1.Effect of leflunomide regulating HIF-1α signal pathway on autophagy of synoviocytes in rheumatoid arthritis
Weiya LAN ; Wukai MA ; Xueming YAO ; Zong JIANG ; Lang XIONG ; Shufen YANG ; Fang TANG
Acta Universitatis Medicinalis Anhui 2024;59(10):1823-1828
Objective To investigate the effect of leflunomide(LEF)on the expression of associated autophagy genes in synoviocytes of rheumatoid arthritis(RA)by regulating HIF-1α signal pathway.Methods Three genera-tions of RA synovial cells were divided into blank control group,LEF group and Tripterygium wilfordii polyglyco-sides group.The blank control group was added with the same volume of DMEM culture medium.The drug group was treated with LEF(concentration 0.2 mg/ml)and Tripterygium wilfordii polyglycosides(concentration 0.03 mg/ml),the proliferation and apoptosis of synovial cells were detected by flow cytometry,the expression of IL-1 β,TNF-α,ANGPTL-4 and VEGF was detected by ELISA,the expression of HIF-1α mRNA was detected by qRT-PCR,and the expression of HIF-1 α,Beclin-1 and BNIP3 protein was detected by Western blot.Results Com-pared with Tripterygium wilfordii polyglycosides group,the expression of IL-1 α,TNF-α,ANGPTL-4 and VEGF in synovial supernatant of LEF group decreased;compared with the blank control group,the expression of HIF-1αmRNA in synovial cells of LEF group and Tripterygium wilfordii polyglycosides group decreased,and the effect of LEF group was the most obvious;compared with the blank control group,the protein expressions of HIF-1α,Bec-lin-1 and BNIP3 in synovial cells of LEF group and Tripterygium wilfordii polyglycosides group decreased,and the effect of LEF group was the most obvious.Conclusion LEF can inhibit the expression of inflammatory factors in RA synovial cells,inhibit HIF-1α signaling pathway,inhibit the expression of autophagy-related genes Beclin-1 and BNIP3,and improve the pathological state of synovitis.
2.Clinical analysis of combined microsurgery for nanophthalmic patients with uncontrolled intraocular pressure after peripheral iridectomy
Yihua SU ; Lei FANG ; Yantao WEI ; Shufen LIN ; Wei WEI ; Hui XIAO ; Yunlan LING ; Xing LIU
Chinese Journal of Microsurgery 2022;45(1):65-70
Objective:To evaluate the efficacy and safety of limited pars plana vitrectomy(LPPV), pressure-controlled phacoemulsification(PCP), intraocular lens implantation(IOL), and posterior capsulotomy (PC) in treatment of nanophthalmic glaucoma eyes which intraocular pressure(IOP) were still out of control after peripheral iridectomy.Methods:All 24 patients(29 eyes) with nanophthalmic glaucoma whose IOP failed to be reduced after peripheral iridectomy and needed LPPV plus PCP plus IOL plus PC were recruited from July 2017 to April 2021. The age of these patients was(44.6±11.0) years old. Preoperative and postoperative IOP, best corrected visual acuity(BCVA), anterior chamber depth(ACD) and number of glaucoma medications were recorded by chart review and compared by using paired t-test or Wilcoxon signed rank-sum test. P<0.05 was considered as statistical significant. IOP could be controlled in normal range(≥5 mmHg and≤21 mmHg), without both of disease progression and serious complications were regarded as the success criteria of the operation. Surgical success rate was evaluated. Surgery-associated complications were recorded. Results:The average follow-up time was(11.52±12.44) months. After the microsurgery, IOP decreased from(33.12±9.25) mmHg to(14.23±3.44) mmHg( P<0.01); The ACD increased from(1.23±0.46) mm to(2.86±0.62) mm, and the median number of glaucoma medications dropped from 3(3,4) to 3(0,3) at final follow-up visit( P<0.05). There were no significant differences in BCVA( P=0.196) and the degrees of angle closure(AC) ( P=0.478) before and after operation. The total surgical success rate was 86.2%(25/29) at the final follow-up visit. Two eyes suffered from local choroidal detachment which recovered within 2 weeks with medical treatment. Conclusion:LPPV plus PCP plus IOL plus PC is a safe and effective novel surgical procedure in the treatment of nanophthalmic glaucoma patients with uncontrolled IOP after peripheral iridectomy. It could significantly decrease IOP, increase the depth of ACD, reduce the number of glaucoma medications and maintain BCVA. It can be considered as a first choice for the surgical management for patients with a such condition.
