Purpose: To investigate the therapeutic potential of eliminating insulin-like growth factor-binding protein 5 (IGFBP5) expression in improving erectile function in mice with cavernous nerve injury (CNI)-induced erectile dysfunction (ED). Materials and Methods: Eight-week-old male C57BL/6 mice were divided into four groups: a sham-operated group and three CNI-induced ED groups. The CNI-induced ED groups were treated with intracavernous injections 3 days before the CNI procedure.These injections included phosphate-buffered saline, scrambled control short hairpin RNA (shRNA), or shRNA targeting mouse IGFBP5 lentiviral particles. One week after CNI, erectile function was evaluated and the penile tissue was then harvested for histological examination and western blot analysis. Additionally, the major pelvic ganglia (MPG) and dorsal root ganglia (DRG) were cultured for ex vivo neurite outgrowth assays. Results: Following CNI, IGFBP5 expression in the cavernous tissues significantly increased, reaching its peak at day 7. First, ablation of IGFBP5 expression promotes neurite sprouting in MPG and DRG when exposed to lipopolysaccharide. Second, ablating IGFBP5 expression in CNI-induced ED mice improved erectile function, likely owing to increased neurovascular contents, including endothelial cells, pericytes, and neuronal processes. Third, ablating IGFBP5 expression in CNI-induced ED mice promoted neurovascular regeneration by increasing cell proliferation, reducing apoptosis, and decreasing Reactive oxygen species production. Finally, western blot analysis demonstrated that IGFBP5 ablation attenuated the JNK/c-Jun signaling pathway, activated the PI3K/AKT signaling pathway, and increased vascular endothelial growth factor and neurotrophic factor expression. Conclusions Ablating IGFBP5 expression enhanced neurovascular regeneration and ultimately improved erectile function in CNI-induced ED mice.

Using Real-time PCR technology, a highly specific and sensitive method for detecting DNA residues of Escherichia coli host cells in levodopa was established, validated, and preliminarily applied. Escherichia coli strain MB6 16S ribosomal RNA gene was selected as the target gene to design multiple pairs of primers and the target fragment by specific amplification of PCR was obtained. The target fragment was cloned into the pLENTI-BSD-CON vector and the recombinant plasmid was constructed and named pLENTI-BSD-CON-E.coli-16S. A quantitative PCR detection method (SYBR Green method) with magnetic bead extraction and purification methods was established with the reference standard of the recombinant plasmid. Furthermore, the established method was validated, including linear and range, accuracy, precision, specificity, and quantification limit, and applied to the detection of levodopa raw materials. Meanwhile, the detection method was compared with the Taqman probe method by the commercial kit. The primer sequences of the quantitative PCR detection method (SYBR Green method) were TTCGATGCAACGCGAAGAAC (forward) and GTGTAGCCCTGGTCGTAAGG (reverse). The standard curve of DNA was in the range of 10 fg/μL to 3 ng/μL with good linearity (R2≥ 0.98). The quantitative limit was 10 fg/μL. In addition, the detection recovery rate was in the range of 59.7% to 80.7%, with RSD at less than 15%. Nine batches of levodopa were detected by this method, and the amount of E.coli DNA residue was below the limit. The developed qPCR method can be used for quantitative detection of residual DNA in biological products produced by E.coli as host cells, such as levodopa . The results indicate that the sensitivity of the detection method for recombinant plasmid construction standards is superior than the reagent kit detection method.

Objective: To explore the association between the Internet usage characteristics and suicidal ideation among vocational high school students, so as to provide a theoretical basis for precise intervention of suicide among vocational high school students. Methods: A total of 1 781 students were recruited from three vocational high schools in Wuhan and Xianning in March 2023 by using the cluster random sampling method. The Columbia-Suicide Severity Rating Scale and Revised Chen Internet Addiction Scale were used to measure suicidal ideation and Internet addiction, respectively. LASSO regression model was used to select influential factors related to suicidal ideation, and the gradient boosting decision tree algorithm XGBoost was used to develop prediction models and evaluate predictive performance. By calculating the SHAP values, the contribution of each influential factor was quantified. Results: The prevalence of suicidal ideation among vocational high school students was 42.22% and prevalence of Internet addiction was 26.39%. LASSO regression results indicated that age, gender, experience of being left behind, parental relationship, holding a class cadre position, using the Internet for learning, Internet use during dawn, morning and late night, Internet addiction, and depressive symptoms were all the influential factors of suicidal ideation among vocational high school students ( β= -0.05 , 0.29, 0.09, 0.27, 0.10, -0.01, 0.09, 0.05, 0.24, 0.28, 0.78, all P <0.05). The AUC of the prediction model was 0.75. The results based on SHAP values indicated that all influential factors identified through multivariate analysis contributed positively to the model predictions ( SHAP >0). Among these, depressive symptoms and parental relationship had the greatest impact on suicidal ideation ( SHAP =0.77, 0.26), and the joint effect of features with higher contribution could improve the prediction probability. Conclusions Depressive symptoms, parental relationships, Internet addiction, and time of Internet use are most important risk factors of suicidal behaviors for vocational high school students. Thus, effective interventions should be conducted to reduce their suicidal ideation.

