ObjectiveThis paper aims to investigate and evaluate the staged efficacy and safety of the representative empirical prescription of the “Zhu Ke Jiao” theory， Qijia Rougan prescription， combined with entecavir in the treatment of hepatic fibrosis in chronic hepatitis B. MethodsA multicenter randomized controlled clinical study was conducted， and 101 patients diagnosed with chronic hepatitis B-related hepatic fibrosis （CHB-HF） who met the diagnosis and inclusion criteria were randomly assigned to an observation group （Qijia Rougan prescription + entecavir） and a control group （entecavir）. The treatment duration was 24 weeks. Liver stiffness measurement （LSM）， fibrosis-4 index （FIB-4）， portal vein diameter， hepatitis B serology， biochemical indicators， hepatic fibrosis markers in serum ［hyaluronic acid （HA）， laminin （LN）， procollagen Ⅲ peptide （PⅢP）， and type Ⅳ collagen （Ⅳ-C）］， and traditional Chinese medicine syndrome scores were used as efficacy evaluation indicators. Efficacy assessments and explorations of different staged subgroups of Qijia Rougan prescription were conducted according to LSM values based on the Metavir pathological staging standard. ResultsA total of 98 cases were included for statistical analysis， with 49 cases in the observation group and 49 in the control group. The general data of the patients in both groups were comparable. Compared with the same group before treatment， the observation group showed a significant reduction in LSM and FIB-4 （P<0.01）， as well as notable improvements in LN， Ⅳ-C， and various TCM syndrome scores （P<0.05， P<0.01）. When compared to the control group after treatment， the observation group demonstrated significant improvements in LSM， FIB-4， and various TCM syndrome score indicators （P<0.05， P<0.01）， indicating that the observation group performed better than the control group. Subgroup analysis of the regression of hepatic fibrosis stages showed that compared to the same group before treatment， the observation group had better improvement in regression of stages F2 and F3 （P<0.05）. When compared to the control group after treatment， the observation group exhibited superior improvement in regression of stage F3 （P<0.05）. No adverse events occurred in either group during the treatment period. ConclusionCompared with entecavir alone， the combination of Qijia Rougan prescription and entecavir significantly improves the degree of hepatic fibrosis and clinical TCM symptoms in patients. The optimal intervention period is primarily during stage F3， which is a potential “interception” point of the “Zhu Ke Jiao” theory.

Background Meteorological factors are among the key extrinsic triggers for the onset and exacerbation of cardiovascular and cerebrovascular diseases (CVD). Against the backdrop of sustained global warming, elucidating the impact of ambient temperature and atmospheric pressure on CVD, especially on pre-hospital CVD emergent events, has become imperative for evidence-based prevention and emergency preparedness. Objective To quantify the temporal trends of daily mean temperature and atmospheric pressure and their associations with pre-hospital CVD emergent events in Yantai, and to explore effect modification by demographic subgroups and geographic areas, thereby providing an empirical basis for the rational allocation of emergency medical resources. Methods Pre-hospital CVD emergency data from January 1, 2016 to December 31, 2022 were selected from the Yantai 120 Emergency Medical Command System. Synchronous meteorological factors and environmental pollutant data were obtained from the websites of the National Oceanic and Atmospheric Administration and the National Centers for Environmental Information of the United States. Time-series analysis combined with distributed lag non-linear model was used to analyze the association between daily temperature, atmospheric pressure, and pre-hospital CVD emergencies. Average annual percentage changes (AAPC) were calculated using Joinpoint (version 5.2.0.0) to reflect temporal trends. Spearman correlation analysis was employed to screen variables with low collinearity for inclusion in the multi-pollutant adjusted models. Results From 2016 to 2022, a total of 268275 pre-hospital CVD emergency cases were recorded in Yantai City, showing an increasing annual trend (AAPC=7.16%, P=0.002). Emergency volume, daily temperature, atmospheric pressure, and PM₁₀ displayed marked seasonal patterns, with summer bottoms and winter peaks for emergencies, daily temperature higher in summer and lower in winter, and the inverse for atmospheric pressure. Correlation analysis showed that both daily temperature and atmospheric pressure were positively correlated with O₃, with correlation coefficients of 0.745 and 0.723, respectively; negatively correlated with PM_2.5, with correlation coefficients of −0.246 and −0.235, respectively; and negatively correlated with PM₁₀, with correlation coefficients of −0.241 and −0.229, respectively (P < 0.05). A U-shaped correlation was revealed between daily temperature and pre-hospital CVD emergency risk. Using 24 °C as the reference, risk was elevated at both low and high daily temperatures, with the strongest cold effect at –11 ℃ (RR=1.53, 95%CI: 1.35, 1.73) and strongest heat effect at 30 ℃ (RR=1.06, 95%CI: 1.01, 1.11); cold effects were prolonged (lag0–14d) compared to heat effects. Atmospheric pressure exhibited a positive association with emergencies; using a median of 1012.2 hPa as the reference, the maximum risk occurred at 1037 hPa (RR=1.25, 95%CI: 1.03, 1.52), with a 0–5 d lag. In the subgroup analysis, the impact of low temperature was more pronounced among females (RR_{−9 ℃}=1.66), people over 60 years (RR_{−9 ℃}=1.91), and rural residents (RR_{−9 ℃}=1.76). High atmospheric pressure significantly increased the risk of pre-hospital CVD emergency among females (RR_{1035 hPa}=1.54), people under 18 years (RR_{1035 hPa}=3.62), and rural residents (RR_{1035 hPa}=1.46). The sensitivity analysis results indicated that, after excluding the impact of pandemic and the degrees of freedom for time variations, the effects of daily average temperature and atmospheric pressure on pre-hospital CVD emergency volume were consistent with the primary analysis findings. Conclusion Both non-optimal temperature and atmospheric pressure significantly increase the pre-hospital CVD emergency volume; therefore, emergency medical services should develop targeted response protocols, optimize resource allocation, and intensify public health education to mitigate the pre-hospital burden attributable to temperature and pressure fluctuations.

