1.Diagnosis and Treatment of Cough Associated with Interstitial Lung Disease from Collaterals Deficiency with Latent Wind
Fang SUN ; Shiqi SUN ; Yan XUE ; Wei ZHANG
Journal of Traditional Chinese Medicine 2025;66(10):1057-1059
It is believed that the basic mechanism of cough associated with interstitial lung disease is collaterals deficiency with latent wind: the deficiency of the lung organs and lung collaterals is the basis of its pathogenesis, and latent wind in lung collaterals is the key mechanism of the cough which is difficult to cure. Treatment is based on the principle of supplementing deficiency and treating wind, dispelling the pathogens and unblocking the collaterals. Supplementing deficiency should supplement lungs, boost kidneys, and strengthen spleens to consolidate the root and banking up the origin, and regulate and tonify the lung collaterals; dispelling the pathogens should treat the internal and external winds at the same time, and taking into account the combined pathogens of phlegm, stasis and dampness to clear the stagnation of the lung collaterals.
2.Effect of Tuina at "Weizhong (BL 40)" on Spinal Microglial Activation-related Proteins and the IL-10/β-EP Pathway in a Rat Model of Chronic Sciatic Nerve Compression Injury
Tianwei ZHANG ; Xiangqian LYU ; Yani XING ; Liuchen ZHU ; Qingguang ZHU ; Lingjun KONG ; Yanbin CHENG ; Zhen YAN ; Wuquan SUN ; Min FANG ; Zhiwei WU
Journal of Traditional Chinese Medicine 2025;66(7):734-740
ObjectiveTo investigate the analgesic effect of Tuina at the "Weizhong (BL 40)" on neuropathic pain in a rat model of chronic constriction injury (CCI) of the sciatic nerve and its potential central spinal mechanisms. MethodsThirty-two Sprague-Dawley rats were randomly divided into four groups (8 rats in each group), sham-operated group, model group, Tuina group, and blockade group. The CCI model was established in the model group, Tuina group, and the blockade group by ligating the sciatic nerve with catgut, while the sham-operated group underwent only sciatic nerve exposure without ligation. From postoperative day 4 to day 14, rats in the Tuina group and the blockade group received Tuina manipulation at the "Weizhong (BL 40)" using a dynamic pressure distribution measurement system (5 N pressure, 2 Hz frequency, 10 min per session, once daily). The blockade group also received intraperitoneal injections of the microglial inhibitor minocycline (10 mg/kg) once daily. The sham-operated and the model group underwent the same handling and fixation as the Tuina group without actual Tuina. Mechanical withdrawal threshold (MWT) and paw withdrawal latency (PWL) were measured before surgery and on day 3, 7, 10, and 14 post-surgery. Transmission electron microscopy was used to evaluate sciatic nerve injury and repair, measuring axon diameter and total myelinated fiber diameter to calculate the g-ratio. Western Blotting was performed to detect the protein levels of ionized calcium-binding adapter molecule 1 (Iba-1), CD206, CD68, interleukin-10 (IL-10), and β-endorphin (β-EP) precursor pro-opiomelanocortin (POMC) in the ipsilateral spinal dorsal horn. ResultsCompared with the sham-operated group, the model group showed significantly reduced MWT and PWL on day 3, 7, 10, and 14 (P<0.01). Compared with the model group, the Tuina group and the blockade group showed increased MWT and PWL on day 10 and 14 (P<0.05). Compared with the Tuina group, the blockade group exhibited higher MWT on day 7, 10, and 14, and higher PWL on day 10 (P<0.05). Sciatic nerve pathological morphology revealed intact and well-structured myelin in the sham-operated group, while the model group exhibited myelin collapse, distortion, and myelin ovoid formation. The Tuina group displayed partially irregular myelin with occasional myelin collapse, whereas the blockade group exhibited partial myelin irregularities and phospholipid shedding. Compared with the sham-operated group, the model group showed a decreased g-ratio and increased levels of Iba-1 and CD68 in the spinal dorsal horn (P<0.05 or P<0.01). Compared with the model group, the Tuina group and the blockade group exhibited an increased g-ratio and reduced Iba-1 and CD68 levels. Additionally, the Tuina group showed elevated levels of CD206, IL-10, and POMC, whereas the blockade group had decreased CD206 levels (P<0.05). ConclusionTuina at "Weizhong (BL 40)" alleviates neuropathic pain in CCI rats, potentially by regulating microglial activation in the spinal cord, inhibiting M1 polarization while promoting M2 polarization, and activating the IL-10/β-EP pathway to exert analgesic effects.
