OBJECTIVES

In Asia, younger individuals (below age 45) are diagnosed to have type 2 diabetes with increased rates of obesity defined by lower BMI yet with greater visceral adiposity (waist circumference and waisthip ratios). The prevalence data on type 1 diabetes is not well established, considered to be low, but is seen to be increasing as well. This changing phenotype therefore, presents a clinical dilemma in terms of correctly classifying diabetes and deciding on the consequent appropriate treatment. Distinguishing type 1 from type 2 diabetes has become more difficult with type 2 diabetes dramatically increasing in young adults and children. This study aims to define the characteristics of diabetes among young adults in the Philippines to provide a basis for appropriate management amidst changes in diabetes phenotypes seen globally.

METHODS

In this cross-sectional analytic study, we characterized the demographic, metabolic, and autoimmune features of diabetes among young adult Filipinos aged 18 to 45 years old consulting at a tertiary referral center in Manila, Philippines. Baseline serum A1c, FBS, 75-g oral glucose tolerance test, insulin, serum C-peptide, insulin autoantibodies, leptin, adiponectin, lipid profile, and thyroid function tests were obtained from the participants and analyzed. The homeostasis model assessment (HOMA) was used to estimate the insulin sensitivity.

RESULTS

A total of 348 patients with diabetes were included, with females comprising two-thirds of the participants. The mean age at diagnosis of diabetes was 35.9±7.22 years. The mean BMI was 28.12 kg/m2, with median waist to hip ratio (WHR) of 0·93. Metabolic syndrome was found in 60% of participants and 67.82% were obese by body mass index. The mean A1c was 9.07±2.52%. Good glucose control (A1c less than 7.0%) was seen in 23% of participants  while nearly half (48%) had HbA1c which was >9.0%. The median levels of fasting insulin and C-peptide were 12.62 (range 1.33–90.42) mIU/L and 0.78 ng/mL (range 0–16.2), respectively. 

Included participants were diagnosed with diabetes within a year and as such, majority did not have any micro- or macrovascular complications. The most common diabetes complication was sensory neuropathy detected by monofilament testing, which was found in 28% of participants, followed by non-proliferative diabetic retinopathy in 13%. A history of previous diabetic ketoacidosis was found in 10 patients (2.87%). Glutamic acid decarboxylase (GAD) and insulin auto-antibodies were found in 3.2% and 19.3% of participants, respectively. Approximately half (51.73%) of the participants were insulin resistant by HOMA-IR.

CONCLUSION

In contrast with Caucasians and other Asians, diabetes among young Filipino adults is associated with lower BMI but with a similarly high visceral adiposity as shown by an elevated WHR. Metabolic syndrome with insulin resistance as defined by a variety of indices is predominant. Type 1 diabetes with autoantibodies occur in only a small fraction of this population. Data derived from this work can provide a framework for cluster analysis towards personalized management specific to this population.

Human ; Acids ; Adiponectin ; Adiposity ; Adult ; Aged ; Antibodies ; Asia ; Asian ; Asian Continental Ancestry Group ; Autoantibodies ; Body Mass Index ; C-peptide ; Carboxy-lyases ; Child ; Cluster Analysis ; Demography ; Diabetes Complications ; Diabetes Mellitus ; Diabetes Mellitus, Type 1 ; Diabetes Mellitus, Type 2 ; Diabetic Ketoacidosis ; Diabetic Retinopathy ; Diagnosis ; Fasting ; Female ; Glucose ; Glucose Tolerance Test ; Glutamate Decarboxylase ; Glutamic Acid ; Insulin ; Insulin Resistance ; Ketosis ; Leptin ; Lipids ; Metabolic Syndrome ; Obesity ; Patients ; Peptides ; Phenotype ; Philippines ; Population ; Prevalence ; Serum ; Therapeutics ; Thyroid Gland ; Thyroid Function Tests ; Young Adult

Introduction: Prediabetes or intermediate hyperglycemia (IH) represents a critical phase in the trajectory toward type 2 diabetes mellitus (T2DM). Recent evidence from the International Diabetes Federation (IDF) suggests that 1-hour OGTT (1HOGTT) ≥8.6 mmol/L is a more sensitive biomarker for early beta-cell dysfunction, with enhanced detection of IH and future T2DM risk. Conventional screening using hemoglobin A1c (HbA1c) or 2-Hour OGTT (2HOGTT) may delay identification of prediabetes, narrowing the window for early intervention. This study evaluates 1HOGTT as a screening tool for prediabetes among Malaysians. Methodology: This cross-sectional study enrolled adults without prior T2DM or prediabetes. Participants underwent 1HOGTT, 2HOGTT, and HbA1c, classified as per the Malaysian Clinical Practice Guideline for T2DM (6th Edition) and IDF 2024 criteria. Agreement between tests was assessed using McNemar’s test and Cohen’s kappa. Diagnostic accuracy was evaluated via receiver operating characteristic (ROC) curve analysis. Cost-effectiveness was determined using reagent cost only. Results: The majority of the 310 participants were female (71.6%), Malay (87.1%), with average age of 40. The 1HOGTT identified prediabetes in 21.6% (n = 67) compared to 17.1% (n = 53) by HbA1c and 2.6% (n = 8) by 2HOGTT. McNemar’s test confirmed statistically significant discordance between 1HOGTT and 2HOGTT (chi-square = 53.397, p <0.001): 61 participants were prediabetic by 1HOGTT but normal by 2HOGTT, versus only 2 in the reverse direction. No significant discordance was found between 1HOGTT and HbA1c (chi-square = 2.817, p = 0.093). 1HOGTT demonstrated excellent discriminatory ability against 2HOGTT (AUC = 0.908; 95% CI: 0.837–0.978), significantly outperforming HbA1c (AUC = 0.664; CI: 0.462– 0.867; DeLong p = 0.012). In a population-level cost analysis, 1HOGTT achieved lowest cost per prediabetes case detected (RM 5.79) – approximately 8.3 times and 8.1 times more cost-effective than 2HOGTT (RM 48.08) and HbA1c (RM 46.78) respectively. Conclusion 1HOGTT identifies a significant proportion of individuals with prediabetes missed by 2HOGTT and HbA1c. Incorporating 1HOGTT enhances the detection of prediabetes, is cost-effective, and enables timely preventive measures in our population with high diabetes burden.
Glucose Tolerance Test ; Glycated Hemoglobin ; Prediabetic State