ObjectiveThis paper aims to investigate the traditional Chinese medicine syndrome types in patients with chronic hepatitis B （CHB） complicated by metabolic dysfunction-associated fatty liver disease （MAFLD） and explore the correlations between these syndrome types and clinical indicators， as well as ocular manifestation characteristics， thereby providing a reference for syndrome differentiation and treatment strategies in traditional Chinese medicine. MethodsGeneral data， information from the four diagnostic methods of traditional Chinese medicine， clinical indicators， and ocular manifestation data were collected from 506 patients with CHB complicated by MAFLD enrolled at the Public Health Clinical Center of Chengdu between June 2024 and December 2024. Cluster analysis， principal component analysis， and complex network models were employed to identify the distribution patterns of traditional Chinese medicine syndromes. Correlations between different syndrome types and clinical indicators， as well as ocular manifestation characteristics， were further analyzed. ResultsThe predominant syndromes identified in patients with CHB complicated by MAFLD were dampness and heat accumulation （51.58%）， liver depression with spleen deficiency （31.62%）， blood stasis obstructing collaterals （8.89%）， and Qi-Yin deficiency （7.91%）. No statistically significant differences were found among the four syndrome types in routine blood tests and liver function indicators. However， patients with the dampness and heat accumulation type exhibited significantly higher levels of total cholesterol （TC）， triglycerides （TG）， low-density lipoprotein cholesterol （LDL-C）， liver stiffness measurement （LSM）， controlled attenuation parameter （CAP）， and alpha-fetoprotein （AFP）， along with lower levels of high-density lipoprotein cholesterol （HDL-C）， compared with those with other syndrome types. Regarding ocular manifestations， the incidence of moon halo signs was significantly higher in patients with the blood stasis obstructing collaterals type than in those with other syndrome types. Additionally， the incidence in scleral zone 3 （corresponding to the large intestine） was higher in patients with the damp and heat accumulation type. ConclusionDampness and heat accumulation is the core syndrome type in patients with CHB complicated by MAFLD， commonly accompanied by spleen deficiency， liver depression， blood stasis， and Yin deficiency. A complex syndrome pattern characterized by a predominance of dampness and heat， along with a mixture of deficiency and excess， is formed. Different traditional Chinese medicine syndrome types are associated with distinct clinical indicators and ocular manifestation characteristics. Among them， patients with the dampness and heat accumulation type exhibit more pronounced metabolic disturbances and liver injury， whereas those with the blood stasis type show a higher incidence of moon halo signs. Abnormalities in scleral zone 3 are also more prevalent in patients with dampness and heat type.