3.Treatment and prognosis of severe hyperbilirubinemia in full-term infants meeting exchange transfusion criteria: a multicenter retrospective study
Ling LI ; Meihua PIAO ; Wei GUO ; Jingqun WANG ; Shuxia GENG ; Mei YANG ; Xin HE ; Shufen ZHAI ; Lili PING ; Baoli TIAN ; Lixia LIANG ; Fang LIU ; Shaoguang LYU ; Xueai FAN ; Liyuan HUI ; Liyan LIU ; Xiaohong GU ; Xiaojiao WANG ; Jing KANG
Chinese Journal of Perinatal Medicine 2021;24(6):454-460
Objective:To investigate the prognosis of severe hyperbilirubinemia in full-term infants who met the exchange transfusion criteria and were treated by blood exchange transfusion and phototherapy.Methods:A total of 168 full-term infants with severe hyperbilirubinemia who met the criteria for exchange transfusion and were hospitalized in the Neonatology Department of seven tertiary hospitals in Hebei Province from June 2017 to December 2018 were retrospectively included. According to the treatment protocol, they were divided into two groups: exchange transfusion group (38 cases) and phototherapy group (130 cases). Two independent sample t-test and Chi-square test were used to compare the clinical manifestations and follow-up results between the two groups. Multivariate logistic regression was used to analyze the risk factors for poor prognosis. Results:Neonatal severe hyperbilirubinemia in the exchange transfusion and phototherapy group were both mainly caused by hemolytic disease [42.1%(16/38) and 29.2%(38/130)], sepsis [28.9%(11/38) and 11.5%(15/130)] and early-onset breastfeeding jaundice [15.8%(6/38) and 11.5%(15/130)]. Total serum bilirubin level on admission in the exchange transfusion group was significantly higher than that in the phototherapy group [(531.7±141.3) vs (440.0±67.4) μmol/L, t=3.870, P<0.001]. Moreover, the percentage of patients with mild, moderate and severe acute bilirubin encephalopathy in the exchange transfusion group were higher than those in the phototherapy group [15.8%(6/38) vs 3.8%(5/130), 7.9%(3/38) vs 0.8%(1/130), 13.2%(5/38) vs 0.0%(0/130); χ2=29.119, P<0.001]. Among the 168 patients, 135 were followed up to 18-36 months of age and 12 showed poor prognosis (developmental retardation or hearing impairment) with four in the exchange transfusion group (12.9%, 4/31) and eight in the phototherapy group (7.7%, 8/104). Multivariate logistic regression analysis showed that for full-term infants with severe hyperbilirubinemia who met the exchange transfusion criteria, phototherapy alone without blood exchange transfusion as well as severe ABE were risk factors for poor prognosis ( OR=14.407, 95% CI: 1.101-88.528, P=0.042; OR=16.561, 95% CI: 4.042-67.850, P<0.001). Conclusions:Full-term infants who have severe hyperbilirubinemia and meet the exchange transfusion criteria should be actively treated with blood exchange transfusion, especially for those with severe ABE, so as to improve the prognosis.
4. Measurement of biological parameters of nanophthalmos and its correlation with axial length
Wei WEI ; Hui XIAO ; Liming CHEN ; Jingyi LUO ; Lei FANG ; Shufen LIN ; Xing LIU
Chinese Journal of Experimental Ophthalmology 2019;37(9):745-749
Objective:
To quantitatively measure biological parameters of nanophthalmos and analyze the correlation between axial length (AL) and the other biological parameters.
