ObjectiveTo explore the mechanism by which Yizhi Qingxin prescription improves mitochondrial dysfunction in Alzheimer's disease （AD） through regulating mitochondrial Ca²⁺ homeostasis and kinetic balance based on the protein kinase A （PKA）/calcineurin （CaN） signaling pathway. MethodsSixty three-month-old amyloid precursor protein （APP）/presenilin 1 （PS1） double transgenic mice were randomly divided into a model group， a donepezil group（0.65 mg·kg^-1）， a low-dose Yizhi Qingxin prescription group （YQF-L，2.6 g·kg^-1）， a medium-dose Yizhi Qingxin prescription group （YQF-M，5.2 g·kg^-1）， and a high-dose Yizhi Qingxin prescription group （YQF-H，10.4 g·kg^-1）， with 12 mice in each group. Twelve C57BL/6J mice with the same genetic background served as a normal group. Each treatment group received gavage administration daily， with the model and normal groups receiving equal volume of physiological saline. Intervention continued for 12 consecutive weeks. The learning and memory abilities of the mice were assessed using the novel object recognition （NOR） and Morris water maze （MWM） tests. Hematoxylin-eosin （HE）/Nissl staining was used to observe histopathological changes in the hippocampus. Transmission electron microscopy （TEM） was used to observe mitochondrial ultrastructure. Fluo-4 acetoxymethyl ester （Fluo-4 AM） Ca²⁺ probe was used to measure intracellular Ca²⁺ concentration in brain tissue. Western blot was used to determine the protein expression of PKA， CaN， sodium/calcium/lithium exchanger （NCLX）， mitochondrial calcium uniporter （MCU）， calmodulin （CaM）， dynamin-related protein 1 （Drp1）， and phosphorylated dynamin-related protein 1 （serine 637 site） ［p-Drp1（S637）］ in the hippocampus. Real-time quantitative polymerase chain reaction （Real-time PCR） was used to measure the expression of PKA， CaN， CaM， NCLX， MCU， and Drp1 mRNAs. ResultsCompared with those in the normal group， the recognition index （RI） of the model group decreased （P0.01）， and the number of crossings through the original platform area， the duration of stay in the target quadrant， and the distance were reduced （P0.01）. The protein expression of PKA， NCLX， and p-DRP1 （ser637） significantly decreased （P0.05）， and the mRNA expression of PKA and NCLX significantly decreased （P0.05）. The escape latency （EL） was prolonged （P0.05）， and the intracellular Ca²⁺ level significantly increased （P0.01）. The protein expression of CaN， CaM， MCU， and Drp1， as well as the mRNA expression of CaN， MCU， and Drp1， significantly increased （P0.05）. After intervention with Donepezil and Yizhi Qingxin prescription， compared with that in the model group， the RI of the treatment group significantly increased （P0.05）， and the number of crossings through the platform and the duration of stay in the target quadrant significantly increased （P0.05）. The protein expression of PKA， NCLX， and p-Drp1 （ser637） and the mRNA expression of PKA and NCLX significantly increased （P0.05）. On the 4th and 5th days， the EL was shortened （P0.05）， and the intracellular Ca²⁺ level decreased （P0.05）. The protein expression of CaN， CaM， MCU， and Drp1 and the mRNA expression of CaN， MCU， and Drp1 significantly decreased （P0.05）. ConclusionYizhi Qingxin prescription regulates the PKA/CaN pathway， upregulates the expression of PKA， NCLX， and p-Drp1 （ser637） proteins， reduces the expression of CaN， CaM， MCU， and Drp1 proteins， and regulates Ca²⁺ homeostasis and mitochondrial dynamic balance， thereby enhancing the spatial learning and memory abilities of AD mice.