Aim To study the main active ingredients,key targets and pathways of Cigu Xiaozhi Decoction(CXD)based on network pharmacology,and to ana-lyze and verify the mechanism of CXD on the transfor-mation of"inflammatory cancer"in non-alcoholic steatohepatitis(NASH)by animal experiments.Meth-ods The potential targets and signaling pathways of CXD in the treatment of NASH"inflammatory carcino-ma"were predicted based on network pharmacology.The mouse model of NASH was induced by methionine-choline deficiency diet(MCD),and CXD and epider-mal growth factor receptor(EGFR)inhibitors were given for 28 days.The mice were killed after the inter-vention,and the liver histopathology of each group was observed by hematoxylin-eosin method(HE).The rel-ative expression levels of EGFR,phosphatidylinositol 3-kinase(PI3K)and protein kinase B(AKT)in liver tissue of mice in each group were detected by Western blot.The contents of interleukin-6(IL-6),interleu-kin-1 β(IL-1β)and tumor necrosis factor-α(TNF-α)in serum were detected by enzyme-linked immunosor-bent assay(ELISA).Results A total of 284 poten-tial active components,159 potential therapeutic tar-gets and 20 key targets of CXD were identified by net-work pharmacological screening.CXD could affect multiple biological processes such as cell proliferation and inflammatory response,involving multiple signa-ling pathways such as tumor and PI3K/AKT.Animal experiments showed that CXD could reduce the levels of IL-6,IL-1β and TNF-α in serum of NASH mice.The relative expression of PI3K and AKT protein in liv-er tissue decreased,and the relative expression of EG-FR protein was increased.Conclusion CXD can reg-ulate EGFR/PI3K/AKT signaling pathway by partici-pating in biological processes such as cell proliferation and inflammatory response,and improve liver tissue injury in NASH mice.

Objective By simulating the nursing skills,management experience and precautions close to the clinical perioperative period,a standardized and regulated postoperative management model of mouse cecal ligation and perforation(CLP)sepsis animal model was established,and its influence on the model establishment was evaluated.Methods BALB/C male mice were randomly divided into the control group and the experimental group,with 15 mice in each group,and the CLP model was made(cecal ligation length of 1 cm,and 12 G needle penetrated 2 holes).The mice in the two groups were given routine feeding before operation,and the mice in the experimental group were treated with heat preservation,fluid rehydration and wound care after operation,while the control group mice were not treated after operation.The body weight,feed intake,animal status and survival rate 7 days after operation of mice in the two groups were recorded.Results After modeling,the body weight recovery,feed intake and animal status of mice in the experimental group were significantly better than those in the control group(P<0.05).At the same time,the 7-day survival rate of mice in the experimental group was 80.0%,which was significantly higher than that of 53.3%in the control group(P<0.05).Conclusion Applying perioperative management experience to the establishment of mice sepsis model is helpful to improve the quality and efficiency of animal experiments,which can avoid the unplanned death of model animal caused by postoperative accidents,and interfere with the judgment of the results.At the same time,it will be closer to the treatment and management measures of clinical sepsis patients,and provide reference for the establishment and application of standardized sepsis animal model.

Objective To monitor the susceptibility of clinical isolates to antimicrobial agents in tertiary hospitals in major regions of China in 2022.Methods Clinical isolates from 58 hospitals in China were tested for antimicrobial susceptibility using a unified protocol based on disc diffusion method or automated testing systems.Results were interpreted using the 2022 Clinical &Laboratory Standards Institute(CLSI)breakpoints.Results A total of 318 013 clinical isolates were collected from January 1,2022 to December 31,2022,of which 29.5％were gram-positive and 70.5％were gram-negative.The prevalence of methicillin-resistant strains in Staphylococcus aureus,Staphylococcus epidermidis and other coagulase-negative Staphylococcus species(excluding Staphylococcus pseudintermedius and Staphylococcus schleiferi)was 28.3％,76.7％and 77.9％,respectively.Overall,94.0％of MRSA strains were susceptible to trimethoprim-sulfamethoxazole and 90.8％of MRSE strains were susceptible to rifampicin.No vancomycin-resistant strains were found.Enterococcus faecalis showed significantly lower resistance rates to most antimicrobial agents tested than Enterococcus faecium.A few vancomycin-resistant strains were identified in both E.faecalis and E.faecium.The prevalence of penicillin-susceptible Streptococcus pneumoniae was 94.2％in the isolates from children and 95.7％in the isolates from adults.The resistance rate to carbapenems was lower than 13.1％in most Enterobacterales species except for Klebsiella,21.7％-23.1％of which were resistant to carbapenems.Most Enterobacterales isolates were highly susceptible to tigecycline,colistin and polymyxin B,with resistance rates ranging from 0.1％to 13.3％.The prevalence of meropenem-resistant strains decreased from 23.5％in 2019 to 18.0％in 2022 in Pseudomonas aeruginosa,and decreased from 79.0％in 2019 to 72.5％in 2022 in Acinetobacter baumannii.Conclusions The resistance of clinical isolates to the commonly used antimicrobial agents is still increasing in tertiary hospitals.However,the prevalence of important carbapenem-resistant organisms such as carbapenem-resistant K.pneumoniae,P.aeruginosa,and A.baumannii showed a downward trend in recent years.This finding suggests that the strategy of combining antimicrobial resistance surveillance with multidisciplinary concerted action works well in curbing the spread of resistant bacteria.