ObjectiveTo investigate the molecular mechanisms related to angiogenesis during the development and progression of diabetic retinopathy （DR）. MethodsAngiogenesis-related genes were obtained from the Gencard website and intersected with differentially expressed genes from DR datasets （GSE60436 and GSE94019）. Functional enrichment and protein-protein interaction （PPI） networks were then used to screen candidate genes and evaluate their diagnostic value. Gene set enrichment analysis （GSEA） was used to explore potential pathways underlying candidate genes， and immune infiltration analysis revealed associations between candidate genes and immune cells. Cellular experiments were conducted to validate the role of fibronectin 1 （FN1） in human retinal microvascular endothelial cells （HRMECs） under high glucose （HG） conditions. ResultsA total of 237 differentially expressed genes related to angiogenesis were identified， enriched in pathways such as phosphoinositide 3-kinase/protein kinase B signaling pathway （PI3K-Akt）， tumor suppressor protein 53 （P53）， tumor necrosis factor （TNF）， and Janus kinase （JAK）/signal transducer and activator of transcription signaling pathway （STAT）. Among them， collagen type I alpha 1 chain （COL1A1）， COL1A2， FN1， TNF， and tumor protein p53 （TP53） were key genes with high diagnostic value. GSEA indicated that these genes were involved in multiple signaling pathways， including P53. CIBERSORTx analysis revealed significant associations with the infiltration of multiple immune cells. HG treatment led to the upregulation of FN1. In HG-induced HRMECs， compared with the si-NC control group， si-FN1 significantly reduced cell proliferation， migration， and tube formation， while P53 protein expression was increased. ConclusionThis study reveals the important role of FN1 in angiogenesis in DR and suggests that it may be a potential diagnostic and therapeutic target.

Background Fine particulate matter (PM_2.5) monitoring stations may generate missing data for a certain period of time due to various factors. This data loss will adversely affect air quality assessment and pollution control decision-making. Objective To propose an inverse distance weighted (IDW) spatiotemporal interpolation method based on particle swarm optimization (PSO) to interpolate and fill missing PM_2.5 spatiotemporal sequence data and increase interpolation accuracy. Methods An interpolation experiment was designed into two parts. The first part used hourly PM_2.5 observational data from four moments on January 1, 2017 in the Yangtze River Delta region. The second part employed daily PM_2.5 observational data from the first 10 d of January 2017 in the Beijing-Tianjin-Hebei region. Interpolation accuracy was evaluated using four metrics: root mean square error (RMSE), mean absolute error (MAE), mean absolute percentage error (MAPE), and mean relative error (MRE). Results IDW spatiotemporal interpolation method optimized with PSO significantly improved the accuracy of filling missing PM_2.5 spatiotemporal sequence data. In the hourly-scale experiment conducted in the Yangtze River Delta region, compared to a distance index of 2, the accuracy metrics RMSE, MAE, MAPE, and MRE generated by the proposed method improved on average by 0.17 μg·m⁻³, 0.27 μg·m⁻³, 0.17%, and 0.01%, respectively. The PM_2.5 spatial field maps generated for four moments based on this method clearly illustrated the spatiotemporal distribution characteristics of hourly PM_2.5 concentrations in the Yangtze River Delta region. In the daily-scale experiment conducted in the Beijing-Tianjin-Hebei region, the PSO-optimized distance index outperformed the traditional method, with interpolation accuracy improvements of approximately 0.215 μg·m⁻³, 0.283 μg·m⁻³, 0.174%, and 0.014%, respectively. Furthermore, the seasonal PM_2.5 spatial field maps generated by this method revealed the spatiotemporal distribution characteristics of PM_2.5 concentrations in the Beijing-Tianjin-Hebei region across different seasons, further validating the effectiveness and applicability of this method. Conclusion The IDW spatiotemporal interpolation method optimized with PSO is highly accurate and reliable for interpolating the missing data in the Yangtze River Delta region and the Beijing-Tianjin-Hebei region, providing valuable insights for air pollution control and public health protection.

