Objective This study aimed to provide an effective scientific basis for prevention and control of cockroaches on aircrafts by identifying cockroach-carried pathogens,and assess the insecticidal efficacy of gel bait mediated cockroach control on aircrafts,to provide technical guidance for aircraft disinsection.Methods Cassette-trapping was used to trap cockroaches,and the carried pathogens were detected using bacterial cultivation techniques.The gel bait mediated killing rate was calculated after 1,7,and 30 d by field application of gel bait.Results A total of 411 cockroaches were captured,and all were identified as Blattella germanica.26 strains of pathogenic bacteria were isolated from the trapped cockroaches.The killing rates of cockroaches were 58.8％-96.3％with 1-30 day application of gel bait.Statistically significant differences were observed in cockroach killing rates on different days(χ2=58.95,P<0.01).Conclusions B.germanica carry a large variety of pathogenic bacteria and opportunistic pathogens and are thus important infectious disease carriers.Gel bait agents have proven to be very effective against cockroaches on aircrafts.

Objective:To investigate effects of macrophage polarization on PI3K/Akt/mTOR signaling pathway and inflammatory response of vascular smooth muscle cells.Methods:THP-1 cells were induced to become macrophages by phaboate,then treated with LPS and IFN-γ,IL-4 and IL-13 for 48 h,and cultured with fresh medium without serum for 24 h.Supernatant was used as conditioned medium.Vascular smooth muscle cells were divided into control group,M0 medium group,M1 medium group and M2 medium group.CCK-8 was used to detect cell proliferation,flow cytometry was used to detect cell apoptosis,ELISA was used to detect expressions of inflammatory cytokines IL-1α,IL-6 and TGF-β in supernatant of cells,and mRNA and phosphorylated protein expressions of PI3K,Akt and mTOR in vascular smooth muscle cells were detected by RT-qPCR and Western blot.Results:Compared with control group,cell proliferation ability and TGF-β level in supernatant of M0 medium group were significantly decreased(P<0.01),apoptosis rate,IL-1α and IL-6 levels in cell supernatant,mRNA and protein phosphorylation levels of PI3K,Akt and mTOR in cells were significantly increased(P<0.01).Compared with M0 medium group,cell proliferation ability and TGF-β level in supernatant of M1 medium group were significantly decreased(P<0.05),apoptosis rate,IL-1α and IL-6 levels in cell supernatant,mRNA and protein phosphorylation levels of PI3K,Akt and mTOR in cells were significantly increased(P<0.01),the trend was opposite in M2 medium group(P<0.05).Conclusion:Macrophage polarization can regulate expressions of inflammatory cytokines by regulating PI3K/Akt/mTOR signaling pathway,and participate in inflammatory response in atherosclerosis.

OBJECTIVE: Resveratrol (Res) is a promising anticancer drug against hepatocellular carcinoma (HCC), but whether its anti-HCC effects implicate mitophagy remains unclear. Therefore, we aimed to explore the specific role of Res in mitophagy and the related mechanisms during the treatment of HCC. METHODS: HepG2 cells and tumor-grafted nude mice were used to investigate the effects of low-, middle- and high-dose of Res on HCC progression and mitophagy in vitro and in vivo, respectively. A series of approaches including cell counting kit-8, flow cytometry, wound healing and transwell assays were used to evaluate tumor cell functions. Transmission electron microscopy, immunofluorescence and Western blotting were used to assess mitophagy. Mitochondrial oxygen consumption rate, reactive oxygen species and membrane potential were used to reflect mitochondrial function. After disrupting the expression of metastasis-associated lung adenocarcinoma transcript 1 (MALAT1), miR-143-3p, and ribonucleoside reductase M2 (RRM2), the effects of the MALAT1/miR-143-3p/RRM2 axis on cell function and mitophagy under Res treatment were explored in vitro. Additionally, dual-luciferase reporter and chromatin immunoprecipitation were used to confirm interactions between target genes. RESULTS: Res significantly inhibited the proliferation and promoted apoptosis of HCC cells in vitro, while significantly suppressing tumor growth in a dose-dependent manner and inducing mitophagy and mitochondrial dysfunction in vivo. Interestingly, MALAT1 was highly expressed in HCC cells and its knockdown upregulated miR-143-3p expression in HCC cells, which subsequently inhibited RRM2 expression. Furthermore, in nude mice grafted with HCC tumors and treated with Res, the expression of MALAT1, miR-143-3p and RRM2 were altered significantly. In vitro data further supported the targeted binding relationships between MALAT1 and miR-143-3p and between miR-143-3p and RRM2. Therefore, a series of cell-based experiments were carried out to study the mechanism of the MALAT1/miR-143-3p/RRM2 axis involved in mitophagy and HCC; these experiments revealed that MALAT1 knockdown, miR-143-3p mimic and RRM silencing potentiated the antitumor effects of Res and its activation of mitophagy. CONCLUSION Res facilitated mitophagy in HCC and exerted anti-cancer effects by targeting the MALAT1/miR-143-3p/RRM2 axis. Please cite this article as: Feng CY, Cai CS, Shi XQ, Zhang ZJ, Su D, Qiu YQ. Resveratrol promotes mitophagy via the MALAT1/miR-143-3p/RRM2 axis and suppresses cancer progression in hepatocellular carcinoma. J Integr Med. 2025; 23(1): 79-91.
Humans ; MicroRNAs/genetics* ; Liver Neoplasms/metabolism* ; Carcinoma, Hepatocellular/metabolism* ; Mitophagy/drug effects* ; Resveratrol/pharmacology* ; Animals ; Mice, Nude ; RNA, Long Noncoding/genetics* ; Hep G2 Cells ; Mice ; Disease Progression ; Mice, Inbred BALB C