Objective To investigate the distribution and antimicrobial resistance profiles of the common pathogens isolated from urine from 2015 to 2021 in the CHINET Antimicrobial Resistance Surveillance Program.Methods The bacterial strains were isolated from urine and identified routinely in 51 hospitals across China in the CHINET Antimicrobial Resistance Surveillance Program from 2015 to 2021.Antimicrobial susceptibility was determined by Kirby-Bauer method,automatic microbiological analysis system and E-test according to the unified protocol.Results A total of 261 893 nonduplicate strains were isolated from urine specimen from 2015 to 2021,of which gram-positive bacteria accounted for 23.8％(62 219/261 893),and gram-negative bacteria 76.2％(199 674/261 893).The most common species were E.coli(46.7％),E.faecium(10.4％),K.pneumoniae(9.8％),E.faecalis(8.7％),P.mirabilis(3.5％),P.aeruginosa(3.4％),SS.agalactiae(2.6％),and E.cloacae(2.1％).The strains were more frequently isolated from inpatients versus outpatients and emergency patients,from females versus males,and from adults versus children.The prevalence of ESBLs-producing strains in E.coli,K.pneumoniae and P.mirabilis was 53.2％,52.8％and 37.0％,respectively.The prevalence of carbapenem-resistant strains in E.coli,K.pneumoniae,P.aeruginosa and A.baumannii was 1.7％,18.5％,16.4％,and 40.3％,respectively.Lower than 10％of the E.faecalis isolates were resistant to ampicillin,nitrofurantoin,linezolid,vancomycin,teicoplanin and fosfomycin.More than 90％of the E.faecium isolates were ressitant to ampicillin,levofloxacin and erythromycin.The percentage of strains resistant to vancomycin,linezolid or teicoplanin was＜2％.The E.coli,K.pneumoniae,P.aeruginosa and A.baumannii strains isolated from ICU inpatients showed significantly higher resistance rates than the corresponding strains isolated from outpatients and non-ICU inpatients.Conclusions E.coli,Enterococcus and K.pneumoniae are the most common pathogens in urinary tract infection.The bacterial species and antimicrobial resistance of urinary isolates vary with different populations.More attention should be paid to antimicrobial resistance surveillance and reduce the irrational use of antimicrobial agents.

Objective To understand the distribution and changing resistance profiles of clinical isolates of Enterococcus in hospitals across China from 2015 to 2021.Methods Antimicrobial susceptibility testing was conducted for the clinical isolates of Enterococcus according to the unified protocol of CHINET program by automated systems,Kirby-Bauer method,or E-test strip.The results were interpreted according to the Clinical & Laboratory Standards Institute(CLSI)breakpoints in 2021.WHONET 5.6 software was used for statistical analysis.Results A total of 124 565 strains of Enterococcus were isolated during the 7-year period,mainly including Enterococcus faecalis(50.7％)and Enterococcus faecalis(41.5％).The strains were mainly isolated from urinary tract specimens(46.9％±2.6％),and primarily from the patients in the department of internal medicine,surgery and ICU.E.faecium and E.faecalis strains showed low level resistance rate to vancomycin,teicoplanin and linezolid(≤3.6％).The prevalence of vancomycin-resistant E.faecalis and E.faecium was 0.1％and 1.3％,respectively.The prevalence of linezolid-resistant E.faecalis increased from 0.7％in 2015 to 3.4％in 2021,while the prevalence of linezolid-resistant E.faecium was 0.3％.Conclusions The clinical isolates of Enterococcus were still highly susceptible to vancomycin,teicoplanin,and linezolid,evidenced by a low resistance rate.However,the prevalence of linezolid-resistant E.faecalis was increasing during the 7-year period.It is necessary to strengthen antimicrobial resistance surveillance to effectively identify the emergence of antibiotic-resistant bacteria and curb the spread of resistant pathogens.

