This study aimed to explore the effects and mechanisms of total extracts from Anthriscus sylvestris on pulmonary hypertension in rats. Sixty male SD rats were divided into normal(NC) group, model(M) group, positive drug sildenafil(Y) group, low-dose A. sylvestris(ES-L) group, medium-dose A. sylvestris(ES-M) group, and high-dose A. sylvestris(ES-H) group. On day 1, rats were intraperitoneally injected with monocrotaline(60 mg·kg~(-1)) to induce pulmonary hypertension, and the rat model was established on day 28. From days 15 to 28, intragastric administration of the respective treatments was performed. After modeling and treatment, small animal echocardiography was used to detect the right heart function of the rats. Arterial blood gas was measured using a blood gas analyzer. Hematoxylin and eosin(HE) staining and Masson staining were performed to observe cardiopulmonary pathological damage. Flow cytometry was used to detect apoptosis in the lung and myocardial tissues and reactive oxygen species(ROS) levels. Western blot was applied to detect the expression levels of transforming growth factor-β1(TGF-β1), phosphorylated mothers against decapentaplegic homolog 3(p-Smad3), Smad3, tissue plasminogen activator(t-PA), and plasminogen activator inhibitor-1(PAI-1) in lung tissue. A blood routine analyzer was used to measure inflammatory immune cell levels in the blood. Enzyme-linked immunosorbent assay(ELISA) was used to detect the expression levels of P-selectin and thromboxane A2(TXA2) in plasma. The results showed that, compared with the NC group, right heart hypertrophy index, right ventricular free wall thickness, right heart internal diameter, partial carbon dioxide pressure(PaCO_2), apoptosis in cardiopulmonary tissue, and ROS levels were significantly increased in the M group. In contrast, the ratio of pulmonary blood flow acceleration time(PAT)/ejection time(PET), right cardiac output, change rate of right ventricular systolic area, systolic displacement of the tricuspid ring, oxygen partial pressure(PaO_2), and blood oxygen saturation(SaO_2) were significantly decreased in the M group. After administration of the total extract of A. sylvestris, right heart function and blood gas levels were significantly improved, while apoptosis in cardiopulmonary tissue and ROS levels significantly decreased. Further testing revealed that the total extract of A. sylvestris significantly decreased the levels of interleukin-1β(IL-1β), interleukin-6(IL-6), and PAI-1 proteins in lung tissue, while increasing the expression of t-PA. Additionally, the extract reduced the levels of inflammatory cells such as leukocytes, lymphocytes, granulocytes, and monocytes in the blood, as well as the levels of P-selectin and TXA2 in plasma. Metabolomics results showed that the total extract of A. sylvestris significantly affected metabolic pathways, including arginine biosynthesis, tyrosine metabolism, and taurine and hypotaurine metabolism. In conclusion, the total extract of A. sylvestris may exert an anti-pulmonary hypertension effect by inhibiting the TGF-β1/Smad3 signaling pathway, thereby alleviating immune-inflammatory responses and thrombosis.
Animals ; Male ; Smad3 Protein/metabolism* ; Transforming Growth Factor beta1/metabolism* ; Rats, Sprague-Dawley ; Rats ; Signal Transduction/drug effects* ; Hypertension, Pulmonary/genetics* ; Thrombosis/immunology* ; Drugs, Chinese Herbal/administration & dosage* ; Humans ; Apoptosis/drug effects*

This study aims to explore the mechanism of lung and gut protection by Tanreqing Capsules on the mice infected with influenza virus based on "the lung-gut axis". A total of 110 C57BL/6J mice were randomized into control group, model group, oseltamivir group, and low-and high-dose Tanreqing Capsules groups. Ten mice in each group underwent body weight protection experiments, and the remaining 12 mice underwent experiments for mechanism exploration. Mice were infected with influenza virus A/Puerto Rico/08/1934(PR8) via nasal inhalation for the modeling. The lung tissue was collected on day 3 after gavage, and the lung tissue, colon tissue, and feces were collected on day 7 after gavage for subsequent testing. The results showed that Tanreqing Capsules alleviated the body weight reduction and increased the survival rate caused by PR8 infection. Compared with model group, Tanreqing Capsules can alleviate the lung injury by reducing the lung index, alleviating inflammation and edema in the lung tissue, down-regulating viral gene expression at the late stage of infection, reducing the percentage of neutrophils, and increasing the percentage of T cells. Tanreqing Capsules relieved the gut injury by restoring the colon length, increasing intestinal lumen mucin secretion, alleviating intestinal inflammation, and reducing goblet cell destruction. The gut microbiota analysis showed that Tanreqing Capsules increased species diversity compared with model group. At the phylum level, Tanreqing Capsules significantly increased the abundance of Firmicutes and Actinobacteria, while reducing the abundance of Bacteroidota and Proteobacteria to maintain gut microbiota balance. At the genus level, Tanreqing Capsules significantly increased the abundance of unclassified＿f＿Lachnospiraceae while reducing the abundance of Bacteroides, Eubacterium, and Phocaeicola to maintain gut microbiota balance. In conclusion, Tanreqing Capsules can alleviate mouse lung and gut injury caused by influenza virus infection and restore the balance of gut microbiota. Treating influenza from the lung and gut can provide new ideas for clinical practice.
Animals ; Drugs, Chinese Herbal/administration & dosage* ; Mice ; Lung/metabolism* ; Mice, Inbred C57BL ; Capsules ; Orthomyxoviridae Infections/virology* ; Gastrointestinal Microbiome/drug effects* ; Male ; Humans ; Female ; Influenza A virus/physiology* ; Influenza, Human/virology*