In continuation of research aimed at identifying anti-inflammatory agents from natural sesquiterpenoids, an activity-guided fractionation approach utilizing lipopolysaccharide (LPS)-mediated RAW264.7 cells was employed to investigate chemical constituents from Inula Britannica (I. britannica). Seven novel sesquiterpenoid dimers inulabritanoids A-G (1-7) and two novel sesquiterpenoid monomers inulabritanoids H (8) and I (9) were isolated from I. britannica together with eighteen known compounds (10-27). The structural elucidation was accomplished through comprehensive analysis of 1D and 2D nuclear magnetic resonance (NMR), high-resolution mass spectrometry (HR-MS), and electronic circular dichroism (ECD) spectra, complemented by quantum chemical calculations. Compounds 1, 2, 12, 16, 19, and 26 demonstrated inhibitory effects on NO production, with IC₅₀ values of 3.65, 5.48, 3.29, 6.91, 3.12, and 5.67 μmol·L^-1, respectively. Mechanistic studies revealed that compound 1 inhibited IκB kinase β (IKKβ) phosphorylation, thereby blocking nuclear factor κB (NF-κB) nuclear translocation, and activated the kelch-like ECH-associated protein 1 (Keap1)/nuclear factor erythroid 2-related factor 2 (Nrf2) signal pathway, leading to decreased expression of NADPH oxidase 2 (NOX-2), inducible nitric oxide synthase (iNOS), tumor necrosis factor α (TNF-α), interleukin-6 (IL-6), monocyte chemotactic protein-1 (MCP-1), IL-1β, and IL-1α and increased expression of NAD(P)H: quinone oxidoreductase 1 (NQO-1) and heme oxygenase-1 (HO-1), thus exhibiting anti-inflammatory effects in vitro. These results indicate that dimeric sesquiterpenoids may serve as promising candidates for anti-inflammatory drug development.
Mice ; Animals ; Sesquiterpenes/isolation & purification* ; Anti-Inflammatory Agents/isolation & purification* ; Inula/chemistry* ; RAW 264.7 Cells ; Nitric Oxide ; Molecular Structure ; NF-kappa B/immunology* ; NF-E2-Related Factor 2/immunology* ; Macrophages/immunology* ; Nitric Oxide Synthase Type II/immunology* ; Plant Extracts/pharmacology* ; Lipopolysaccharides ; Tumor Necrosis Factor-alpha/immunology* ; I-kappa B Kinase/genetics*

