This article adopts Professor CHEN Chaozu′s " sanjiao composed by membrane-striae" theory as its foundation to explore the relationship between irritable bowel syndrome and functional/structural abnormalities of the membrane-striae. Sanjiao encompasses both the tangible membrane and the intangible striae. These striae permeate the entire body，and their pathological changes comprehensively reflect qi，body fluids，and fasciae. Based on the physiological function of the membrane-striae in regulating qi and fluids，the pathogenesis of irritable bowel syndrome is characterized by a disharmony of membrane-striae and an imbalance of the qi-fluid interactions. In the early stage，external pathogens，emotional factors，or dietary stimuli often cause membrane-striae constriction and disordered qi-fluid circulation. In the middle stage，stagnant fluids gradually transform into phlegm retention，leading to membrane-striae obstruction. In the late stage，deficiency of vital qi becomes predominant，manifesting as laxity of membrane-striae with impaired control or weakened conduction. The treatment of irritable bowel syndrome should adopt " unblocking" as the guiding principle. In the early stage，therapy should focus on eliminating pathogenic factors and soothing membrane-striae to promptly restore qi-fluid circulation，thereby attaining unblocking through spasm relief. In the middle stage，treatment should focus on resolving tangible obstructions in membrane-striae，achieving unblocking via dredging. In the late stage，the emphasis should shift to reinforcing healthy qi，particularly by strengthening spleen-kidney yang qi，and achieving unblocking through supplementation. Concurrently，throughout the entire treatment process，the regulation of mental state and easing of emotional tension should be integrated to alleviate patient′s anxiety，achieving the goal of holistic treatment of both body and mind.

Objective: To explore the application method and clinical efficacy of endoscopic and computerized navigation technology in maxillofacial foreign body removal surgery, and to provide a reference for the clinical application of this technology. Methods: This study, which was approved by the Medical Ethics Committee of the hospital, retrospectively analyzed the data of five patients with maxillofacial foreign bodies who were admitted to Sun Yat-sen Memorial Hospital, Sun Yat-sen University from January 2018 to December 2024. All patients underwent preoperative CT scanning. Intraoperatively, endoscopic and computer navigation techniques were used in combination or separately according to the location, size, and adjacency of the foreign body to important neurovascular vessels. The foreign body was precisely localized by endoscopic magnification and direct visualization, and the optimal surgical path was designed and verified under the real-time guidance of computerized navigation to accurately remove the foreign body. The type of foreign body, location, length and diameter, duration of surgery, length of incision, success rate of foreign body removal, postoperative complications, and follow-up were recorded and analyzed. Results: The foreign body was successfully removed in all five patients with a success rate of 100%. The intraoperative computerized navigation system was accurate in positioning, and the alignment stability was not significantly affected by mandibular movement; the endoscope provided good illumination and exposure of the operative field. All surgical incisions were small, and no serious complications, such as foreign body residue, important neurovascular injury, or infection, occurred after surgery. One month after the operation, the patients were followed up and recovered well. Conclusion The combination of endoscopy and computer navigation or separately assisted technology can provide a clear field and real-time positioning for maxillofacial foreign body removal, effectively avoiding important anatomical structures, thus realizing safe and complete foreign body removal with minimized trauma. This assistive technology significantly improves the accuracy and safety of the operation and has clinical promotion value.

Using Real-time PCR technology, a highly specific and sensitive method for detecting DNA residues of Escherichia coli host cells in levodopa was established, validated, and preliminarily applied. Escherichia coli strain MB6 16S ribosomal RNA gene was selected as the target gene to design multiple pairs of primers and the target fragment by specific amplification of PCR was obtained. The target fragment was cloned into the pLENTI-BSD-CON vector and the recombinant plasmid was constructed and named pLENTI-BSD-CON-E.coli-16S. A quantitative PCR detection method (SYBR Green method) with magnetic bead extraction and purification methods was established with the reference standard of the recombinant plasmid. Furthermore, the established method was validated, including linear and range, accuracy, precision, specificity, and quantification limit, and applied to the detection of levodopa raw materials. Meanwhile, the detection method was compared with the Taqman probe method by the commercial kit. The primer sequences of the quantitative PCR detection method (SYBR Green method) were TTCGATGCAACGCGAAGAAC (forward) and GTGTAGCCCTGGTCGTAAGG (reverse). The standard curve of DNA was in the range of 10 fg/μL to 3 ng/μL with good linearity (R2≥ 0.98). The quantitative limit was 10 fg/μL. In addition, the detection recovery rate was in the range of 59.7% to 80.7%, with RSD at less than 15%. Nine batches of levodopa were detected by this method, and the amount of E.coli DNA residue was below the limit. The developed qPCR method can be used for quantitative detection of residual DNA in biological products produced by E.coli as host cells, such as levodopa . The results indicate that the sensitivity of the detection method for recombinant plasmid construction standards is superior than the reagent kit detection method.

