1.Associations of systemic immune-inflammation index and systemic inflammation response index with maternal gestational diabetes mellitus: Evidence from a prospective birth cohort study.
Shuanghua XIE ; Enjie ZHANG ; Shen GAO ; Shaofei SU ; Jianhui LIU ; Yue ZHANG ; Yingyi LUAN ; Kaikun HUANG ; Minhui HU ; Xueran WANG ; Hao XING ; Ruixia LIU ; Wentao YUE ; Chenghong YIN
Chinese Medical Journal 2025;138(6):729-737
BACKGROUND:
The role of inflammation in the development of gestational diabetes mellitus (GDM) has recently become a focus of research. The systemic immune-inflammation index (SII) and systemic inflammation response index (SIRI), novel indices, reflect the body's chronic immune-inflammatory state. This study aimed to investigate the associations between the SII or SIRI and GDM.
METHODS:
A prospective birth cohort study was conducted at Beijing Obstetrics and Gynecology Hospital from February 2018 to December 2020, recruiting participants in their first trimester of pregnancy. Baseline SII and SIRI values were derived from routine clinical blood results, calculated as follows: SII = neutrophil (Neut) count × platelet (PLT) count/lymphocyte (Lymph) count, SIRI = Neut count × monocyte (Mono) count/Lymph count, with participants being grouped by quartiles of their SII or SIRI values. Participants were followed up for GDM with a 75-g, 2-h oral glucose tolerance test (OGTT) at 24-28 weeks of gestation using the glucose thresholds of the International Association of Diabetes and Pregnancy Study Groups (IADPSG). Logistic regression was used to analyze the odds ratios (ORs) (95% confidence intervals [CIs]) for the the associations between SII, SIRI, and the risk of GDM.
RESULTS:
Among the 28,124 women included in the study, the average age was 31.8 ± 3.8 years, and 15.76% (4432/28,124) developed GDM. Higher SII and SIRI quartiles were correlated with increased GDM rates, with rates ranging from 12.26% (862/7031) in the lowest quartile to 20.10% (1413/7031) in the highest quartile for the SII ( Ptrend <0.001) and 11.92-19.31% for the SIRI ( Ptrend <0.001). The ORs (95% CIs) of the second, third, and fourth SII quartiles were 1.09 (0.98-1.21), 1.21 (1.09-1.34), and 1.39 (1.26-1.54), respectively. The SIRI findings paralleled the SII outcomes. For the second through fourth quartiles, the ORs (95% CIs) were 1.24 (1.12-1.38), 1.41 (1.27-1.57), and 1.64 (1.48-1.82), respectively. These associations were maintained in subgroup and sensitivity analyses.
CONCLUSION
The SII and SIRI are potential independent risk factors contributing to the onset of GDM.
Humans
;
Female
;
Pregnancy
;
Diabetes, Gestational/immunology*
;
Prospective Studies
;
Adult
;
Inflammation/immunology*
;
Glucose Tolerance Test
;
Birth Cohort
2.Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood.
Juan YE ; Feng YE ; Ling HOU ; Wei WU ; Xiao-Ping LUO ; Yan LIANG
Chinese Journal of Contemporary Pediatrics 2025;27(1):94-100
OBJECTIVES:
To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.
METHODS:
A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.
RESULTS:
All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.
CONCLUSIONS
This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Male
;
Female
;
Child
;
Retrospective Studies
;
Glucokinase/genetics*
;
Adolescent
;
Child, Preschool
;
Glucose Tolerance Test
3.N6-methyladenosine modification and skin diseases.
