After continuous development and improvement, lung transplantation has become the preferred means to treat a variety of benign end-stage lung diseases. However, the field of lung transplantation still faces many challenges, including shortage of donor resources, preservation and maintenance of donor lungs, and postoperative complications. Lung tissue samples removed after lung transplantation are excellent clinical resources for the study of benign end-stage lung disease and perioperative complications of lung transplantation. However, at present, the collection, storage and utilization of tissue samples after lung transplantation are limited to a single study, and unified technical specifications have not been formed. Based on the construction plan of the biobank for lung transplantation in the First Affiliated Hospital of Xi'an Jiaotong University, this study reviewed the practical experience in the collection, storage and utilization of lung transplant tissue samples in the aspects of ethical review, staffing, collection process, storage method, quality control and efficient utilization, in order to provide references for lung transplant related research.

Constipation,a common functional gastrointestinal disorder,not only severely impairs patients'quality of life but is also highly comorbid with psychiatric conditions such as anxiety and depression.Emerging evidence indicates that gut microbiota dysbiosis is a critical link connecting these two disease states.On one hand,dysbiosis exacerbates constipation by affecting host metabolism and intestinal function;on the other,it plays a central role in the pathophysiology of mood disorders.This complex interaction is primarily mediated through the"microbiota-gut-brain axis."Therefore,elucidating the intrinsic relationship among anxiety,depression,gut microbiota,and constipation has become a frontier of interdisciplinary research.

This study aims to investigate the effects of Pulsatilla decoction(PD)on the 5-HT sig-naling system in the hippocampus of damp-heat diarrhoea(DHD)rats.Twenty-four male SD rats were randomly divided into four groups including the blank group,the model group,the PD group and the self-healing group.Except for the blank group,the rats in each group were induced by"high sugar and high fat,high temperature and high humidity,and E.coli poisoning"to establish a of rat model DHD,and were treated by gavage with PD.Changes in body weight,temperature,food intake and water intake,routine blood tests and histopathological changes in the colon were recor-ded to comprehensively determine the modelling condition of rats with DHD;histopathological changes in the hippocampus of rats were observed,and real-time fluorescence PCR was used to de-termine the expression of IL-1β3,IL-6,TNF-α,IFN-γ and TPH1 mRNA in the hippocampus;West-ern blot and immunohistochemistry were used to detect the protein expression of tryptophan hydroxylase 1(TPH1),receptors(5-HT3R,5-HT4R,5-HT7R)in 5-HT signaling pathway in the hippocampus.The results showed that:PD significantly regulated the abnormal changes of body weight,food and water intake and blood routine indexes in rats with DHD,and significantly im-proved the pathological damage of colonic tissues;PD significantly lowered the expression of in-flammatory cytokines IL-1β,IL-6,IFN-γ,and TNF-α in hippocampus of rats with DHD(P＜0.05),and significantly reduced the expression of TPH1 mRNA in hippocampus of rats with DHD(P＜0.05).PD could increased the expression of 5-HT4R and 5-HT7R in the hippocampus of rats with DHD;reduced the expression of 5-HT3R and TPH in the hippocampus,among which 5-HT3R expression was significantly reduced.This study suggests that PD can affect the function of hippocampus in rats with DHD by regulating the 5-HT signaling pathway.

This study aims to investigate the effects of Pulsatilla powder(PP)on colonic intestinal flora and tryptophan metabolism in piglets with diarrhea.Twenty-four weaned piglets were ran-domly divided into the normal control group,model group,self-healing group,and PP group.The model of piglet diarrhea was established by the compound factor of external evil+internal injury+epi-demic virus,and treated with PP.During the modeling period,the body weight,mental status and fecal patterns of piglets were monitored daily.After the experiment,the colon tissues were collect-ed for histopathological observation,and the inflammatory factors IL-1β and IL-6 in the colon tis-sue was detected by ELISA,16S rRNA was used to analyze colonic intestinal flora and RT-qPCR was used to determine the expression of genes related to tryptophan metabolism in the colon.The results showed that,compared with the model group,PP significantly improved the pathological status of the colon in piglets with diarrhea,with elevated body mass and a significant increase in goblet cells(P＜0.05);and significantly reduced the levels of IL-1β and IL-6 in the colon of diar-rhea piglets(P＜0.05).The results of intestinal flora showed that PP increased the abundance of Firmicutes(P＜0.01),Spirochaeota(P＜0.01)and Lactobacillus(P＜0.05),reduced the abun-dance of Bacteroidota(P＜0.05)、Prevotella_NK3B31_group(P＜0.05)and Clostridium_sensu_stricto 1(P＜0.01).Meanwhile,PP significantly reduced the expression level of TPH1 mRNA(P＜0.05),increased the expression levels of AhR(P＜0.05)and IL-22 mRNA in the co-lon of diarrhea piglets.These results indicates that PP may alleviate diarrhea in piglets by regula-ting colonic intestinal flora and genes related to intestinal tryptophan metabolism.This study pro-vides data support for the subsequent investigation of piglet diarrhea prevention and treatment.