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVE: To evaluate the efficacy and safety of Shexiang Tongxin Dropping Pill (STDP) in treating stable angina patients with phlegm-heat and blood-stasis syndrome by exercise duration and metabolic equivalents. METHODS: This multicenter, randomized, double-blind, placebo-controlled clinical trial enrolled stable angina patients with phlegm-heat and blood-stasis syndrome from 22 hospitals. They were randomized 1:1 to STDP (35 mg/pill, 6 pills per day) or placebo for 56 days. The primary outcome was the exercise duration and metabolic equivalents (METs) assessed by the standard Bruce exercise treadmill test after 56 days of treatment. The secondary outcomes included the total angina symptom score, Chinese medicine (CM) symptom scores, Seattle Angina Questionnaire (SAQ) scores, changes in ST-T on electrocardiogram and adverse events (AEs). RESULTS: This trial enrolled 309 patients, including 155 and 154 in the STDP and placebo groups, respectively. STDP significantly prolonged exercise duration with an increase of 51.0 s, compared to a decrease of 12.0 s with placebo (change rate: -11.1% vs. 3.2%, P<0.01). The increase in METs was significantly greater in the STDP group than in the placebo group (change: -0.4 vs. 0.0, change rate: -5.0% vs. 0.0%, P<0.01). The improvement of total angina symptom scores (25.0% vs. 0.0%), CM symptom scores (38.7% vs. 11.8%), reduction of nitroglycerin consumption (100.0% vs. 11.3%), and all domains of SAQ, were significantly greater with STDP than placebo (all P<0.01). The changes in Q-T intervals at 28 and 56 days from baseline were similar between the two groups (both P>0.05). Twenty-five participants (16.3%) with STDP and 16 (10.5%) with placebo experienced AEs (P=0.131), with no serious AEs observed. CONCLUSION STDP could improve exercise tolerance in patients with stable angina and phlegm-heat and blood stasis syndrome, with a favorable safety profile. (Registration No. ChiCTR-IPR-15006020).
Humans ; Double-Blind Method ; Drugs, Chinese Herbal/adverse effects* ; Male ; Female ; Middle Aged ; Angina, Stable/physiopathology* ; Aged ; Syndrome ; Treatment Outcome ; Placebos ; Tablets

OBJECTIVES: To analyze the differential expression and biological functions of circRNAs in the anterior lens capsules of high myopic patients with cataract and their pathogenic roles in the development of this condition. METHODS: Anterior lens capsule specimens were collected intraoperatively from 36 patients with age-related cataract (ARC) and 36 high myopic patients with cataract. Among these, 18 specimens from each group were selected for whole transcriptome sequencing and biological analysis, and the remaining 36 specimens were used for validation of circPDGFRA, circFOXJ3, hsa_circ_0004767, hsa_circ_0007528, ciCRIM1, circMAN1A2, circSLC5A3, and circPTK2 expressions using RT-qPCR. hsa_circ_0007528 was selected for cell experiments to examine its effects on proliferation, migration, and apoptosis of lens epithelial cells (LECs). RESULTS: A total of 16 192 circRNAs were detected in the specimens from both groups, among which 62 circRNAs were differentially expressed (29 upregulated and 33 downregulated). GO and KEGG analyses revealed that the differentially expressed circRNAs were primarily localized in the cytoplasm, nucleoplasm, and endoplasmic reticulum, and were involved in signaling pathways associated with Gap junction and the PI3K-Akt, NF-κB, Jak-STAT, HIF-1, and MAPK signaling pathways. The ceRNA network predicted multiple target genes. RT-qPCR validation results were consistent with the sequencing data. In the LECs, upregulation of hsa_circ_0007528 significantly inhibited cell proliferation and migration and obviously promoted cell apoptosis. CONCLUSIONS The expression profile of circRNAs in the anterior lens capsule of high myopic patients with cataract differs from that of ARC patients. Upregulation of hsa_circ_0007528 inhibits LEC proliferation and migration and promotes cell apoptosis.
Humans ; Cataract/complications* ; RNA, Circular ; Myopia/genetics* ; Apoptosis ; Cell Proliferation ; Epithelial Cells ; Cell Movement ; Anterior Capsule of the Lens/metabolism* ; Male ; Female

Image 1.