3.Treatment of Sepsis-induced Inflammatory Responses with Xijiao Dihuangtang by Modulation of PKM2-mediated One-carbon Metabolism Pathway
Qixiang YAN ; Yeyan ZHU ; Fan GE ; Qimeng SUN ; Leyao YE ; Fang TIAN ; Jun LU
Chinese Journal of Experimental Traditional Medical Formulae 2025;31(10):18-26
ObjectiveTo investigate the effects of Xijiao Dihuangtang (XJDHT) on mice with sepsis and cellular models of sepsis and explore its molecular mechanism in alleviating sepsis-induced inflammatory responses via regulating pyruvate kinase M2 (PKM2)-mediated one-carbon metabolism pathway. MethodsForty C57BL/6N mice were randomly divided into four groups: normal group, model group, low-dose XJDHT group (7.7 g·kg-1), and high-dose XJDHT group (15.4 g·kg-1). After one week of continuous gavage, sepsis was induced using cecal ligation and puncture (CLP) in groups except the normal group. 24 h after the surgery, mortality rates in all groups were recorded, and serum cytokines were measured by enzyme linked immunosorbent assay (ELISA). Lung histopathology was examined by hematoxylin-eosin (HE) staining. During the in vitro experiment, the human monocytic leukemia cell line (THP-1) was exposed to various concentrations of XJDHT and treated with lipopolysaccharide (LPS) at a final concentration of 2 mg·L-1 for 24 h. Cell apoptosis was detected using terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay. Protein levels of tumor necrosis factor-α (TNF-α), interleukin-1β (IL-1β), B-cell lymphoma 2 (Bcl-2), and Bcl-2-associated X protein (Bax) were measured by Western blot. Transcriptome sequencing was performed to analyze differentially expressed genes in all groups and conduct gene ontology (GO) enrichment. Key genes in the one-carbon metabolism pathway, including pyruvate kinase M2 (PKM2), 5-methyltetrahydrofolate-homocysteine methyltransferase (MTR), and phosphoglycerate dehydrogenase (PHGDH), were verified by Western blot. A PKM2 inhibition model was established using shikonin for further protein expression analysis. ResultsAnimal experiments showed that compared with the normal group, the model group exhibited significantly elevated body temperature and lung pathology (P<0.01) and increased serum TNF-α and IL-1β levels (P<0.01). High-dose XJDHT reduced body temperature and lung tissue damage (P<0.01) and significantly decreased serum TNF-α and IL-1β levels (P<0.01). Low-dose XJDHT treatment showed no significant temperature change (P<0.01) but reduced serum TNF-α and IL-1β levels (P<0.01). Transcriptome sequencing and Western blot revealed significant differences in the expression of TNF-α, IL-1β, and one-carbon metabolism genes (PKM2, MTR, and PHGDH) (P<0.01). Cell experiments demonstrated that compared to the normal group, the model group showed elevated protein expressions of TNF-α and IL-1β in THP-1 cells (P<0.01), decreased Bcl-2/Bax ratio, and increased apoptosis (P<0.01). Transcriptome sequencing and Western blot revealed significant differences in the expression of TNF-α, IL-1β, and one-carbon metabolism genes (PKM2, MTR, and PHGDH) (P<0.01). Compared to the model group, high-dose XJDHT significantly increased Bax/Bcl-2 ratio and PHGDH protein expression (P<0.01) and effectively reduced cell apoptosis (P<0.01) while down-regulating protein expressions of TNF-α, IL-1β, PKM2, and MTR (P<0.01). Low-dose XJDHT moderately increased Bax/Bcl-2 ratio and PHGDH protein expression (P<0.05), reduced apoptosis (P<0.05), and decreased IL-1β and MTR protein levels (P<0.05, P<0.01), but there were no significant changes in TNF-α and PKM2 expression. After PKM2 inhibition by shikonin in THP-1 cells, the expression of protein related to one-carbon metabolism was detected. Compared with the blank group, the LPS-induced model group showed significantly upregulated PKM2 and MTR protein expression (P<0.01) and downregulated PHGDH expression (P<0.01). Compared with the model group, shikonin treatment significantly reduced PKM2 expression (P<0.05), increased PHGDH expression (P<0.01), and decreased MTR expression (P<0.05). ConclusionXJDHT can inhibit the release of inflammatory factors in sepsis, and its mechanism is related to the intervention of the PKM2-regulated one-carbon metabolism pathway in macrophages.