AIM To investigate the clinical effects of Cinobufosin Injection combined with RALOX-HAIC regimen on patients with hepatocellular carcinoma.METHODS Ninety-two patients were randomly assigned into control group(46 cases)for intervention of RALOX-HAIC regimen,and observation group(46 cases)for intervention of both Cinobufosin Injection and RALOX-HAIC regimen.The changes in short-term effects,survival situation,inflammatory indices(LCN2,NLRP3 inflammasome,NLR,PLR),immune indices(NK cells,CD8+T cells,IL-17,Th17/Treg)and incidence of toxic and side effects were detected.RESULTS Based on mRECIST,the observation group demonstrated higher disease control rate and objective remission rate than the control group(P＜0.05),along with lower disease progression(P＜0.05).After the treatment,the two groups displayed decreased inflammatory indices,IL-17,Th17/Treg(P＜0.05),and increased NK cells,CD8+T cells(P＜0.05),especially for the observation group(P＜0.05).The observation group exhibited lower incidence of abdominal pain,nausea,vomiting,diarrhea,leukopenia and thrombocytopenia than the control group(P＜0.05),and no significant differences in overall survival and incidence of other toxic and side effects were found between the two groups(P＞0.05).CONCLUSION For the patients with hepatocellular carcinoma,Cinobufosin Injection combined with RALOX-HAIC regimen can safely and effectively enhance body immune functions,and reduce in vivo immune indices.

Parkinson's disease(PD)is the second most prevalent neurodegenerative disease and a major cause of movement disorders.Neuroinflammation plays an important role in the pathogenesis of PD.Icilin is a small molecule compound that has been reported to inhibit inflammation.Howev-er,its role in PD has not been reported.This study explored the effects of icilin on motor behavior,nerve damage,microglia activation,and neuroinflammation in MPTP-induced PD Meriones unguic-ulatus by behavioral experiments,immunohistochemistry,Western blot,and fluorescence quantifi-cation.The results showed that Icilin not only ameliorated motor dysfunction and neurological damage in MPTP-induced Meriones unguiculatus,but also inhibited microglia hyperactivation and its mediated neuroinflammation.The present study provides an evidence that icilin attenuates MPTP-induced neurodegenerative lesions in long-pawed gerbils,suggesting that it is a promising candidate for PD.

Constipation,a common functional gastrointestinal disorder,not only severely impairs patients'quality of life but is also highly comorbid with psychiatric conditions such as anxiety and depression.Emerging evidence indicates that gut microbiota dysbiosis is a critical link connecting these two disease states.On one hand,dysbiosis exacerbates constipation by affecting host metabolism and intestinal function;on the other,it plays a central role in the pathophysiology of mood disorders.This complex interaction is primarily mediated through the"microbiota-gut-brain axis."Therefore,elucidating the intrinsic relationship among anxiety,depression,gut microbiota,and constipation has become a frontier of interdisciplinary research.

The morphological changes and functions of mitochondria are closely associated with the development and progression of non-alcoholic fatty liver disease （NAFLD）. Dynamin-related protein 1 （Drp1） is one of the primary proteins determining mitochondrial fission， and its activity is strictly controlled to ensure the balance of mitochondrial dynamics according to cellular needs. Drp1 can enhance mitochondrial interactions and mitochondrial fission by promoting the formation of endoplasmic reticulum tubules， and the phosphorylation state and deacetylation of Drp1 can also affect the morphological changes of mitochondria， thereby affecting the status of NAFLD. This article elaborates on the role and mechanism of action of Drp1 in the progression of NAFLD， in order to provide ideas for targeted therapy for NAFLD.