OBJECTIVE: Resveratrol (Res) is a promising anticancer drug against hepatocellular carcinoma (HCC), but whether its anti-HCC effects implicate mitophagy remains unclear. Therefore, we aimed to explore the specific role of Res in mitophagy and the related mechanisms during the treatment of HCC. METHODS: HepG2 cells and tumor-grafted nude mice were used to investigate the effects of low-, middle- and high-dose of Res on HCC progression and mitophagy in vitro and in vivo, respectively. A series of approaches including cell counting kit-8, flow cytometry, wound healing and transwell assays were used to evaluate tumor cell functions. Transmission electron microscopy, immunofluorescence and Western blotting were used to assess mitophagy. Mitochondrial oxygen consumption rate, reactive oxygen species and membrane potential were used to reflect mitochondrial function. After disrupting the expression of metastasis-associated lung adenocarcinoma transcript 1 (MALAT1), miR-143-3p, and ribonucleoside reductase M2 (RRM2), the effects of the MALAT1/miR-143-3p/RRM2 axis on cell function and mitophagy under Res treatment were explored in vitro. Additionally, dual-luciferase reporter and chromatin immunoprecipitation were used to confirm interactions between target genes. RESULTS: Res significantly inhibited the proliferation and promoted apoptosis of HCC cells in vitro, while significantly suppressing tumor growth in a dose-dependent manner and inducing mitophagy and mitochondrial dysfunction in vivo. Interestingly, MALAT1 was highly expressed in HCC cells and its knockdown upregulated miR-143-3p expression in HCC cells, which subsequently inhibited RRM2 expression. Furthermore, in nude mice grafted with HCC tumors and treated with Res, the expression of MALAT1, miR-143-3p and RRM2 were altered significantly. In vitro data further supported the targeted binding relationships between MALAT1 and miR-143-3p and between miR-143-3p and RRM2. Therefore, a series of cell-based experiments were carried out to study the mechanism of the MALAT1/miR-143-3p/RRM2 axis involved in mitophagy and HCC; these experiments revealed that MALAT1 knockdown, miR-143-3p mimic and RRM silencing potentiated the antitumor effects of Res and its activation of mitophagy. CONCLUSION Res facilitated mitophagy in HCC and exerted anti-cancer effects by targeting the MALAT1/miR-143-3p/RRM2 axis. Please cite this article as: Feng CY, Cai CS, Shi XQ, Zhang ZJ, Su D, Qiu YQ. Resveratrol promotes mitophagy via the MALAT1/miR-143-3p/RRM2 axis and suppresses cancer progression in hepatocellular carcinoma. J Integr Med. 2025; 23(1): 79-91.
Humans ; MicroRNAs/genetics* ; Liver Neoplasms/metabolism* ; Carcinoma, Hepatocellular/metabolism* ; Mitophagy/drug effects* ; Resveratrol/pharmacology* ; Animals ; Mice, Nude ; RNA, Long Noncoding/genetics* ; Hep G2 Cells ; Mice ; Disease Progression ; Mice, Inbred BALB C