Methods:
The clinical data of 71 eyes of 43 patients identified with nanophthalmos (AL≤20 mm) from September 2012 to August 2018 in Zhongshan Ophthalmic Center were retrospectively analyzed.All enrolled patients underwent ophthalmological examinations including best-corrected visual acuity, refraction, slit-lamp biomicroscopy, fundus examination, Goldmann applanation tonometry, A-scan ultrasound examinations, ultrasound biomicroscopy, spectral domain optical coherence tomography (SD-OCT) and nonmydriatic fundus photography.Pearson correlation analysis was used to analyze the relationship between AL and all biological parameters.This study followed the Declaration of Helsinki and was approved by the Ethics Committee of Zhongshan Ophthalmic Center (NO.2017KYPJ092). All patients signed informed consent.
Results:
Of the 43 patients, the average age was (46.00±12.75) years, the mean intraocular pressure was (24.97±14.87)mmHg (1 mmHg=0.133 kPa). The mean best corrected visual acuity was 1.14±0.79, the mean refraction was (11.61±4.09)D.The mean AL, central corneal thickness (CCT), central anterior chamber depth(ACD), anterior chamber width (ACW), len thickness(LT) and vitreous cavity length(VCL) was (17.13±1.57)mm, (550±60)μm, (1.64±0.37)mm, (11.17±0.61)mm, (5.01±0.51)mm and (10.10±1.80)mm, respectively.The average retinal nerve fiber layer thickness (mRNFLT), macular foveal retinal thickness (FRT) and subfoveal choroidal thickness (SFCT) was (98.51±40.93), (294.46±116.83) and (488.72±133.06)μm, respectively.The ratio of ACD to AL, LT to AL, and VCL to AL was 9.6%, 29.4% and 59.3%, respectively.The ACW and VCL were positively correlated with AL(
5.lncRNA SBF2-AS1 promotes epithelial-mesenchymal transition of cervical cancer cells via regulating miR-140-5p/VEGFAaxis
FANG Shufen ; XIONG Shuhua ; HUANG Ouping ; WAN Yuzhen
Chinese Journal of Cancer Biotherapy 2019;26(12):1331-1336
Objective: To investigate the effect of lncRNA SBF2-AS1 on epithelial-mesenchymal transition (EMT) of cervical cancer HeLa cell via regulating miR-140-5p/VEGFA (vascular endothelial growth factor A) axis. Methods: After cell culture and transfection, the cells were divided into 5 groups: NC group, miR-140-5p mimic group, miR-140-5p mimic+pcDNA-VEGFA group, si-lncRNA SBF2-AS1+pcDNA-VEGFA group and si-lncRNA SBF2-AS1+miR-140-5p mimic group. The expression level of lncRNA SBF2-AS1 in cervical cancer tissues and cell lines was detected by qPCR. The targeted relationship between lncRNA SBF2-AS1, miR-140-5p and VEGFA was confirmed by Dual luciferase reporter gene assay. The expression levels of VEGFA and EMT-related proteins N-cadherin, Vimentin and E-cadherin in HeLa cells were detected by WB. The invasion and migration of HeLa cells were detected by Transwell. Results: lncRNA SBF2-AS1 was highly expressed in cervical cancer tissues and cell lines (P<0.05 or P<0.01). Dual luciferase reporter gene assay confirmed that lncRNASBF2-AS1 targetedly combined with miR-140-5p and VEGFAwas a target gene of miR-140-5p (P< 0.05). Knockdown of lncRNA SBF2-AS1 inhibited invasion and migration as well as EMT of HeLa cells. Further experiment confirmed that lncRNA SBF2-AS1 up-regulated the expression level of VEGFA via miR-140-5p, thereby promoting invasion, migration and EMT of HeLa cells. Conclusion: lncRNASBF2-AS1 promotes EMT of HeLa cells via miR-140-5p/VEGFAaxis.