Objective:To investigate the clinical features and etiologies of hospitalized patients with spike-and-wave activation in sleep(SWAS).Methods:Case-series study.The clinical features and etiologies of patients diagnosed with SWAS in the Department of Neurology, Capital Center for Children′s Health, Capital Medical University from September 2016 to March 2023 were retrospectively analyzed.The measurement data were analyzed by normality testing, and those conforming to the normal distribution were characterized by Mean± SD deviation.After the homogeneity test of variance, either the independent sample t test or the completely random analysis of variance (ANOVA) was employed for data comparison between groups.If the results of ANOVA were statistically significant, the LSD test was utilized for pairwise comparison. Results:(1)Basic data: a total of 140 patients with SWAS were included, with the onset age of (7.4±2.1) years.There were 134 cases (134/140, 95.7%) complicated by epilepsy, and the age of epilepsy onset was (5.3±2.2) years.Seventy-four cases (74/137, 54.0%) had self-limited epilepsy and centrotemporal spikes.Twenty-one cases (21/137, 15.3%) had epileptic encephalopathy and SWAS.Eight cases (8/137, 5.8%) had developmental and epileptic encephalopathy and SWAS.Pulse Methylprednisolone therapy, Clonazepam or Clobazam, callosotomy, and left temporo-parietal-occipital craniotomy for epileptogenic lesion resection were effective in 20 cases (20/32, 62.5%), 3 cases (3/13, 23.1%), 1 case (1/2, 50.0%) and 1 case, respectively.One patient achieved development improvement and a decrease in discharge index after vagus nerve stimulation.(2) Etiologies: ①Genetic etiology: 6 patients carried pathogenic or suspected pathogenic mutations, including GRIN2A (c.87_106dupGGGTCCCCCCGCGCTAAATA/p.I36Rfs*6), GRIN2A (c.2069C>T/p.T690M), CREBBP (c.4844A>G/p.N1615S), KAT6A(c.2203C>T/p.R735X), GRIN1 (c.2326_2327insACCTCT-GGAAGCAGAACGTCTCCCTGTCCA/p.S775_I776insNLWKQNVSLS) and MECP2 (c.916C>T/p.R306C).Among them, there were no reports on the association of CREBBP and KAT6A with SWAS.②Structural etiology: there were 7 cases with perinatal brain injury and 1 case with bilateral temporo-parietal gyrus.③Metabolic etiology: 1 patient with cerebrotendinous xanthomatosis carried the pathogenic gene CYP27A1 (c.379C>T/p.R127W, c.1415G>C/p.G472A), which was not related to SWAS.④Infectious etiology: 1 case had congenital cytomegalovirus infection.⑤ Immune etiology: 1 case had autoimmune encephalitis.⑥ There were 123 cases with unknown etiologies.(3) Etiologies and clinical characteristics: SWAS occurred earlier in patients with structural etiology than that in patients with unknown etiologies ( F=4.478, P<0.05).The proportions of discharge index ≥85% ( χ2=10.079, P<0.05) and encephalopathy ( χ2=9.385, P<0.05) were higher in patients with genetic etiology than those in patients with unknown etiologies.(4) Discharge index: the patients were divided into a group with a discharge index ≥85% and a group with a discharge index < 85%.Compared with the latter group, the former group had a higher proportion of developmental retardation ( χ2=15.976, P<0.001), suffered epilepsy ( t=-3.498, P<0.05) and SWAS at a younger age ( t=-2.044, P<0.05), and used more types of antiepileptic drugs ( t=2.079, P<0.05).(5) Neurodevelopmental outcomes: 21 patients had neurodevelopmental disorders and 75 had normal neurodevelopment. Conclusions:There are various etiologies for encephalopathy or epilepsy complicated by SWAS.The patients with structural etiology may develop SWAS at a younger age, whereas those with a clearly identified pathogenic gene may exhibit a higher discharge index and a higher rate of encephalopathy.When patients present with encephalopathy or refractory epilepsy, surgical treatment should be considered if structural lesions are found.The proportion of developing encephalopathy in patients with a discharge index ≥85% is the same as that in patients with a discharge index <85%.However, the patients with a higher discharge index develop epilepsy and SWAS at a younger age, and are more difficult to treat.

Objective:In order to clarify the ABO phenotype and genotype,and explore the molecular biological mechanism,serological detection,genotyping and gene sequencing were performed on an upper gastrointestinal hemorrhage patient with inconsistent forward and reverse ABO blood typing.Methods:ABO forward and reverse blood typing,H antigen identification,capillary centrifugation test and salivary substance detection were performed by classical serological method,moreover,polymerase chain reaction-sequence specific primer(PCR-SSP)was used for ABO genotyping,ABO gene 1-7 exons were sequenced by Sanger analysis in order to identify mutation.Results:Mixed field agglutination with anti-A,anti-AB and no agglutination with anti-A1 were appeared in the forward typing tests,agglutination with B cells but no agglutination with A1 cells and O cells were appeared in the reverse typing tests.3+agglutination strength was showed with anti-H.In capillary centrifugation experiment,erythrocyte after isolation in proximal part and distal end had same strength of agglutination with anti-A.Substances A and H were detected in saliva.The patient was assigned an A3 phenotype according to serological characteristics.Sequencing results of ABO gene 1-7 exons showed c.261delG,c.467C＞T,c.865A＞G,in which,865A＞G was the first discovered mutation,and this new mutation had been submitted to GenBank with accession number PP187306.Conclusion:A novel site mutation c.865A＞G is reported in this study,and this new mutation can result in a replacement of Met with Val at residue 289(p.Met289Val)and lead to an A3 phenotype.