Objective:To explore the incidence of Crohn's disease-like pouch (CDP) after ileal pouch-anal anastomosis (IPAA) and analyze the clinical characteristics and risk factors in ulcerative colitis (UC) patients.Methods:A retrospective cohort study was conducted. One hundred and eighty-two UC patients undergoing IPAA at Jinling Hospital affiliated to Nanjing University from November 2003 to November 2024 were enrolled. Patients were categorized into CDP and non-CDP groups. Clinical features and prognosis were compared, and multivariate Cox regression was performed to identify risk factors for CDP.Results:A total of 182 UC patients were included, with a median follow-up time of 45.00 (30.00, 75.25) months. The patients were divided into two groups based on the diagnosis of CDP, with 23 patients (12.64%) in the CDP group and 159 patients (87.30%) in the non-CDP group. Compared to the non-CDP group, patients in the CDP group had a lower body mass index (BMI) ( Z=-2.87, P=0.004), and were more likely to develop early postoperative pouchitis (χ 2=4.50, P=0.034). The median time from ileostomy closure to the development of CDP was 12 .00 (6.00, 28.00) months. Cox regression analysis showed that a preoperative BMI<18.5 kg/m 2 ( HR=2.84, 95% CI: 1.24~6.49, P=0.013) and early postoperative pouchitis ( HR=3.11, 95% CI: 1.22~7.93, P=0.018) were associated with an increased risk of CDP. Conclusions:Preoperative low BMI and pouchitis occurring within 3 months postoperatively are significant risk factors for CDP. Close monitoring and early intervention are recommended for high-risk patients.

Objective:To evaluate the long-term protective efficacy of the recombinant Chinese hamster ovary cell-derived hepatitis B vaccine（CHO-HepB）26 years post-vaccination in the rural China.Methods:Zhengding county，Hebei province was designated as a rural monitoring site for CHO-HepB efficacy. Study participants included individuals born between 1997 and 1999 who had completed the three-dose CHO-HepB primary series without booster doses. A cross-sectional survey was conducted in late 2024 using random sampling. Demographic and vaccination history data were collected via questionnaires，and hepatitis B virus（HBV）serological markers were detected using chemiluminescence. Historical surveillance data were integrated to infer infection statuses of HBsAg-positive individuals and evaluate longitudinal trends in anti-HBs seropositivity and antibody titers.Results:Among 178 participants（mean time since vaccination：26.2 years），the seroprevalence rates were 0.6% for HBsAg（95% CI：0.0%-1.6%），64.6% for anti-HBs（95% CI：57.6%-71.6%），and 1.1% for anti-HBc（95% CI：0.0%-2.7%）. Compared to the pre-vaccination baseline HBsAg positivity of 11.3% in children under 10 years of age，the estimated vaccine protection rate was 95%. Two notable cases were identified：one with concurrent HBsAg and anti-HBc positivity and one with anti-HBs and anti-HBc positivity，suggestive of transient HBV exposure（1999—2009）without chronicity. Natural immune boosting was inferred for the latter case based on anti-HBs titer dynamics. Longitudinal analysis of four prior cross-sectional surveys（2005，2009，2013，and 2017）revealed no significant upward trends in HBsAg and anti-HBc positivity（both P>0.05）over 26 years，while anti-HBs seropositivity declined significantly（ P<0.05）from 6 to 26 years post-vaccination. Conclusion:The CHO-HepB vaccine demonstrates sustained immunological persistence and robust long-term protection up to 26 years post-immunization. Continued emphasis on rigorous implementation of mother-to-child transmission prevention strategies is critical for future hepatitis B control.

Objective To examine the changing prevalence and antimicrobial resistance profiles of Burkholderia cepacia in 52 hospitals across China from 2015 to 2021.Methods A total of 9 261 strains of B.cepacia were collected from 52 hospitals between January 1,2015 and December 31,2021.Antimicrobial susceptibility of the strains was tested using Kirby-Bauer method or automated antimicrobial susceptibility testing systems according to a unified protocol.The results were interpreted according to the breakpoints released in the Clinical & Laboratory Standards Institute(CLSI)guidelines(2023 edition).Results A total of 9 261 strains of B.cepacia were isolated from all age groups,especially elderly patients.The proportion was 11.1％(1 032 strains)in children,significantly lower than the proportion in adults.About half(46.5％,4 310/9 261)of the strains were isolated from patients at least 60 years old and 42.3％(3 919/9 261)of the strains were isolated from young adults.Most isolates(71.1％)were isolated from sputum and respiratory secretions,followed by urine(10.7％)and blood samples(8.1％).B.cepacia isolates were highly susceptible to the five antimicrobial agents recommended in the CLSI M100 document(33rd edition,2023).B.cepacia isolates showed relatively higher resistance rates to meropenem and levofloxacin.However,the resistance rates to ceftazidime,trimethoprim-sulfamethoxazole,and minocycline remained below 8.1％.The percentage of B.cepacia strains resistant to levofloxacin was the highest compared to other antibiotics in any of the three age groups(from 12.4％in the patients＜18 years old to 20.6％in the patients aged 60 years or older).Conclusions B.cepacia is one of the clinically important non-fermenting gram-negative bacteria.Accurate and timely reporting of antimicrobial susceptibility test results and ongoing antimicrobial resistance surveillance are helpful for rational prescription of antimicrobial agents and proper prevention and control of nosocomial infections.