In continuation of research aimed at identifying anti-inflammatory agents from natural sesquiterpenoids, an activity-guided fractionation approach utilizing lipopolysaccharide (LPS)-mediated RAW264.7 cells was employed to investigate chemical constituents from Inula Britannica (I. britannica). Seven novel sesquiterpenoid dimers inulabritanoids A-G (1-7) and two novel sesquiterpenoid monomers inulabritanoids H (8) and I (9) were isolated from I. britannica together with eighteen known compounds (10-27). The structural elucidation was accomplished through comprehensive analysis of 1D and 2D nuclear magnetic resonance (NMR), high-resolution mass spectrometry (HR-MS), and electronic circular dichroism (ECD) spectra, complemented by quantum chemical calculations. Compounds 1, 2, 12, 16, 19, and 26 demonstrated inhibitory effects on NO production, with IC₅₀ values of 3.65, 5.48, 3.29, 6.91, 3.12, and 5.67 μmol·L^-1, respectively. Mechanistic studies revealed that compound 1 inhibited IκB kinase β (IKKβ) phosphorylation, thereby blocking nuclear factor κB (NF-κB) nuclear translocation, and activated the kelch-like ECH-associated protein 1 (Keap1)/nuclear factor erythroid 2-related factor 2 (Nrf2) signal pathway, leading to decreased expression of NADPH oxidase 2 (NOX-2), inducible nitric oxide synthase (iNOS), tumor necrosis factor α (TNF-α), interleukin-6 (IL-6), monocyte chemotactic protein-1 (MCP-1), IL-1β, and IL-1α and increased expression of NAD(P)H: quinone oxidoreductase 1 (NQO-1) and heme oxygenase-1 (HO-1), thus exhibiting anti-inflammatory effects in vitro. These results indicate that dimeric sesquiterpenoids may serve as promising candidates for anti-inflammatory drug development.
Mice ; Animals ; Sesquiterpenes/isolation & purification* ; Anti-Inflammatory Agents/isolation & purification* ; Inula/chemistry* ; RAW 264.7 Cells ; Nitric Oxide ; Molecular Structure ; NF-kappa B/immunology* ; NF-E2-Related Factor 2/immunology* ; Macrophages/immunology* ; Nitric Oxide Synthase Type II/immunology* ; Plant Extracts/pharmacology* ; Lipopolysaccharides ; Tumor Necrosis Factor-alpha/immunology* ; I-kappa B Kinase/genetics*

OBJECTIVE: This study aimed to explore the association between body mass index (BMI) and mortality based on the 10-year population-based multicenter prospective study. METHODS: A general population-based multicenter prospective study was conducted at four sites in rural China between 2013 and 2023. Multivariate Cox proportional hazards models and restricted cubic spline analyses were used to assess the association between BMI and mortality. Stratified analyses were performed based on the individual characteristics of the participants. RESULTS: Overall, 19,107 participants with a sum of 163,095 person-years were included and 1,910 participants died. The underweight (< 18.5 kg/m ²) presented an increase in all-cause mortality (adjusted hazards ratio [ aHR] = 2.00, 95% confidence interval [ CI]: 1.66-2.41), while overweight (≥ 24.0 to < 28.0 kg/m ²) and obesity (≥ 28.0 kg/m ²) presented a decrease with an aHR of 0.61 (95% CI: 0.52-0.73) and 0.51 (95% CI: 0.37-0.70), respectively. Overweight ( aHR = 0.76, 95% CI: 0.67-0.86) and mild obesity ( aHR = 0.72, 95% CI: 0.59-0.87) had a positive impact on mortality in people older than 60 years. All-cause mortality decreased rapidly until reaching a BMI of 25.7 kg/m ² ( aHR = 0.95, 95% CI: 0.92-0.98) and increased slightly above that value, indicating a U-shaped association. The beneficial impact of being overweight on mortality was robust in most subgroups and sensitivity analyses. CONCLUSION This study provides additional evidence that overweight and mild obesity may be inversely related to the risk of death in individuals older than 60 years. Therefore, it is essential to consider age differences when formulating health and weight management strategies.
Humans ; Body Mass Index ; China/epidemiology* ; Male ; Female ; Middle Aged ; Prospective Studies ; Rural Population/statistics & numerical data* ; Aged ; Follow-Up Studies ; Adult ; Mortality ; Cause of Death ; Obesity/mortality* ; Overweight/mortality*

Objective To explore the changes of metabonomics in blood of mice after high-voltage electric shock,then screen out the significantly changed differential metabolites and metabolic pathways.Methods The head of C57BL/6J mice was subjected to high-voltage electric shock(electric shock group)or exposed to acoustic and optical stimulation of high-voltage electric(control group),then the whole blood from mice were collected to separate serum.The dual platform combined metabonomic analysis based on gas chromatography-mass spectrometer(GC-MS)and liquid chromatography-mass spectrometer(LC-MS)was performed and orthogonal partial least squares discriminant analysis(OPLS-DA)was used to screen the differential metabolites and related metabolic pathways.Results A total of 415 differential metabolites were screened out in metabonomics in blood of mice after high-voltage electric shock,including 187 up-regulated and 228 down-regulated metabolites.These differentially metabolites were significantly enriched in metabolic pathways including central carbon metabolism in cancer,glucagon signaling pathway,etc.Conclusion By establishing the model of high-voltage electrical injury on experimental mice,this study reveals the significant change of metabolite content and metabolic pathway in blood by high-voltage electrical injury.Which provides a basis for the damage of blood metabolic activity by high-voltage electrical injury,and suggests the potential harm of high-voltage electrical injury to blood metabolic activity in the whole body.