4.Exogenous administration of heparin-binding epidermal growth factor-like growth factor improves erectile function in mice with bilateral cavernous nerve injury.
Minh Nhat VO ; Mi-Hye KWON ; Fang-Yuan LIU ; Fitri Rahma FRIDAYANA ; Yan HUANG ; Soon-Sun HONG ; Ju-Hee KANG ; Guo Nan YIN ; Ji-Kan RYU
Asian Journal of Andrology 2025;27(6):697-706
Prostate cancer is the second most common malignancy and the sixth leading cause of cancer-related death in men worldwide. Radical prostatectomy (RP) is the standard treatment for localized prostate cancer, but the procedure often results in postoperative erectile dysfunction (ED). The poor efficacy of phosphodiesterase 5 inhibitors after surgery highlights the need to develop new therapies to enhance cavernous nerve regeneration and improve the erectile function of these patients. In the present study, we aimed to examine the potential of heparin-binding epidermal growth factor-like growth factor (HB-EGF) in preserving erectile function in cavernous nerve injury (CNI) mice. We found that HB-EGF expression was reduced significantly on the 1 st day after CNI in penile tissue. Ex vivo and in vitro studies showed that HB-EGF promotes major pelvic ganglion neurite sprouting and neuro-2a (N2a) cell migration. In vivo studies showed that exogenous HB-EGF treatment significantly restored the erectile function of CNI mice to 86.9% of sham levels. Immunofluorescence staining showed that mural and neuronal cells were preserved by inducing cell proliferation and reducing apoptosis and reactive oxygen species production. Western blot analysis showed that HB-EGF upregulated protein kinase B and extracellular signal-regulated kinase activation and neurotrophic factor expression. Overall, HB-EGF is a major promising therapeutic agent for treating ED in postoperative RP.
Animals
;
Male
;
Heparin-binding EGF-like Growth Factor/therapeutic use*
;
Erectile Dysfunction/etiology*
;
Mice
;
Penis/drug effects*
;
Nerve Regeneration/drug effects*
;
Penile Erection/drug effects*
;
Peripheral Nerve Injuries/drug therapy*
;
Cell Proliferation/drug effects*
;
Apoptosis/drug effects*
;
Cell Movement/drug effects*
;
Prostatectomy/adverse effects*
;
Mice, Inbred C57BL
;
Reactive Oxygen Species/metabolism*
5.Molecular targeted therapy for progressive low-grade gliomas in children.
Yan-Ling SUN ; Miao LI ; Jing-Jing LIU ; Wen-Chao GAO ; Yue-Fang WU ; Lu-Lu WAN ; Si-Qi REN ; Shu-Xu DU ; Wan-Shui WU ; Li-Ming SUN
Chinese Journal of Contemporary Pediatrics 2025;27(6):682-689
OBJECTIVES:
To evaluate the efficacy of molecular targeted agents in children with progressive pediatric low-grade gliomas (pLGG).
METHODS:
A retrospective analysis was conducted on pLGG patients treated with oral targeted therapies at the Department of Pediatrics, Beijing Shijitan Hospital, Capital Medical University, from July 2021. Treatment responses and safety profiles were assessed.