[Objective] To establish a new scoring system to predict the perioperative outcomes (operation time, intraoperative blood loss, and trifecta achievement) in patients undergoing robot-assisted partial nephrectomy (RAPN) by integrating the RENAL and Mayo adhesive probability (MAP) scores. [Methods] Clinical data of 178 patients with renal cell carcinoma who underwent RAPN performed by the same surgeon in our hospital during Jan.2015 and Jan.2022 were retrospectively analyzed.The RENAL and MAP scores of all patients were calculated.Linear regression and logistic regression were used to evaluate the associations between the components of the RENAL and MAP scores (a total of 6 variables) and perioperative outcomes.The factors with significant associations were then included into logistic regression analysis to identify independent predictors for constructing an assessment system for perioperative outcomes, and the receiver operating characteristic (ROC) curve was plotted to calculate the area under the curve (AUC) to predict its efficacy. [Results] Multivariate linear regression analysis showed that tumor size (β=6.14, 95%CI: 1.93—10.34, P=0.004), exophytic rate (β=10.60, 95%CI: 3.44—17.76, P=0.004), and perinephric fat thickness (β=16.48, 95%CI: 8.52—24.45, P<0.001) were significantly associated with operation time.Tumor size (β=10.55 95%CI: 5.60—15.49, P<0.001) was associated with both intraoperative blood loss and trifecta achievement (OR=1.73, 95%CI: 1.26—2.36, P=0.001). Multivariate logistic regression analysis of these 3 factors identified tumor size (OR=9.07, 95% CI: 1.18—69.45, P=0.03) and perinephric fat thickness (OR=2.28, 95%CI: 1.86—6.04, P=0.01) as independent predictors of perioperative outcomes.Based on these findings, the tumor size and perinephric fat thickness (RP) scoring was constructed, which demonstrated better predictive ability than RENAL score or MAP score alone (RP vs.RENAL vs.MAP: 0.766 vs.0.548 vs.0.684). [Conclusion] The RP score includes fewer variables than the RENAL and MAP scores but outperforms them.

Objective To investigate the setup error in patients with spinal bone metastasis who underwent radiotherapy under the guidance of kilovoltage cone-beam CT (KV-CBCT). Methods A total of 118 patients with spinal metastasis who underwent radiotherapy, including 17 cases of cervical spine, 62 cases of thoracic spine, and 39 cases of lumbar spine, were collected. KV-CBCT scans were performed using the linear accelerators from Elekta and Varian’s EDGE system. CBCT images were registered with reference CT images in the bone window mode. A total of 973 data were collected, and 3D linear errors were recorded. Results The patients with spinal bone metastasis were grouped by site, height, weight, and BMI. The P value of the patients grouped only by site was P<0.05, which was statistically significant. Conclusion When grouped by site in the 3D direction, the positioning effect of cervical spine is better than that of thoracic and lumbar spine. The positioning effect of the thoracic spine is better in the head and foot direction but worse in the left and right direction compared with that of the lumbar spine. Instead of extending or narrowing the margin according to the BMI of patients with spinal metastasis, the margin must be changed according to the site of spinal bone metastasis.