OBJECTIVE: This study aimed to explore the association between body mass index (BMI) and mortality based on the 10-year population-based multicenter prospective study. METHODS: A general population-based multicenter prospective study was conducted at four sites in rural China between 2013 and 2023. Multivariate Cox proportional hazards models and restricted cubic spline analyses were used to assess the association between BMI and mortality. Stratified analyses were performed based on the individual characteristics of the participants. RESULTS: Overall, 19,107 participants with a sum of 163,095 person-years were included and 1,910 participants died. The underweight (< 18.5 kg/m ²) presented an increase in all-cause mortality (adjusted hazards ratio [ aHR] = 2.00, 95% confidence interval [ CI]: 1.66-2.41), while overweight (≥ 24.0 to < 28.0 kg/m ²) and obesity (≥ 28.0 kg/m ²) presented a decrease with an aHR of 0.61 (95% CI: 0.52-0.73) and 0.51 (95% CI: 0.37-0.70), respectively. Overweight ( aHR = 0.76, 95% CI: 0.67-0.86) and mild obesity ( aHR = 0.72, 95% CI: 0.59-0.87) had a positive impact on mortality in people older than 60 years. All-cause mortality decreased rapidly until reaching a BMI of 25.7 kg/m ² ( aHR = 0.95, 95% CI: 0.92-0.98) and increased slightly above that value, indicating a U-shaped association. The beneficial impact of being overweight on mortality was robust in most subgroups and sensitivity analyses. CONCLUSION This study provides additional evidence that overweight and mild obesity may be inversely related to the risk of death in individuals older than 60 years. Therefore, it is essential to consider age differences when formulating health and weight management strategies.
Humans ; Body Mass Index ; China/epidemiology* ; Male ; Female ; Middle Aged ; Prospective Studies ; Rural Population/statistics & numerical data* ; Aged ; Follow-Up Studies ; Adult ; Mortality ; Cause of Death ; Obesity/mortality* ; Overweight/mortality*

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVE: To evaluate the efficacy and safety of Shexiang Tongxin Dropping Pill (STDP) in treating stable angina patients with phlegm-heat and blood-stasis syndrome by exercise duration and metabolic equivalents. METHODS: This multicenter, randomized, double-blind, placebo-controlled clinical trial enrolled stable angina patients with phlegm-heat and blood-stasis syndrome from 22 hospitals. They were randomized 1:1 to STDP (35 mg/pill, 6 pills per day) or placebo for 56 days. The primary outcome was the exercise duration and metabolic equivalents (METs) assessed by the standard Bruce exercise treadmill test after 56 days of treatment. The secondary outcomes included the total angina symptom score, Chinese medicine (CM) symptom scores, Seattle Angina Questionnaire (SAQ) scores, changes in ST-T on electrocardiogram and adverse events (AEs). RESULTS: This trial enrolled 309 patients, including 155 and 154 in the STDP and placebo groups, respectively. STDP significantly prolonged exercise duration with an increase of 51.0 s, compared to a decrease of 12.0 s with placebo (change rate: -11.1% vs. 3.2%, P<0.01). The increase in METs was significantly greater in the STDP group than in the placebo group (change: -0.4 vs. 0.0, change rate: -5.0% vs. 0.0%, P<0.01). The improvement of total angina symptom scores (25.0% vs. 0.0%), CM symptom scores (38.7% vs. 11.8%), reduction of nitroglycerin consumption (100.0% vs. 11.3%), and all domains of SAQ, were significantly greater with STDP than placebo (all P<0.01). The changes in Q-T intervals at 28 and 56 days from baseline were similar between the two groups (both P>0.05). Twenty-five participants (16.3%) with STDP and 16 (10.5%) with placebo experienced AEs (P=0.131), with no serious AEs observed. CONCLUSION STDP could improve exercise tolerance in patients with stable angina and phlegm-heat and blood stasis syndrome, with a favorable safety profile. (Registration No. ChiCTR-IPR-15006020).
Humans ; Double-Blind Method ; Drugs, Chinese Herbal/adverse effects* ; Male ; Female ; Middle Aged ; Angina, Stable/physiopathology* ; Aged ; Syndrome ; Treatment Outcome ; Placebos ; Tablets