RESULTS:
Among the 20 enrolled patients, the trametinib group (n=12, including 11 cases with BRAF fusions and 1 case with BRAF V600E mutation) demonstrated 4 partial responses (33%) and 2 minor responses (17%), with a median time to response of 3.0 months. In the vemurafenib group (n=6, all with BRAF V600E mutation), 5 patients achieved partial responses (83%), showing a median time to response of 1.0 month. Comparative analysis revealed no statistically significant difference in progression-free survival rates between the two treatment groups (P>0.05). The median duration of clinical benefit (defined as partial response + minor response + stable disease) was 11.0 months for vemurafenib and 18.0 months for trametinib. Two additional cases, one with ATM mutation treated with olaparib for 24 months and one with NF1 mutation receiving everolimus for 21 months, discontinued treatment due to sustained disease stability. No severe adverse events were observed in any treatment group.
CONCLUSIONS
Molecular targeted therapy demonstrates clinical efficacy with favorable tolerability in pLGG. Vemurafenib achieves high response rates and induces early tumor shrinkage in patients with BRAF V600E mutations, supporting its utility as a first-line therapy.
Humans
;
Glioma/genetics*
;
Male
;
Female
;
Child
;
Child, Preschool
;
Retrospective Studies
;
Brain Neoplasms/genetics*
;
Molecular Targeted Therapy/adverse effects*
;
Adolescent
;
Infant
;
Proto-Oncogene Proteins B-raf/genetics*
;
Pyrimidinones/therapeutic use*
;
Mutation
6.Incidence of small for gestational age infants among singleton live births and analysis of risk factors.
Yan-Fen LIU ; Yu-Tian LIU ; Yan-Fang ZHAO ; Xian-Jun SUN
Chinese Journal of Contemporary Pediatrics 2025;27(11):1326-1332
OBJECTIVES:
To investigate the incidence of small for gestational age (SGA) infants among singleton live births and identify risk factors.
METHODS:
Clinical data for 1 020 singleton live-born infants and their mothers at People's Hospital Affiliated to Shandong First Medical University from January 2019 to January 2024 were retrospectively collected. The incidence of SGA was calculated, and univariate and multivariable logistic regression analyses were performed to determine independent risk factors.
RESULTS:
Among 1 020 singleton live births, the incidence of SGA was 9.90%. SGA was more frequent in female neonates and in cases with lower placental weight or umbilical cord abnormalities (all P<0.05). Both preterm and post-term birth showed significant linear trends with SGA incidence (P<0.05). Maternal factors associated with higher SGA incidence included age <20 years or ≥35 years, primary-school education or below, low pre-pregnancy body mass index (BMI), insufficient gestational weight gain, gestational hypertension, diabetes, anemia, hyperthyroidism, hypothyroidism, amniotic fluid/placental abnormalities, and smoking history (all P<0.05). Multivariable logistic regression identified preterm birth, post-term birth, low placental weight, umbilical cord abnormalities, low pre-pregnancy BMI, insufficient gestational weight gain, gestational hypertension, anemia during pregnancy, and maternal smoking as independent risk factors for SGA (all P<0.05).
CONCLUSIONS
The occurrence of SGA among singleton live births is associated with preterm or post-term delivery, low placental weight, umbilical cord abnormalities, low pre-pregnancy BMI, inadequate gestational weight gain, gestational hypertension, anemia during pregnancy, and maternal smoking. Targeted strengthening of perinatal management is warranted to reduce the risk of SGA.