BACKGROUND: Generalized pustular psoriasis (GPP), a rare and recurrent autoinflammatory disease, imposes a substantial burden on patients and society. Awareness of GPP in China remains limited. METHODS: This cross-sectional survey, conducted between September 2021 and May 2023 across 14 hospitals in China, included GPP patients of all ages and disease phases. Data collected encompassed demographics, clinical characteristics, economic impact, disease severity, quality of life, and treatment-related complications. Risk factors for GPP recurrence were analyzed. RESULTS: Among 127 patients (female/male ratio = 1.35:1), the mean age of disease onset was 25 years (1st quartile [Q1]-3rd quartile [Q3]: 11-44 years); 29.2% had experienced GPP for more than 10 years. Recurrence occurred in 75.6% of patients, and nearly half reported no identifiable triggers. Younger age at disease onset ( P  = 0.021) and transitioning to plaque psoriasis ( P  = 0.022) were associated with higher recurrence rates. The median diagnostic delay was 8 months (Q1-Q3: 2-41 months), and 32.3% of patients reported misdiagnoses. Comorbidities were present in 53.5% of patients, whereas 51.1% experienced systemic complications during treatment. Depression and anxiety affected 84.5% and 95.6% of patients, respectively. During GPP flares, the median Dermatology Life Quality Index score was 19.0 (Q1-Q3: 13.0-23.5). This score showed significant differences between patients with and without systemic symptoms; it demonstrated correlations with both depression and anxiety scores. Treatment costs caused financial hardship in 55.9% of patients, underscoring the burden associated with GPP. CONCLUSIONS The substantial disease and economic burdens among Chinese GPP patients warrant increased attention. Patients with early onset disease and those transitioning to plaque psoriasis require targeted interventions to mitigate the high recurrence risk.
Humans ; Male ; Female ; Psoriasis/pathology* ; Adult ; Cross-Sectional Studies ; Adolescent ; Child ; Young Adult ; Quality of Life ; Middle Aged ; China/epidemiology* ; Recurrence ; Risk Factors ; Surveys and Questionnaires ; East Asian People

This study systematically reviewed the randomized controlled trial(RCT) of traditional Chinese medicine(TCM) treatment of post-stroke depression(PSD) and analyzed the clinical study characteristics and outcome indicators, aiming to optimize the design and establish the core outcome set in the future clinical trials of the TCM treatment of PSD. PubMed, Web of Science, Cochrane Library, EMbase, CNKI, VIP, Wanfang, and SinoMed were searched for the relevant RCT published in recent 3 years. The basic characteristics, intervention measures, and outcome indicators of the included RCT were extracted, and the descriptive analysis was carried out. A total of 76 RCTs were eventually included, with the sample size concentrated in 80-100 cases. The most frequent TCM syndromes were liver depression and Qi stagnation(15 times, 31.91%) and phlegm combined with stasis(5 times, 10.63%). The frequency of intervention methods followed a descending trend of TCM decoction(35 times, 46.05%) and TCM decoction + acupuncture(4 times, 5.26%), Chinese patent medicine(3 times, 3.94%), and the intervention mainly lasted for 1 to 3 months(43 times, 60.56%). The adverse reactions of patients were mainly digestive system reaction(150 patients, 39.37%) and nervous system reaction(112 patients, 29.39%). Most of the included studies had unclear risk of bias, involving 84 outcome indicators, which belonged to 8 indicator domains. The RCTs of TCM treatment of PSD showed a variety of problems, such as non-standard TCM syndrome differentiation, inconsistent names of TCM syndrome scores and measurement tools, low quality, unclear risk of bias, neglect of endpoint indicators, unreasonable selection of substitute indicators, lack of differentiation between primary and secondary outcome indicators, non-standard reporting of safety indicators, insufficient attention to economic indicators, and lack of long-term prognosis evaluation. It is suggested that the future research should improve the quality of methodology and build a standardized core outcome set to promote the development of high-quality clinical research in this field.
Humans ; Randomized Controlled Trials as Topic ; Drugs, Chinese Herbal/administration & dosage* ; Stroke/psychology* ; Depression/etiology* ; Treatment Outcome ; Medicine, Chinese Traditional

