLUSIONS XYD could be a complementary therapy for intensive BP control. Our study offers real-world evidence and guides the choice of complementary and alternative therapies. (Registration No. ChiCTR2400086589).
Adult ; Aged ; Female ; Humans ; Male ; Middle Aged ; Antihypertensive Agents/pharmacology* ; Blood Pressure/drug effects* ; Drugs, Chinese Herbal/pharmacology* ; Hypertension/physiopathology* ; Patient Readmission ; Treatment Outcome

Digital technologies have become an integral part of complete denture restoration. With advancement in computer-aided design and computer-aided manufacturing (CAD/CAM), tools such as intraoral scanning, facial scanning, 3D printing, and numerical control machining are reshaping the workflow of complete denture restoration. Unlike conventional methods that rely heavily on clinical experience and manual techniques, digital technologies offer greater precision, predictability, and efficacy. They also streamline the process by reducing the number of patient visits and improving overall comfort. Despite these improvements, the clinical application of digital complete denture restoration still faces challenges that require further standardization. The major issues include appropriate case selection, establishing consistent digital workflows, and evaluating long-term outcomes. To address these challenges and provide clinical guidance for practitioners, this expert consensus outlines the principles, advantages, and limitations of digital complete denture technology. The aim of this review was to offer practical recommendations on indications, clinical procedures and precautions, evaluation metrics, and outcome assessment to support digital restoration of complete denture in clinical practice.
Humans ; Denture, Complete ; Computer-Aided Design ; Denture Design/methods* ; Consensus ; Printing, Three-Dimensional

Image 1.

Body weight abnormalities, including overweight, obesity, and underweight, have become a dual public health challenge in Chinese adults: overweight and obesity lead to a variety of chronic complications, while underweight increases the risks of malnutrition, sarcopenia, and organ dysfunction. To systematically address these issues, multidisciplinary experts in endocrinology, sports science, nutrition, and psychiatry from various regions have held multiple weight management seminars. Based on the latest epidemiological data and clinical evidence, they expanded the guideline to include assessment and intervention strategies for underweight, in addition to the core content of obesity management. This guideline outlines the etiological mechanisms, evaluation methods, and multidimensional management strategies for overweight and obesity, covering key areas such as diagnosis and assessment, medical nutrition therapy, exercise prescription, pharmacological intervention, and psychological support. It is intended to provide a scientific and standardized approach to weight management across the adult population, aiming to curb the rising prevalence of obesity, mitigate complications associated with abnormal body weight, and improve nutritional status and overall quality of life.