Humans
;
Female
;
Infant, Small for Gestational Age
;
Risk Factors
;
Infant, Newborn
;
Retrospective Studies
;
Pregnancy
;
Male
;
Incidence
;
Adult
;
Logistic Models
;
Live Birth
;
Young Adult
7.Detection of residual DNA in host cells of Escherichia coli in levodopa by Real-time PCR
Bingyu XU ; YAN LIU ; Xinyao GUO ; Fang YAN ; Guibin SUN
Journal of China Pharmaceutical University 2025;56(2):176-182
Using Real-time PCR technology, a highly specific and sensitive method for detecting DNA residues of Escherichia coli host cells in levodopa was established, validated, and preliminarily applied. Escherichia coli strain MB6 16S ribosomal RNA gene was selected as the target gene to design multiple pairs of primers and the target fragment by specific amplification of PCR was obtained. The target fragment was cloned into the pLENTI-BSD-CON vector and the recombinant plasmid was constructed and named pLENTI-BSD-CON-E.coli-16S. A quantitative PCR detection method (SYBR Green method) with magnetic bead extraction and purification methods was established with the reference standard of the recombinant plasmid. Furthermore, the established method was validated, including linear and range, accuracy, precision, specificity, and quantification limit, and applied to the detection of levodopa raw materials. Meanwhile, the detection method was compared with the Taqman probe method by the commercial kit. The primer sequences of the quantitative PCR detection method (SYBR Green method) were TTCGATGCAACGCGAAGAAC (forward) and GTGTAGCCCTGGTCGTAAGG (reverse). The standard curve of DNA was in the range of 10 fg/μL to 3 ng/μL with good linearity (R2≥ 0.98). The quantitative limit was 10 fg/μL. In addition, the detection recovery rate was in the range of 59.7% to 80.7%, with RSD at less than 15%. Nine batches of levodopa were detected by this method, and the amount of E.coli DNA residue was below the limit. The developed qPCR method can be used for quantitative detection of residual DNA in biological products produced by E.coli as host cells, such as levodopa . The results indicate that the sensitivity of the detection method for recombinant plasmid construction standards is superior than the reagent kit detection method.
8.Current status of generalized pustular psoriasis: Findings from a multicenter hospital-based survey of 127 Chinese patients.
Haimeng WANG ; Jiaming XU ; Xiaoling YU ; Siyu HAO ; Xueqin CHEN ; Bin PENG ; Xiaona LI ; Ping WANG ; Chaoyang MIAO ; Jinzhu GUO ; Qingjie HU ; Zhonglan SU ; Sheng WANG ; Chen YU ; Qingmiao SUN ; Minkuo ZHANG ; Bin YANG ; Yuzhen LI ; Zhiqiang SONG ; Songmei GENG ; Aijun CHEN ; Zigang XU ; Chunlei ZHANG ; Qianjin LU ; Yan LU ; Xian JIANG ; Gang WANG ; Hong FANG ; Qing SUN ; Jie LIU ; Hongzhong JIN
Chinese Medical Journal 2025;138(8):953-961
BACKGROUND:
Generalized pustular psoriasis (GPP), a rare and recurrent autoinflammatory disease, imposes a substantial burden on patients and society. Awareness of GPP in China remains limited.
METHODS:
This cross-sectional survey, conducted between September 2021 and May 2023 across 14 hospitals in China, included GPP patients of all ages and disease phases. Data collected encompassed demographics, clinical characteristics, economic impact, disease severity, quality of life, and treatment-related complications. Risk factors for GPP recurrence were analyzed.
RESULTS:
Among 127 patients (female/male ratio = 1.35:1), the mean age of disease onset was 25 years (1st quartile [Q1]-3rd quartile [Q3]: 11-44 years); 29.2% had experienced GPP for more than 10 years. Recurrence occurred in 75.6% of patients, and nearly half reported no identifiable triggers. Younger age at disease onset ( P = 0.021) and transitioning to plaque psoriasis ( P = 0.022) were associated with higher recurrence rates. The median diagnostic delay was 8 months (Q1-Q3: 2-41 months), and 32.3% of patients reported misdiagnoses. Comorbidities were present in 53.5% of patients, whereas 51.1% experienced systemic complications during treatment. Depression and anxiety affected 84.5% and 95.6% of patients, respectively. During GPP flares, the median Dermatology Life Quality Index score was 19.0 (Q1-Q3: 13.0-23.5). This score showed significant differences between patients with and without systemic symptoms; it demonstrated correlations with both depression and anxiety scores. Treatment costs caused financial hardship in 55.9% of patients, underscoring the burden associated with GPP.