6.The associations between adenosine triphosphate binding cassette subfamily G member-2 single nucleotide polymorphism and hyperuricemia in a Chinese tertiary hospital faculty cohort
Bingqing ZHANG ; Weigang FANG ; Yun ZHANG ; Shufen LIU ; Xuejun ZENG
Chinese Journal of Internal Medicine 2017;56(11):833-838
Objective To investigate gender specific association between single nucleotide polymorphism rs2231142 and hyperuricemia .Method A matched case-control study was conducted in a faculty cohort of a tertiary hospital in Beijing .The enrollment criteria were faculty member of the hospital with signed consent .The exclusion criteria were tumor , previous renal diseases , renal function damage , pregnancy , currently taking medicines that could increase or decrease serum uric acid level , and those who had gout.Males with serum uric acid >416.4 μmol/L and females with serum uric acid >359.6 μmol/L were enrolled as hyperuricemia group .Subjects with normal serum uric acid were randomly enrolled at 1:2 ratio after matching for gender , age, renal function and body mass index .Rs2231142( C>A) was assayed by amplification refractory mutation system polymerase chain reaction , with common forward primer:5′GGCTTTGCAGACATCTATGG 3′, C specific reverse primer:5′CGAAGAGCTGCTGAGAAATG 3′, and A specific reverse primer:5′CGAAGAGCTGCTGAGAAATT 3′.Association between rs 2231142 and hyperuricemia was analyzed in the general study group , as well as different gender and age groups .Results A total of 198 subjects with hyperuricemia and 370 controls were enrolled .The A allele frequency of rs2231142 was significantly higher in the hyperuricemia group than control group (38.38% vs 26.62%, P<0.001), with an OR for hyperuricemia of 2.89 (95%CI 1.91-4.37, P<0.001).After adjustment for hypertension, hyperglycemia and dyslipidemia , the OR was 2.99 (95%CI 1.94 -4.62, P<0.001). Subgroup analysis showed that the ORs were 3.83 (95%CI 2.03-7.24, P<0.001) in male and 2.30 (95%CI 1.32-4.00, P=0.003) in female.In those 55 years or older, the gender differences of ORs were decreased, with ORs of 3.23 (95%CI 1.02-10.29, P=0.047) in male and 3.06 (95%CI 1.37-6.84, P=0.006) in female.While in those less than 55 years, the gender differences of ORs were enlarged, with ORs of 4.11 (95%CI 1.92-8.79, P<0.001) in males and 1.73 (95%CI 0.80-3.76, P=0.165) in females.Interaction study between gender and rs 2231142 did not reach significant level in both the gender group and two age groups . Conclusion Single nucleotide polymorphism rs 2231142 A allele is an independent risk factor for hyperuricemia in this tertiary hospital faculty cohort .The ORs are higher in male than those in female , especially in those less than 55 years old .
7.Experimental study of tumor-specific CTL induced by rmIL-18 treated on hepatocellular carcinoma
Xuguang MI ; Lei LIU ; Shouqing LI ; Haifeng WEI ; Shufen XU ; Yan TAN ; Yanqiu FANG
Chinese Journal of Immunology 2017;33(4):545-548
Objective:To research rmIL-18 in vitro culture system CCs induce tumor-specific cytotoxic T lymphocytes CTL and anti-tumor effect in mice.Methods:Used Stem SepTM immune magnetic cells separation method to culture mouse spleen NK cells,T cells and DCs,established culture systems in vitro;used of different approaches,different doses rmIL-18 to immunize HCC tumor-bearing mice,researched the effect of rmIL-18 on tumor growth rate and survival time.Results:rmIL-18 could induce and promote tumor-specific CTL-mediated killing effects in vitro culture system;tumor-specific CTL could significantly inhibit tumor growth(P<0.01) of and prolong the survival time of liver cancer tumor-bearing mice(P<0.01),and the effect was increased with rmIL-18 concentration increased(P<0.01),and intratumoral injection was superior to intraperitoneal injection(P<0.01).Conclusion:rmIL-18 can induce tumor-specific CTL in vitro and play a role in anti-liver cancer in mice.