This study aims to explore the mechanism of Jiaotai Pills in treating depression based on metabolomics and network pharmacology. The chemical constituents of Jiaotai Pills were identified by UHPLC-Orbitrap Exploris 480, and the targets of Jiaotai Pills and depression were retrieved from online databases. STRING and Cytoscape 3.7.2 were used to construct the protein-protein interaction network of core targets of Jiaotai Pills in treating depression and the "compound-target-pathway" network. DAVID was used for Gene Ontology(GO) function and Kyoto Encyclopedia of Genes and Genomes(KEGG) pathway enrichment analyses of the core targets. The mouse model of depression was established with chronic unpredictable mild stress(CUMS) and treated with different doses of Jiaotai Pills. The behavioral changes and pathological changes in the hippocampus were observed. UHPLC-Orbitrap Exploris 120 was used for metabolic profiling of the serum, from which the differential metabolites and related metabolic pathways were screened. A "metabolite-reaction-enzyme-gene" network was constructed for the integrated analysis of metabolomics and network pharmacology. A total of 34 chemical components of Jiaotai Pills were identified, and 143 core targets of Jiaotai Pills in treating depression were predicted, which were mainly involved in the arginine and proline, sphingolipid, and neurotrophin metabolism signaling pathways. The results of animal experiments showed that Jiaotai Pills alleviated the depression behaviors and pathological changes in the hippocampus of the mouse model of CUMS-induced depression. In addition, Jiaotai Pills reversed the levels of 32 metabolites involved in various pathways such as arginine and proline metabolism, sphingolipid metabolism, and porphyrin metabolism in the serum of model mice. The integrated analysis showed that arginine and proline metabolism, cysteine and methionine metabolism, and porphyrin metabolism might be the key pathways in the treatment of depression with Jiaotai Pills. In conclusion, metabolomics combined with network pharmacology clarifies the antidepressant mechanism of Jiaotai Pills, which may provide a basis for the clinical application of Jiaotai Pills in treating depression.
Animals ; Drugs, Chinese Herbal/chemistry* ; Depression/genetics* ; Mice ; Network Pharmacology ; Metabolomics ; Male ; Disease Models, Animal ; Humans ; Protein Interaction Maps/drug effects* ; Antidepressive Agents

This study aims to evaluate the efficacy of Chinese medicine injections in treating transient ischemic attack(TIA) based on network Meta-analysis. Randomized controlled trial(RCT) about Chinese medicine injections in treating TIA were retrieved from PubMed, Web of Science, Cochrane Library, EMbase, CNKI, VIP, Wanfang, and SinoMed with the time interval from inception to March 1, 2024. The methodological quality of the included articles was assessed by ROB 2.0, and the GRADE system was employed to evaluate the quality of evidence. The gemtc package of R 4.1.2 was used to perform the network Meta-analysis. Finally, 63 RCTs with a total sample size of 5 750 cases were included, involving 11 Chinese medicine injections(Shuxuetong Injection, Danhong Injection, Shuxuening Injection, Ginkgo Damo Injection, Shenxiong Glucose Injection, Ligustrazine Injection, Salviae Miltiorrhizae and Ligustrazine Hydrochloride Injection, Salvianolic Acids for Injection, Dengzhan Xixin Injection, Guhong Injection, and Xueshuantong Injection). All patients received conventional western medicine treatment, and the experimental group was additionally treated with Chinese medicine injection. Network Meta-analysis yielded the following results.(1) In terms of improving the clinical total response rate, 11 Chinese medicine injections combined with conventional western medicine outperformed conventional western medicine alone, and Dengzhan Xixin Injection + conventional western medicine had the best effect.(2) In terms of reducing plasma viscosity, 7 Chinese medicine injections combined with conventional western medicine outperformed conventional western medicine alone, and Shenxiong Glucose Injection + conventional western medicine had the best effect.(3) In terms of reducing whole blood high shear viscosity, 6 Chinese medicine injections combined with conventional western medicine outperformed conventional western medicine alone, and Guhong Injection + conventional western medicine had the best effect.(4) In terms of reducing whole blood low shear viscosity, 6 Chinese medicine injections combined with conventional western medicine outperformed conventional western medicine alone, and Shuxuening Injection + conventional western medicine had the best effect.(5) In terms of reducing fibrinogen, 9 Chinese medicine injections combined with conventional western medicine outperformed conventional western medicine alone, and Ginkgo Damo Injection + conventional western medicine had the best effect.(6) In terms of increasing the average blood flow velocity, 3 Chinese medicine injections combined with conventional western medicine outperformed conventional western medicine alone, and Shuxuening Injection + conventional western medicine had the best effect. In summary, compared with conventional western medicine alone, Chinese medicine injections combined with conventional western medicine were effective in improving the clinical total response rate and the average blood flow velocity, as well as reducing plasma viscosity, whole blood high shear viscosity, whole blood low shear viscosity, and fibrinogen. However, due to the limited quality and quantity of the included articles, the above conclusions need to be verified by more high-quality, multi-center, and large-sample RCT.
Humans ; Drugs, Chinese Herbal/administration & dosage* ; Injections ; Ischemic Attack, Transient/drug therapy* ; Randomized Controlled Trials as Topic ; Treatment Outcome