ObjectiveTo explore the mechanism by which Yizhi Qingxin prescription improves mitochondrial dysfunction in Alzheimer's disease （AD） through regulating mitochondrial Ca²⁺ homeostasis and kinetic balance based on the protein kinase A （PKA）/calcineurin （CaN） signaling pathway. MethodsSixty three-month-old amyloid precursor protein （APP）/presenilin 1 （PS1） double transgenic mice were randomly divided into a model group， a donepezil group（0.65 mg·kg^-1）， a low-dose Yizhi Qingxin prescription group （YQF-L，2.6 g·kg^-1）， a medium-dose Yizhi Qingxin prescription group （YQF-M，5.2 g·kg^-1）， and a high-dose Yizhi Qingxin prescription group （YQF-H，10.4 g·kg^-1）， with 12 mice in each group. Twelve C57BL/6J mice with the same genetic background served as a normal group. Each treatment group received gavage administration daily， with the model and normal groups receiving equal volume of physiological saline. Intervention continued for 12 consecutive weeks. The learning and memory abilities of the mice were assessed using the novel object recognition （NOR） and Morris water maze （MWM） tests. Hematoxylin-eosin （HE）/Nissl staining was used to observe histopathological changes in the hippocampus. Transmission electron microscopy （TEM） was used to observe mitochondrial ultrastructure. Fluo-4 acetoxymethyl ester （Fluo-4 AM） Ca²⁺ probe was used to measure intracellular Ca²⁺ concentration in brain tissue. Western blot was used to determine the protein expression of PKA， CaN， sodium/calcium/lithium exchanger （NCLX）， mitochondrial calcium uniporter （MCU）， calmodulin （CaM）， dynamin-related protein 1 （Drp1）， and phosphorylated dynamin-related protein 1 （serine 637 site） ［p-Drp1（S637）］ in the hippocampus. Real-time quantitative polymerase chain reaction （Real-time PCR） was used to measure the expression of PKA， CaN， CaM， NCLX， MCU， and Drp1 mRNAs. ResultsCompared with those in the normal group， the recognition index （RI） of the model group decreased （P0.01）， and the number of crossings through the original platform area， the duration of stay in the target quadrant， and the distance were reduced （P0.01）. The protein expression of PKA， NCLX， and p-DRP1 （ser637） significantly decreased （P0.05）， and the mRNA expression of PKA and NCLX significantly decreased （P0.05）. The escape latency （EL） was prolonged （P0.05）， and the intracellular Ca²⁺ level significantly increased （P0.01）. The protein expression of CaN， CaM， MCU， and Drp1， as well as the mRNA expression of CaN， MCU， and Drp1， significantly increased （P0.05）. After intervention with Donepezil and Yizhi Qingxin prescription， compared with that in the model group， the RI of the treatment group significantly increased （P0.05）， and the number of crossings through the platform and the duration of stay in the target quadrant significantly increased （P0.05）. The protein expression of PKA， NCLX， and p-Drp1 （ser637） and the mRNA expression of PKA and NCLX significantly increased （P0.05）. On the 4th and 5th days， the EL was shortened （P0.05）， and the intracellular Ca²⁺ level decreased （P0.05）. The protein expression of CaN， CaM， MCU， and Drp1 and the mRNA expression of CaN， MCU， and Drp1 significantly decreased （P0.05）. ConclusionYizhi Qingxin prescription regulates the PKA/CaN pathway， upregulates the expression of PKA， NCLX， and p-Drp1 （ser637） proteins， reduces the expression of CaN， CaM， MCU， and Drp1 proteins， and regulates Ca²⁺ homeostasis and mitochondrial dynamic balance， thereby enhancing the spatial learning and memory abilities of AD mice.