Ling JIANG ; Yibo HU ; Jing CHEN
Journal of Central South University(Medical Sciences) 2025;50(3):382-395
Currently, research on N6-methyladenine (m6A) is extensive in the field of oncology, while studies involving m6A and skin diseases remain relatively limited. Based on existing reports, we searched PubMed and Web of Science for literature related to m6A and dermatological conditions. Analysis of citation counts and journal impact factors revealed a significant upward trend in the volume of m6A-related research. Term frequency analysis of titles and abstracts indicated that studies mainly focus on skin tumors and inflammatory or immune-related skin diseases, particularly melanoma, psoriasis, and skin development. Transcriptomic data from the Gene Expression Omnibus (GEO) were analyzed, revealing differential expression of m6A-related genes in 4 types of skin tumors (including squamous cell carcinoma and basal cell carcinoma) as well as in inflammatory skin diseases such as psoriasis and atopic dermatitis, and potential mechanisms of action were also explored. Findings suggest that m6A modifications exhibit heterogeneity between neoplastic and non-neoplastic skin diseases. However, the regulatory mechanisms of m6A dynamic modifications on key genes involved in dermatological disorders remain unclear and warrant further investigation.
Humans
;
Skin Neoplasms/metabolism*
;
Skin Diseases/metabolism*
;
Adenosine/genetics*
;
Psoriasis/genetics*
;
Carcinoma, Squamous Cell/genetics*
;
Carcinoma, Basal Cell/genetics*
;
Melanoma/genetics*
4.Evaluating serum endosialin (CD248) levels as a diagnostic marker in gestational diabetes.
Tevfik Berk BILDACI ; Can ATA ; Ufuk ATLIHAN ; Huseyin Aytug AVSAR ; Selcuk ERKILINC
Journal of the ASEAN Federation of Endocrine Societies 2025;40(2):65-68
OBJECTIVES
Gestational diabetes mellitus (GDM), a pregnancy-induced hyperglycemia, affects approximately 17% of pregnancies globally. Its pathophysiology remains unclear, with inflammation and vascular remodeling playing key roles. CD248, a glycoprotein linked to inflammation and vascular remodeling, has been implicated in various conditions, but its role in GDM is uncertain.
METHODOLOGYA prospective case-control study was conducted with 169 pregnant women aged 18 to 49 at a tertiary hospital. Serum CD248 levels were assessed at 24 to 28 weeks of gestation prior to the oral glucose tolerance test (OGTT). Statistical analyses evaluated the association between CD248 levels, BMI and GDM status.
RESULTSOf the participants, 32 (18.9%) were diagnosed with GDM. CD248 levels were lower in GDM patients (8.15 ± 10.16 ng/mL) than in controls (11.42 ± 15.44 ng/mL), but the difference was not statistically significant (p = 0.084). Although CD248 levels did not correlate with OGTT values, it was positively associated with BMI (pCONCLUSION
Unlike earlier findings associating elevated CD248 levels with early pregnancy GDM risk, this study found no significant relationship during later gestational stages. These results highlight a potentially complex and context-dependent role for CD248 in GDM pathophysiology.
Human ; Diabetes, Gestational ; Inflammation ; Glucose Tolerance Test
5.Research progress on automated insulin delivery system in the field of diabetes management.
Zhichao YU ; Yufan SUN ; Zhijian HUANG ; Zhanhong LI ; Jianjun LONG ; Zhigang ZHU
Journal of Biomedical Engineering 2024;41(6):1279-1285
Diabetes and its complications pose a serious threat to human life and health. It has become a public health problem of wide concern worldwide. Currently, diabetes is mainly treated with insulin injection in clinic. However, manual insulin injection still has many shortcomings. In recent years, with the deepening of research, it has been found that an automated insulin delivery system (AID), which combines a continuous glucose monitoring device with an insulin pump, can significantly improve the effectiveness of diabetes treatment and reduce the incidence of complications in patients. This paper firstly introduces the composition of the AID system and its working principle, and then details the development history and current status of the related technologies from the aspects of continuous glucose monitoring technology, insulin pumps and the development of closed-loop control algorithms, etc. Finally, this paper looks forward to the application prospect and future development of AID system in the field of diabetes treatment, providing theoretical reference for further research.