Prostate cancer is the second most common malignancy and the sixth leading cause of cancer-related death in men worldwide. Radical prostatectomy (RP) is the standard treatment for localized prostate cancer, but the procedure often results in postoperative erectile dysfunction (ED). The poor efficacy of phosphodiesterase 5 inhibitors after surgery highlights the need to develop new therapies to enhance cavernous nerve regeneration and improve the erectile function of these patients. In the present study, we aimed to examine the potential of heparin-binding epidermal growth factor-like growth factor (HB-EGF) in preserving erectile function in cavernous nerve injury (CNI) mice. We found that HB-EGF expression was reduced significantly on the 1 st day after CNI in penile tissue. Ex vivo and in vitro studies showed that HB-EGF promotes major pelvic ganglion neurite sprouting and neuro-2a (N2a) cell migration. In vivo studies showed that exogenous HB-EGF treatment significantly restored the erectile function of CNI mice to 86.9% of sham levels. Immunofluorescence staining showed that mural and neuronal cells were preserved by inducing cell proliferation and reducing apoptosis and reactive oxygen species production. Western blot analysis showed that HB-EGF upregulated protein kinase B and extracellular signal-regulated kinase activation and neurotrophic factor expression. Overall, HB-EGF is a major promising therapeutic agent for treating ED in postoperative RP.
Animals ; Male ; Heparin-binding EGF-like Growth Factor/therapeutic use* ; Erectile Dysfunction/etiology* ; Mice ; Penis/drug effects* ; Nerve Regeneration/drug effects* ; Penile Erection/drug effects* ; Peripheral Nerve Injuries/drug therapy* ; Cell Proliferation/drug effects* ; Apoptosis/drug effects* ; Cell Movement/drug effects* ; Prostatectomy/adverse effects* ; Mice, Inbred C57BL ; Reactive Oxygen Species/metabolism*

OBJECTIVES: To evaluate the efficacy of molecular targeted agents in children with progressive pediatric low-grade gliomas (pLGG). METHODS: A retrospective analysis was conducted on pLGG patients treated with oral targeted therapies at the Department of Pediatrics, Beijing Shijitan Hospital, Capital Medical University, from July 2021. Treatment responses and safety profiles were assessed. RESULTS: Among the 20 enrolled patients, the trametinib group (n=12, including 11 cases with BRAF fusions and 1 case with BRAF V600E mutation) demonstrated 4 partial responses (33%) and 2 minor responses (17%), with a median time to response of 3.0 months. In the vemurafenib group (n=6, all with BRAF V600E mutation), 5 patients achieved partial responses (83%), showing a median time to response of 1.0 month. Comparative analysis revealed no statistically significant difference in progression-free survival rates between the two treatment groups (P>0.05). The median duration of clinical benefit (defined as partial response + minor response + stable disease) was 11.0 months for vemurafenib and 18.0 months for trametinib. Two additional cases, one with ATM mutation treated with olaparib for 24 months and one with NF1 mutation receiving everolimus for 21 months, discontinued treatment due to sustained disease stability. No severe adverse events were observed in any treatment group. CONCLUSIONS Molecular targeted therapy demonstrates clinical efficacy with favorable tolerability in pLGG. Vemurafenib achieves high response rates and induces early tumor shrinkage in patients with BRAF V600E mutations, supporting its utility as a first-line therapy.
Humans ; Glioma/genetics* ; Male ; Female ; Child ; Child, Preschool ; Retrospective Studies ; Brain Neoplasms/genetics* ; Molecular Targeted Therapy/adverse effects* ; Adolescent ; Infant ; Proto-Oncogene Proteins B-raf/genetics* ; Pyrimidinones/therapeutic use* ; Mutation