BACKGROUND:Gradient artificial bone repair scaffolds can mimic unique anatomical features in musculoskeletal tissues,showing great potential for repairing injured musculoskeletal tissues. OBJECTIVE:To review the latest research advances in gradient artificial bone repair scaffolds for tissue engineering in the musculoskeletal system and describe their advantages and fabrication strategies. METHODS:The first author of the article searched the Web of Science and PubMed databases for articles published from 2000 to 2023 with search terms"gradient,bone regeneration,scaffold".Finally,76 papers were analyzed and summarized after the screening. RESULTS AND CONCLUSION:(1)As an important means of efficient and high-quality repair of skeletal system tissues,gradient artificial bone repair scaffolds are currently designed bionically for the natural gradient characteristics of bone tissue,bone-cartilage,and tendon-bone tissue.These scaffolds can mimic the extracellular matrix of native tissues to a certain extent in terms of structure and composition,thus promoting cell adhesion,migration,proliferation,differentiation,and regenerative recovery of damaged tissues to their native state.(2)Advanced manufacturing technology provides more possibilities for gradient artificial bone repair scaffold preparation:Gradient electrospun fiber scaffolds constructed by spatially differentiated fiber arrangement and loading of biologically active substances have been developed;gradient 3D printed scaffolds fabricated by layered stacking,graded porosity,and bio-3D printing technology;gradient hydrogel scaffolds fabricated by in-situ layered injections,simple layer-by-layer stacking,and freeze-drying method;and in addition,there are also scaffolds made by other modalities or multi-method coupling.These scaffolds have demonstrated good biocompatibility in vitro experiments,were able to accelerate tissue regeneration in small animal tests,and were observed to have significantly improved histological structure.(3)The currently developed gradient artificial bone repair scaffolds have problems such as mismatch of gradient scales,unclear material-tissue interactions,and side effects caused by degradation products,which need to be further optimized by combining the strengths of related disciplines and clinical needs in the future.

BACKGROUND:Multiple studies have confirmed that mitogen-activated protein kinase(MAPK)signaling pathway is involved in cell proliferation,and microRNA(miR)is involved in the occurrence and development of hypertrophic scars.Therefore,the role of miR-27a-3p and MAPK signaling pathways in pathological scar formation has been further explored. OBJECTIVE:To explore the effect of miR-27a-3p on the proliferation of human hypertrophic scar fibroblasts through the MAPK signaling pathway. METHODS:The primary fibroblasts were isolated and collected from the skin samples.The primary fibroblasts were observed by inverted microscope and verified by immunofluorescence.The relative expression level of miR-27a-3p in tissues was detected by qRT-PCR.The target genes of hsa-miR-27a-3p were predicted using the database,and then the predicted target genes were enriched by gene ontology function analysis and biological pathway enrichment analysis of the Kyoto Encyclopedia of Genes and Genomes.There were seven groups:blank control,negative control,miR-27a-3p mimic,miR-27a-3p inhibitor,miR-27a-3p mimic+p38 MAPK inhibitor,miR-27a-3p mimic+extracellular regulated protein kinase inhibitor,miR-27a-3p mimic+c-Jun N-terminal kinase inhibitor.Western blot was used to detect the levels of extracellular regulated protein kinase,c-Jun N-terminal kinase inhibitor.and p38 kinase and their phosphorylation levels.Cell counting kit-8 and EdU were used to detect cell proliferation. RESULTS AND CONCLUSION:Compared with normal skin fibroblasts,hypertrophic scar fibroblasts had stronger proliferative activity(P<0.05)and faster proliferation level(P<0.001).Compared with normal skin,miR-27a-3p was highly expressed in hypertrophic scars(P<0.001).Compared with the negative control group,overexpression of miR-27a-3p could promote cell proliferation activity(P<0.001)and proliferation levels(P<0.001).Compared with the negative control group,knockdown of miR-27a-3p could inhibit the proliferation activity(P<0.05)and proliferation levels(P<0.001).Compared with the negative control group,overexpression of miR-27a-3p promoted the phosphorylated levels of extracellular regulated protein kinase,c-Jun N-terminal kinase,and p38 mitogen-activated protein kinase(P<0.05).Compared with the negative control group,knockdown of miR-27a-3p inhibited the phosphorylated levels of extracellular regulated protein kinase,c-Jun N-terminal kinase,and p38 MAPK(P<0.05).Compared with the miR-27a-3p mimic group,specific inhibitors of extracellular regulated protein kinase,c-Jun N-terminal kinase,and p38 MAPK reversed the effects of miR-27a-3p on the proliferative activity(P<0.01)and proliferation level(P<0.001)of fibroblasts.To conclude,these results suggest that miR-27a-3p promotes the proliferation of human hypertrophic scar fibroblasts by activating the MAPK signaling pathway.