CONCLUSIONS
The substantial disease and economic burdens among Chinese GPP patients warrant increased attention. Patients with early onset disease and those transitioning to plaque psoriasis require targeted interventions to mitigate the high recurrence risk.
Humans
;
Male
;
Female
;
Psoriasis/pathology*
;
Adult
;
Cross-Sectional Studies
;
Adolescent
;
Child
;
Young Adult
;
Quality of Life
;
Middle Aged
;
China/epidemiology*
;
Recurrence
;
Risk Factors
;
Surveys and Questionnaires
;
East Asian People
9.Guidelines for the diagnosis and treatment of prurigo nodularis.
Li ZHANG ; Qingchun DIAO ; Xia DOU ; Hong FANG ; Songmei GENG ; Hao GUO ; Yaolong CHEN ; Chao JI ; Chengxin LI ; Linfeng LI ; Jie LI ; Jingyi LI ; Wei LI ; Zhiming LI ; Yunsheng LIANG ; Jianjun QIAO ; Zhiqiang SONG ; Qing SUN ; Juan TAO ; Fang WANG ; Zhiqiang XIE ; Jinhua XU ; Suling XU ; Hongwei YAN ; Xu YAO ; Jianzhong ZHANG ; Litao ZHANG ; Gang ZHU ; Fei HAO ; Xinghua GAO
Chinese Medical Journal 2025;138(22):2859-2861
10.Outcome indicators in randomized controlled trials of traditional Chinese medicine treatment of post-stroke depression.
Jin HAN ; Yue YUAN ; Fang-Biao XU ; Yan-Bo SONG ; Yong-Kang SUN ; Xin-Zhi WANG
China Journal of Chinese Materia Medica 2025;50(2):542-559
This study systematically reviewed the randomized controlled trial(RCT) of traditional Chinese medicine(TCM) treatment of post-stroke depression(PSD) and analyzed the clinical study characteristics and outcome indicators, aiming to optimize the design and establish the core outcome set in the future clinical trials of the TCM treatment of PSD. PubMed, Web of Science, Cochrane Library, EMbase, CNKI, VIP, Wanfang, and SinoMed were searched for the relevant RCT published in recent 3 years. The basic characteristics, intervention measures, and outcome indicators of the included RCT were extracted, and the descriptive analysis was carried out. A total of 76 RCTs were eventually included, with the sample size concentrated in 80-100 cases. The most frequent TCM syndromes were liver depression and Qi stagnation(15 times, 31.91%) and phlegm combined with stasis(5 times, 10.63%). The frequency of intervention methods followed a descending trend of TCM decoction(35 times, 46.05%) and TCM decoction + acupuncture(4 times, 5.26%), Chinese patent medicine(3 times, 3.94%), and the intervention mainly lasted for 1 to 3 months(43 times, 60.56%). The adverse reactions of patients were mainly digestive system reaction(150 patients, 39.37%) and nervous system reaction(112 patients, 29.39%). Most of the included studies had unclear risk of bias, involving 84 outcome indicators, which belonged to 8 indicator domains. The RCTs of TCM treatment of PSD showed a variety of problems, such as non-standard TCM syndrome differentiation, inconsistent names of TCM syndrome scores and measurement tools, low quality, unclear risk of bias, neglect of endpoint indicators, unreasonable selection of substitute indicators, lack of differentiation between primary and secondary outcome indicators, non-standard reporting of safety indicators, insufficient attention to economic indicators, and lack of long-term prognosis evaluation. It is suggested that the future research should improve the quality of methodology and build a standardized core outcome set to promote the development of high-quality clinical research in this field.
Humans
;
Randomized Controlled Trials as Topic
;
Drugs, Chinese Herbal/administration & dosage*
;
Stroke/psychology*
;
Depression/etiology*
;
Treatment Outcome
;
Medicine, Chinese Traditional

Result Analysis
Print
Save
E-mail