ObjectiveThis study aimed to explore the effects of aerobic exercise on cognitive function in aging mice and to elucidate the underlying molecular mechanisms by which aerobic exercise ameliorates cognitive decline through the regulation of gut microbiota-metabolite network. By providing novel insights into the interplay between exercise, gut microbiota, and cognitive health, this research seeks to offer a robust theoretical foundation for developing anti-aging strategies and personalized exercise interventions targeting aging-related cognitive dysfunction. MethodsUsing naturally aged C57BL/6 mice as the experimental model, this study employed a multi-omics approach combining 16S rRNA sequencing and wide-targeted metabolomics analysis. A total of 18 mice were divided into 3 groups: young control (YC, 4-month-old), old control (OC, 21-month-old), and old+exercise (OE, 21-month-old with 12 weeks of moderate-intensity treadmill training) groups. Behavioral assessments, including the Morris water maze (MWM) test, were conducted to evaluate cognitive function. Histopathological examinations of brain tissue sections provided morphological evidence of neuronal changes. Fecal samples were collected for gut microbiota and metabolite profiling via 16S rRNA sequencing and ultra-performance liquid chromatography coupled with quadrupole-time-of-flight mass spectrometry (UPLC-QTOF-MS). Data were analyzed using a combination of statistical and bioinformatics tools to identify differentially abundant microbial taxa and metabolites and to construct interaction networks between them. ResultsBehavioral tests revealed that 12 weeks of aerobic exercise significantly improved spatial learning and memory capacity of aged mice, as evidenced by reduced escape latency and increased target area exploration and platform crossings in the MWM. Histopathological analysis demonstrated that exercise mitigated aging-related neuronal damage in the hippocampus, enhancing neuronal density and morphology. 16S rRNA sequencing indicated that exercise increased gut microbiota α‑diversity and enriched beneficial bacterial genera, including Bifidobacterium, Parabacteroides, and Rikenella. Metabolomics analysis identified 32 differentially regulated metabolites between OC and OE groups, with 94 up-regulated and 30 down-regulated in the OE group when compared with OC group. These metabolites were primarily involved in energy metabolism reprogramming (e.g., L-homocitrulline), antioxidant defense (e.g., L-carnosine), neuroprotection (e.g., lithocholic acid), and DNA repair (e.g., ADP-ribose). Network analysis further revealed strong positive correlations between specific bacteria and metabolites, such as Parabacteroides with ADP-ribose and Bifidobacterium with lithocholic acid, suggesting potential neuroprotective pathways mediated by the gut microbiota-metabolite axis. ConclusionThis study provides comprehensive evidence that aerobic exercise elicits cognitive benefits in aging mice by modulating the gut microbiota-metabolite network. These findings highlight three key mechanisms: (1) the proliferation of beneficial gut bacteria enhances metabolic reprogramming to boost DNA repair pathways; (2) elevated neuroinflammation-inhibiting factors reduce neurodegenerative changes; and (3) enhanced antioxidant defenses maintain neuronal homeostasis. These results underscore the critical role of the “microbiota-metabolite-brain” axis in mediating the cognitive benefits of aerobic exercise. This study not only advances our understanding of the gut-brain axis in aging but also offers a scientific basis for developing personalized exercise and probiotic-based interventions targeting aging-related cognitive decline. Future research should further validate these mechanisms in non-human primates and human clinical trials to establish the translational potential of exercise-induced gut microbiota-metabolite modulation for combating neurodegenerative diseases.

Insulin-like growth factor 2 (IGF2) is a critical endocrine mediator implicated in male reproductive physiology. To investigate the correlation between IGF2 protein levels and various aspects of male infertility, specifically focusing on sperm quality, inflammation, and DNA damage, a cohort of 320 male participants was recruited from the Women's Hospital, Zhejiang University School of Medicine (Hangzhou, China) between 1 st January 2024 and 1 st March 2024. The relationship between IGF2 protein concentrations and sperm parameters was assessed, and Spearman correlation and linear regression analysis were employed to evaluate the independent associations between IGF2 protein levels and risk factors for infertility. Enzyme-linked immunosorbent assay (ELISA) was used to measure IGF2 protein levels in seminal plasma, alongside markers of inflammation (tumor necrosis factor-alpha [TNF-α] and interleukin-1β [IL-1β]). The relationship between seminal plasma IGF2 protein levels and DNA damage marker phosphorylated histone H2AX (γ-H2AX) was also explored. Our findings reveal that IGF2 protein expression decreased notably in patients with asthenospermia and teratospermia. Correlation analysis revealed nuanced associations between IGF2 protein levels and specific sperm parameters, and low IGF2 protein concentrations correlated with increased inflammation and DNA damage in sperm. The observed correlations between IGF2 protein levels and specific sperm parameters, along with its connection to inflammation and DNA damage, underscore the importance of IGF2 in the broader context of male reproductive health. These findings lay the groundwork for future research and potential therapeutic interventions targeting IGF2-related pathways to enhance male fertility.
Humans ; Male ; Insulin-Like Growth Factor II/metabolism* ; Infertility, Male/genetics* ; DNA Damage ; Adult ; Inflammation/metabolism* ; Spermatozoa/metabolism* ; Semen Analysis ; Semen/metabolism* ; Tumor Necrosis Factor-alpha/metabolism* ; Histones/metabolism* ; Interleukin-1beta/metabolism*

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test