Diabetes is a very complex endocrine disease whose common feature is the increase in blood glucose concentration. Persistent hyperglycemia can lead to blindness, kidney and heart disease, neurodegeneration, and many other serious complications that have a significant impact on human health and quality of life. The number of people with diabetes is increasing yearly. The global diabetes prevalence in 20-79 year olds in 2021 was estimated to be 10.5% (536.6 million), and it will rise to 12.2% (783.2 million) in 2045. The main modes of intervention for diabetes include medication, dietary management, and exercise conditioning. Medication is the mainstay of treatment. Marketed diabetes drugs such as metformin and insulin, as well as GLP-1 receptor agonists, are effective in controlling blood sugar levels to some extent, but the preventive and therapeutic effects are still unsatisfactory. Peptide drugs have many advantages such as low toxicity, high target specificity, and good biocompatibility, which opens up new avenues for the treatment of diabetes and other diseases. Currently, insulin and its analogs are by far the main life-saving drugs in clinical diabetes treatment, enabling effective control of blood glucose levels, but the risk of hypoglycemia is relatively high and treatment is limited by the route of delivery. New and oral anti-diabetic drugs have always been a market demand and research hotspot. Inhibitor cystine knot (ICK) peptides are a class of multifunctional cyclic peptides. In structure, they contain three conserved disulfide bonds (C3-C20, C7-C22, and C15-C32) form a compact “knot” structure, which can resist degradation of digestive protease. Recent studies have shown that ICK peptides derived from legume, such as PA1b, Aglycin, Vglycin, Iglycin, Dglycin, and aM₁, exhibit excellent regulatory activities on glucose and lipid metabolism at the cellular and animal levels. Mechanistically, ICK peptides promote glucose utilization by muscle and liver through activation of IR/AKT signaling pathway, which also improves insulin resistance. They can repair the damaged pancrease through activation of PI3K/AKT/Erk signaling pathway, thus lowering blood glucose. The biostability and hypoglycemic efficacy of the ICK peptides meet the requirements for commercialization of oral drugs, and in theory, they can be developed into natural oral anti-diabetes peptide drugs. In this review, the structural properties, activity and mechanism of ICK pattern peptides in regulating glucose and lipid metabolism were summaried, which provided a reference for the development of new oral peptides for diabetes.

Objective To explore the pathogenesis and prognostic factors of liposarcoma in the head and neck region, and simultaneously analyze the efficacy of different treatment regimens. Methods A retrospective analysis was performed on all patients with primary untreated head and neck liposarcoma who were diagnosed and underwent surgical treatment at our hospital from January 2008 to January 2024. All patients were monitored during follow-up, and their prognoses were analyzed using SPSS software. Results A total of 30 patients were included in the study. Liposarcoma accounted for up to 60% of the cases in the orbit, while the remaining liposarcomas were primarily located in various interspaces of the neck. Dedifferentiated liposarcoma was the most common type, comprising 33%, while myxoid pleomorphic liposarcoma was the rarest at 4%. The tumor pathological type (P<0.001) and Ki67 (P=0.014) significantly affected the tumor control rate. However, an analysis of disease-specific survival rates revealed no significant differences across various factors (all P>0.05). Conclusion The prognosis of head and neck liposarcoma is better compared to that of liposarcomas in other parts of the body. However, myxoid pleomorphic liposarcoma, pleomorphic fat sarcoma, and high Ki67 levels are indicators of poor prognosis. Additionally, postoperative adjuvant radiotherapy does not significantly enhance disease-specific survival rates.