Objective To examine the changing antimicrobial resistance profile of Enterobacter spp.isolates in 53 hospitals across China from 2015 t0 2021.Methods The clinical isolates of Enterobacter spp.were collected from 53 hospitals across China during 2015-2021 and tested for antimicrobial susceptibility using Kirby-Bauer method or automated testing systems according to the CHINET unified protocol.The results were interpreted according to the breakpoints issued by the Clinical & Laboratory Standards Institute(CLSI)in 2021(M100 31st edition)and analyzed with WHONET 5.6 software.Results A total of 37 966 Enterobacter strains were isolated from 2015 to 2021.The proportion of Enterobacter isolates among all clinical isolates showed a fluctuating trend over the 7-year period,overall 2.5％in all clinical isolates amd 5.7％in Enterobacterale strains.The most frequently isolated Enterobacter species was Enterobacter cloacae,accounting for 93.7％(35 571/37 966).The strains were mainly isolated from respiratory specimens(44.4±4.6)％,followed by secretions/pus(16.4±2.3)％and urine(16.0±0.9)％.The strains from respiratory samples decreased slightly,while those from sterile body fluids increased over the 7-year period.The Enterobacter strains were mainly isolated from inpatients(92.9％),and only(7.1±0.8)％of the strains were isolated from outpatients and emergency patients.The patients in surgical wards contributed the highest number of isolates(24.4±2.9)％compared to the inpatients in any other departement.Overall,≤ 7.9％of the E.cloacae strains were resistant to amikacin,tigecycline,polymyxin B,imipenem or meropenem,while ≤5.6％of the Enterobacter asburiae strains were resistant to these antimicrobial agents.E.asburiae showed higher resistance rate to polymyxin B than E.cloacae(19.7％vs 3.9％).Overall,≤8.1％of the Enterobacter gergoviae strains were resistant to tigecycline,amikacin,meropenem,or imipenem,while 10.5％of these strains were resistant to polycolistin B.The overall prevalence of carbapenem-resistant Enterobacter was 10.0％over the 7-year period,but showing an upward trend.The resistance profiles of Enterobacter isolates varied with the department from which they were isolated and whether the patient is an adult or a child.The prevalence of carbapenem-resistant E.cloacae was the highest in the E.cloacae isolates from ICU patients.Conclusions The results of the CHINET Antimicrobial Resistance Surveillance Program indicate that the proportion of Enterobacter strains in all clinical isolates fluctuates slightly over the 7-year period from 2015 to 2021.The Enterobacter strains showed increasing resistance to multiple antimicrobial drugs,especially carbapenems over the 7-year period.

Objective To monitor the antifungal resistance of clinical isolates of Candida spp.in the East China region.Methods MALDI-TOF MS or molecular methods were used to re-identify the strains collected from January 2018 to December 2022.Antifungal susceptibility testing was performed using the broth microdilution method.The susceptibility test results were interpreted according to the breakpoints of 2022 Clinical and Laboratory Standards Institute(CLSI)documents M27 M44s-Ed3 and M57s-Ed4.Results A total of 3 026 strains of Candida were collected,65.33％of which were isolated from sterile body sites,mainly from blood(38.86％)and pleural effusion/ascites(10.21％).The predominant species of Candida were Candida albicans(44.51％),followed by Candida parapsilosis complex(19.46％),Candida tropicalis(13.98％),Candida glabrata(10.34％),and other Candida species(0.79％).Candida albicans showed overall high susceptibility rates to the 10 antifungal drugs tested(the lowest rate being 93.62％).Only 2.97％of the strains showed dose-dependent susceptibility(SDD)to fluconazole.Candida parapsilosis complex had a SDD rate of 2.61％and a resistance rate of 9.42％to fluconazole,and susceptibility rates above 90％to other drugs.Candida glabrata had a SDD rate of 92.01％and a resistance rate of 7.99％to fluconazole,resistance rates of 32.27％and 48.24％to posaconazole and voriconazole non-wild-type strains(NWT),respectively,and susceptibility rates above 90％to other drugs.Candida tropicalis had resistance rates of 29.55％and 26.24％to fluconazole and voriconazole,respectively,resistance rates of 76.60％and 21.99％to posaconazole and echinocandins non-wild-type strains(NWT),and a resistance rate of 2.36％to echinocandins.Conclusions The prevalence and species distribution of Candida spp.in the East China region are consistent with previous domestic and international reports.Candida glabrata exhibits certain degree of resistance to fluconazole,while Candida tropicalis demonstrates higher resistance to triazole drugs.Additionally,echinocandins resistance has emerged in Candida albicans,Candida glabrata,Candida tropicalis,and Candida parapsilosis.