8.Anti-tumor effect of rmIL-18 in mice with hepatocellular carcinoma
Yanqiu FANG ; Xuguang MI ; Shouqing LI ; Haifeng WEI ; Shufen XU ; Yan TAN
Journal of Jilin University(Medicine Edition) 2017;43(3):550-554
Objective:To investigate the effects of different doses and infusion methods of recombinant mouse interleukin-18(rmIL-18) on the survival time and tumor diameter of the mice with hepatocellular carcinoma,and to elucidate the rational application of rmIL-18 in vivo.Methods:A total of 60 Babl/C mice were randomly divided into 5 μg rmIL-18 intraperitoneal injection group,0.5 μg rmIL-18 intraperitoneal injection group,0.5 μg rmIL-18 tumor injection group,cytotoxic T lymphocyte(CTL) intraperitoneal injection group,CTL tumor injection group and saline control group;there were 10 mice in each group.From the 10th day of inoculation,the mice in different rmIL-18 groups were injected with the corresponding doses and methods.The mice in different CTL groups were injected with tumor-specific CTL (1×106/mouse) by intraperitoneal and intratumoral injection.The mice in saline control group were injected with an equal volume (100 μL) of saline,the injections were performed 10 times.The diameters of mice were measured weekly and the survival time was recorded.Results:Compared with 5 μg rmIL-18 intraperitoneal injection group,0.5 μg rmIL-18 intraperitoneal injection group and saline control group,the tumor growth rate of the mice in 0.5 μg rmIL-18 tumor injection group was decreased (P<0.01)and the survival rate of the mice was increased (P<0.01);compared with 0.5 μg rmIL-18 intraperitoneal injection group,the tumor growth rate and the survival rate of the mice in CTL intraperitoneal injection group were decreased (P<0.01);compared with 0.5 μg rmIL-18 tumor injection group,the tumor growth rate and the survival rate of the mice in CTL tumor injection group were decreased (P<0.01).Conclusion:The best way for rmIL-18 anti-tumor effect is tumor injection and the effect has a dose-dependent manner.
9.Exploration on the coaching of hematology clinical practice for undergraduate students of clinical medicine
Liangliang MA ; Xiuna SUN ; Shuming LU ; Yanxia LI ; Yan LU ; Shufen JIANG ; Meiyun FANG ; Jianling DU
Chinese Journal of Medical Education Research 2015;(9):937-940
[Abatract] In order to improve the result of clinical practice for undergraduate students of clinical medicine, combined with the professional characteristics of hematology and teaching syllabus, Hematology Department in the First Affiliated Hospital of Dalian Medical University developed practi-cal teaching content and tried using a variety of teaching methods and teaching means such as multi-media aided teaching, case teaching and simulation teaching method and so on. Besides, multiple station examination was established; teaching feedback and supervision were strengthened. The prac-tice proved that the reform measures were conducive to the cultivation of medical students' practical skills and clinical thinking, which helped to speed up the transformation from the students to the role of doctors.
10.Development and assessment of professional network teaching platform for nursing
Shufen YANG ; Shujie SUI ; Fang YU ; Liguo GAO ; Shujie SHI ; Dandan LI
Chinese Journal of Modern Nursing 2015;(24):2934-2936
Objective To develop a nursing network teaching platform gathered teaching, learning, interaction, inspectors, feedback and other advantages. Methods We designed and developed a network teaching platform to support the course learning of ‘Fundamental Nursing’, and questionnaire 72 Grade 2012 bachelor of nursing students to assess the effects of the network teaching platform. Results The network teaching platform acquired a high score of educational, scientific and usable aspects (3. 59 ± 0. 58), (3. 61 ± 0. 57) and (3. 58 ± 0. 60) among 72 students, as well as a high score at second-level indictor of assessment items. Conclusions The network teaching platform can broaden student′s knowledge reserve, and enhance autonomous initiative learning and quality of nursing education, so it achieves the predictive target.


Result Analysis
Print
Save
E-mail