OBJECTIVE To explore the mechanism of improvement effect of Chanbao zhichuang suppository （CBZCS） on hemorrhoids in rats through network pharmacology and metabolomics. METHODS A hemorrhoid model was established by subcutaneous injection of rhododendron oil to induce anal swelling. SD rats were divided into blank group （NC group， 0.32 g/kg vaseline）， model group （Model group， 0.32 g/kg vaseline）， CBZCS low-， medium-， and high-dose groups （CBZCS-L， CBZCS- M， CBZCS-H groups， with dosages of 0.16， 0.32， and 0.64 g/kg respectively）， and Mayinglong musk hemorrhoids suppository group （Positive group， 0.32 g/kg）， with 9 rats in each group. Anal administration was performed at 6， 12， 24， 48， and 72 hours after modeling. After the last administration， the pathological changes of the anal tissues in rats were observed， and the serum levels of interleukin-6 （IL-6） and tumor necrosis factor-α （TNF-α） in rats were detected. Differential metabolite analysis and enrichment analysis were conducted by metabolomics methods， and the target proteins of CBZCS in treating hemorrhoids were obtained by network pharmacology. The core metabolic pathways were screened by interaction and enrichment analysis of differential metabolites and proteins， and the core proteins were experimentally verified. RESULTS Compared with the NC group， the anal tissues of the Model group showed obvious lesions， and the levels of IL-6 and TNF- α in the serum were significantly increased （P＜0.05）； compared with the Model group， the pathological damage of the anal tissues in the treatment groups was alleviated to varying degrees， and serum levels of IL-6 in CBZCS-H group， CBZCS-M group， and Positive group as well as serum levels of TNF-α in CBZCS-H group were significantly reduced （P＜0.05）. The metabolomics results showed that 34 differential metabolites were screened from the anal tissues of rats， and 22 of them showed a return after CBZCS administration. The differential metabolites mainly enriched in arachidonic acid metabolism， histidine metabolism， and glycerophospholipid metabolism. Through the network pharmacology， 138 intersection genes of CBZCS against hemorrhoids were determined. The analysis results showed that differential metabolites and target proteins were mainly enriched in the arachidonic acid metabolism pathway， and the regulation of this pathway might be related to cyclooxygenase-2 （COX-2）， Myc proto-oncogene protein （c-MYC）， cytochrome P450 1B1 （CYP1B1）， interleukin-1β （IL-1β）， and IL-6 protein expression. The experimental verification results showed that the expression levels of key proteins （COX-2， c-MYC， CYP1B1， IL-6， IL-1β） in the anal tissues of the Model group were significantly higher than those in the NC group （P＜0.05）， and the levels of the above proteins in the anal tissues of CBZCS-H group and Positive group were significantly lower than those in the Model group （P＜0.05）. CONCLUSIONS The mechanism of CBZCS in treating hemorrhoids may be to inhibit the expression of COX-2， c-MYC and CYP1B1 proteins， thereby inhibiting arachidonic acid metabolism and reducing the release of inflammatory factors IL-6 and IL-1β.

Using Real-time PCR technology, a highly specific and sensitive method for detecting DNA residues of Escherichia coli host cells in levodopa was established, validated, and preliminarily applied. Escherichia coli strain MB6 16S ribosomal RNA gene was selected as the target gene to design multiple pairs of primers and the target fragment by specific amplification of PCR was obtained. The target fragment was cloned into the pLENTI-BSD-CON vector and the recombinant plasmid was constructed and named pLENTI-BSD-CON-E.coli-16S. A quantitative PCR detection method (SYBR Green method) with magnetic bead extraction and purification methods was established with the reference standard of the recombinant plasmid. Furthermore, the established method was validated, including linear and range, accuracy, precision, specificity, and quantification limit, and applied to the detection of levodopa raw materials. Meanwhile, the detection method was compared with the Taqman probe method by the commercial kit. The primer sequences of the quantitative PCR detection method (SYBR Green method) were TTCGATGCAACGCGAAGAAC (forward) and GTGTAGCCCTGGTCGTAAGG (reverse). The standard curve of DNA was in the range of 10 fg/μL to 3 ng/μL with good linearity (R2≥ 0.98). The quantitative limit was 10 fg/μL. In addition, the detection recovery rate was in the range of 59.7% to 80.7%, with RSD at less than 15%. Nine batches of levodopa were detected by this method, and the amount of E.coli DNA residue was below the limit. The developed qPCR method can be used for quantitative detection of residual DNA in biological products produced by E.coli as host cells, such as levodopa . The results indicate that the sensitivity of the detection method for recombinant plasmid construction standards is superior than the reagent kit detection method.