Humans
;
Insulin Infusion Systems
;
Insulin/administration & dosage*
;
Blood Glucose Self-Monitoring/instrumentation*
;
Diabetes Mellitus/drug therapy*
;
Algorithms
;
Hypoglycemic Agents/administration & dosage*
;
Blood Glucose/analysis*
;
Pancreas, Artificial
;
Automation
6.Effect of maternal iodine excess during pregnancy on neonatal thyroid function and neurodevelopmental status at 12 weeks
Deepashree K Rao ; Ankur Jindal ; Aashima Dabas ; Haseena Sait ; Sangeeta Yadav ; Seema Kapoor
Journal of the ASEAN Federation of Endocrine Societies 2024;39(2):27-32
Objective:
This study aims to determine the effect of iodine excess in pregnant mothers on thyroid function, growth and neurodevelopment in the neonates when assessed at 12 weeks of age.
Methodology:
This prospective study enrolled term neonates with birth weight >2500 gm of mothers having urine iodine concentration (UIC) ≥500 µg/L documented in the third trimester of the peripartum period. Neonatal TSH was collected by heel prick on dried blood spots within 24-72 hours of age and measured by time-resolved fluroimmunoassay. Neonates with TSH ≥11 mIU/L at birth were followed up at 2 and 12 weeks to monitor thyroid dysfunction, growth and development.
Results:
A total of 2354 (n = 1575 in the delivery room) maternal urine samples were collected of which 598 (25.4%) had elevated UIC. Forty-nine (12.2%) neonates had TSH ≥11mIU/L on newborn screening of whom 18 and 3 neonates had residual elevated TSH at 2 and 12 weeks of life, respectively. Maternal iodine levels correlated weakly with TSH at 2 weeks (rho = 0.299; p = 0.037). No child required treatment for congenital hypothyroidism. Eight babies additionally had TSH >5 mIU/L at 12 weeks of life. The growth and development of babies with or without TSH elevation was comparable at three months (p > 0.05).
Conclusion
Maternal iodine excess in pregnancy and peripartum period causes transient hyperthyrotropinemia in neonates that did not affect the growth and development at 3 months of age.
Thyroid
;
Thyroid Gland
;
Hypothyroidism
;
Thyroid Function Tests
7.A systematic review of the accuracy of Insulin and C-peptide secretion ratios during the oral glucose tolerance test to diagnose insulinoma
Fransiskus Mikael Chandra ; Dicky Tahapary
Journal of the ASEAN Federation of Endocrine Societies 2024;39(1):79-83
Background:
Insulinoma is one of the causes of recurrent hypoglycemia, one of the chief complaints for emergency department admission. The gold standard in diagnosing insulinoma is a 72-hour fasting test which is inconvenient and inefficient as it requires hospitalization. Research has found that measurement of insulin and C-peptide during OGTT may help diagnose insulinoma. We aimed to assess the diagnostic value of OGTT in diagnosing insulinoma.
Methodology:
The literature search was conducted on 19 August 2022 using several databases (MEDLINE, Scopus, Embase, and ScienceDirect). All studies that measured OGTT as diagnostic tools in diagnosing insulinoma and 72-hour fasting test as reference standard were included. The quality assessment of the selected studies was based on the Centre of Evidence-Based Medicine University of Oxford and the Quality Assessment of Diagnostic Accuracy-2 tool (QUADAS-2). Analysis of the included studies was performed qualitatively. This study was registered on PROSPERO (CRD42022360205).
Results:
A total of two case-control studies (106 patients) were included, which were at risk of bias and low concern of applicability. Both studies demonstrated that the combination of insulin and C-peptide levels measured during OGTT had high specificity, sensitivity, positive predictive value, and negative predictive value in diagnosing insulinoma compared to the reference standard. A logistic regression model of 8.305 – (0.441 × insulin 2-h/0-h) – (1.679 × C-peptide 1-h/0-h) > 0.351 has the highest diagnostic value in one study (AUC 0.97, Sensitivity 86.5%, Specificity 95.2%, PPV 94.1, NPV 88.9).
Conclusion
The measurement of 0-h and 2-h insulin and C-peptide levels during 2-h OGTT was found in two small case-control studies with a total of 106 patients to have good sensitivity and specificity. However, due to these limitations, future research is still needed to validate the potential use of OGTT for the diagnosis of insulinoma.