ObjectiveThis study explores the methods of lung tissue extraction and fixation required for pathological studies of fetal rats, based on the unique physiological structure of fetal rat lung tissue and existing lung tissue fixation techniques for adult rats. MethodsSix pregnant adult SD rats at 20.5 days of gestation were subjected to cesarean section to obtain fetal rats. Four healthy fetal rats with similar body weight, vital signs, and respiratory status were selected from each pregnant rat, and they were randomly divided into the following groups using a random number table: direct lung infiltration group, lung infiltration group after intratracheal infusion, whole-body infiltration group of fetal rats, and whole-body infiltration group after intratracheal infusion of fetal rats. To systematically compare and analyze the anatomical morphology under different fixation methods, lung tissues from four groups of fetal rats were harvested, perfused, and fixed, and the gross morphology of lung tissues in each group was observed. Paraffin sections were prepared and stained with Hematoxylin-Eosin (H&E). The histological morphology of the whole lung, alveoli, and bronchi was further examined under optical microscopy. ResultsIn the direct lung infiltration group, the hilar structures were unclear, lung lobation was indistinct, the shape was irregular, lung cavities were small, and alveoli and bronchi were shrunken. In the lung infiltration group after intratracheal infusion, the hilar structures were clear, lobation was pronounced, the shape was regular, lung cavities were large, and alveoli and bronchi were full. Both the whole-body infiltration group and whole-body infiltration group after intratracheal infusion of fetal rats exhibited visible lungs, hearts, skins, and other organs. The lung tissues of both groups showed obvious lobulation, irregular shape, and damage at the margins of lung lobes. In the whole-body infiltration group, the thoracic cavities of the fetus were flattened, lung cavities were small, and alveoli and bronchi were shrunken. In the whole-body infiltration group after intratracheal infusion of fetal rats, the fetal thoracic cavities were full, lung cavities were large, and alveoli and bronchi were relatively full. ConclusionThe lung infiltration after intratracheal infusion method for fetal rat lung tissue fixation outperforms direct lung infiltration, whole-body infiltration of fetal rats, and whole-body infiltration after intratracheal infusion of fetal rats in terms of preservation of the lung tissue's original morphology, paraffin sectioning, staining, and pathological observation and analysis. The embedding, sectioning, and staining processes are also simple and save consumables. Therefore, intratracheal infusion followed by lung infiltration method is recommended for fixation in histopathological observation of fetal rat lung tissue.

Objective: To explore the association between the Internet usage characteristics and suicidal ideation among vocational high school students, so as to provide a theoretical basis for precise intervention of suicide among vocational high school students. Methods: A total of 1 781 students were recruited from three vocational high schools in Wuhan and Xianning in March 2023 by using the cluster random sampling method. The Columbia-Suicide Severity Rating Scale and Revised Chen Internet Addiction Scale were used to measure suicidal ideation and Internet addiction, respectively. LASSO regression model was used to select influential factors related to suicidal ideation, and the gradient boosting decision tree algorithm XGBoost was used to develop prediction models and evaluate predictive performance. By calculating the SHAP values, the contribution of each influential factor was quantified. Results: The prevalence of suicidal ideation among vocational high school students was 42.22% and prevalence of Internet addiction was 26.39%. LASSO regression results indicated that age, gender, experience of being left behind, parental relationship, holding a class cadre position, using the Internet for learning, Internet use during dawn, morning and late night, Internet addiction, and depressive symptoms were all the influential factors of suicidal ideation among vocational high school students ( β= -0.05 , 0.29, 0.09, 0.27, 0.10, -0.01, 0.09, 0.05, 0.24, 0.28, 0.78, all P <0.05). The AUC of the prediction model was 0.75. The results based on SHAP values indicated that all influential factors identified through multivariate analysis contributed positively to the model predictions ( SHAP >0). Among these, depressive symptoms and parental relationship had the greatest impact on suicidal ideation ( SHAP =0.77, 0.26), and the joint effect of features with higher contribution could improve the prediction probability. Conclusions Depressive symptoms, parental relationships, Internet addiction, and time of Internet use are most important risk factors of suicidal behaviors for vocational high school students. Thus, effective interventions should be conducted to reduce their suicidal ideation.