Insulinoma
;
Glucose Tolerance Test
8.Effectiveness of smartphone applications in achieving glycemic control among adult diabetic patients: A meta-analysis.
Eron Allen C. Tan ; Janella Jillian G. Abella ; Marie Ruth A. Echavez
The Filipino Family Physician 2024;62(1):145-154
BACKGROUND
Diabetes Mellitus Type 2 is a significant global health issue with a high prevalence in the Philippines. Managing this condition effectively is crucial, and digital technologies, particularly smartphone (mHealth) applications, have emerged as a potential tool in diabetes self-management.
OBJECTIVEThis study evaluated the effectiveness of smartphone (mHealth) application use in achieving glycemic control among adults with Type 2 Diabetes Mellitus, focusing on HbA1c levels and medication adherence.
METHODThis systematic review and meta-analysis, adhering to PRISMA guidelines, analyzed randomized controlled trials from databases like PubMed and Embase, comparing interventions using mHealth applications with standard care. The primary measures were HbA1c levels and medication adherence.
RESULTSTen studies involving 20,984 participants were included in the meta-analysis. Using mHealth applications led to an average HbA1c reduction of 0.36%, indicating improved glycemic control. There was considerable heterogeneity (I2 = 91%) because of the clinical and methodological diversity of the included studies. Subgroup analysis showed that the younger and older age groups, shorter and longer T2DM duration, and lower and higher HbA1c baseline benefited from its use. Sensitivity analysis still showed high heterogeneity (95%-97%), reflecting clinical diversity. A narrative analysis of two studies highlighted the utility of mHealth applications in tracking diet, physical activity, and vital stats, aiding medication adherence through reminders and data sharing with healthcare providers.
CONCLUSION/RECOMMENDATIONSThis systematic review and meta-analysis showed the effectiveness of mHealth application use in achieving glycemic control among adults with Type 2 Diabetes Mellitus by improving HbA1c levels and medication adherence. Integrating mHealth applications as adjuncts in family and community medicine as part of personalized care for managing type 2 diabetes in the Philippines can help achieve glycemic control and medication adherence. Future studies should focus on longitudinal assessments, exploring cultural and linguistic factors in the Filipino context to optimize diabetes care within this specialized medical framework.
Blood Glucose Self-monitoring ; Mobile Applications ; Diabetes Mellitus
9.Research progress on minimally invasive and non-invasive blood glucose detection methods.
Xinyu GAO ; Zekai XU ; Liqun CHEN
Journal of Biomedical Engineering 2023;40(2):365-372
Blood glucose monitoring has become the weakest point in the overall management of diabetes in China. Long-term monitoring of blood glucose levels in diabetic patients has become an important means of controlling the development of diabetes and its complications, so that technological innovations in blood glucose testing methods have far-reaching implications for accurate blood glucose testing. This article discusses the basic principles of minimally invasive and non-invasive blood glucose testing assays, including urine glucose assays, tear assays, methods of extravasation of tissue fluid, and optical detection methods, etc., focuses on the advantages of minimally invasive and non-invasive blood glucose testing methods and the latest relevant results, and summarizes the current problems of various testing methods and prospects for future development trends.
Humans
;
Blood Glucose
;
Blood Glucose Self-Monitoring/methods*
;
Diabetes Mellitus/diagnosis*
;
Monitoring, Physiologic/methods*
;
Tears
10.Continuous Blood Glucose Monitoring:Technological Progress and Application Extension.
Chinese Journal of Medical Instrumentation 2023;47(4):424-427
Continuous glucose monitoring (CGM) technology developed rapidly in recent years, and new products came out all the time. Nowadays, CGM plays an important role in diabetes management and has been recommended by various guideline all over the world. CGM equipment classification, progress on glucose sensor technology, and the new application and expansion of CGM technology in the field of diabetes and non-diabetes were briefly introduced in the study.
Humans
;
Diabetes Mellitus, Type 1
;
Blood Glucose
;
Blood Glucose Self-Monitoring
;
Technology


Result Analysis
Print
Save
E-mail