Introduction: Malaysia has one of the highest diabetes prevalence rates in Asia (1 in 5), with >50% fail to achieve optimal glycemic control. Continuous glucose monitoring (CGM) provides detailed insights beyond hemoglobin A1c (HbA1c), capturing daily glucose fluctuations and variability. Realworld data describing CGM patterns and their clinical associations in Malaysian adults with type 2 diabetes mellitus (T2DM) are limited. Methodology: This cross-sectional study analyzed CGM data from 25 Malaysian adults with T2DM, standardized over 14 days. CGM metrics included time in range (TIR), time above range (TAR), time below range (TBR), mean glucose, and coefficient of variation (CV). Weekday–weekend comparisons were performed, and correlations with age, diabetes duration, HbA1c, body mass index (BMI), treatment regimen, and complications were assessed. Results: Participants had a mean age of 56.2 ± 13.2 years (52% male), mean HbA1c 9.4 ± 2.7%, diabetes duration 10.7 ± 9.0 years, and BMI 29.8 ± 9.4 kg/m². Mean TIR, TAR, TBR, mean glucose, and CV were similar between weekdays and weekends (p >0.34 for all). TIR >70% was achieved by 52% of participants on weekdays and 48% on weekends, with no statistically significant difference (p = 0.75). Longer diabetes duration correlated with lower TIR (r = −0.62, p <0.001), higher mean glucose (r = 0.58, p = 0.002), and greater variability (r = 0.54, p = 0.004). Older age was associated with lower TIR (r = −0.48, p = 0.014) and higher mean glucose (r = 0.44, p = 0.025). Higher HbA1c correlated with lower TIR (r = −0.36, p = 0.04), higher TAR (r = 0.35, p = 0.05), greater variability (r = 0.51, p = 0.006), and increased target organ damage (ρ = 0.55, p = 0.004). BMI was not associated with TIR (r = −0.18, p = 0.38). Participants with ≥2 complications had lower TIR (55.8 ± 28.4% vs 76.7 ± 19.2%, p = 0.073), while insulin the Conclusion In Malaysian adults with T2DM, CGM metrics were similar between weekdays and weekends, indicating lifestyle differences had minimal impact on glycemic control. Longer diabetes duration, older age, higher HbA1c, multiple complications, and insulin therapy identified patients at highest risk for poor glycemic control, greater variability, and hypoglycemia. These findings support the use of CGM for risk stratification, individualized monitoring, and therapy optimization to reduce complications and hypoglycemia risk.
Adult ; Blood Glucose ; Blood Glucose Self-Monitoring ; Continuous Glucose Monitoring ; Diabetes Mellitus, Type 2

Introduction: A common diagnostic error is the tendency to attribute new symptoms directly to the most obvious laboratory abnormality. In pregnancy, a suppressed thyroidstimulating hormone (TSH) with elevated free T4 is frequently presumed to indicate primary hyperthyroidism, overlooking the possibility of benign gestational transient thyrotoxicosis (GTT). We report a case where this pattern led to the misattribution of acute flaccid paralysis to thyrotoxic periodic paralysis, critically delaying the diagnosis of Guillain-Barré syndrome (GBS). Case: A 21-year-old female Malay primigravida at 19 weeks and 5 days presented with a 2-week history of progressive, descending bilateral lower limb weakness culminating in paralysis, associated with vomiting and 5 kg weight loss. On admission, she was febrile (38.0°C) and tachycardic (150 bpm). Neurological examination revealed proximalpredominant flaccid paralysis and hyporeflexia with intact sensation, without thyroid eye signs or goiter. Thyroid function tests showed profound thyrotoxicosis (TSH <0.005 mIU/L, free thyroxine 4 20.16 pmol/L) with hypokalemia (2.9 mmol/L). A neck ultrasound was normal. A provisional diagnosis of thyrotoxic periodic paralysis with impending storm was made, leading to treatment with potassium replacement, propylthiouracil, and hydrocortisone. Despite biochemical improvement, her paralysis persisted. On day 5, she developed acute bulbar palsy and respiratory failure requiring intubation. A subsequent comprehensive workup for infectious, autoimmune (including thyroid antibodies), and nutritional causes was unremarkable. Nerve conduction studies confirmed the acute motor axonal neuropathy (AMAN) variant of GBS. Treatment with a 5-day course of intravenous immunoglobulin resulted in neurological improvement and successful extubation. Conclusion This case highlights the critical pitfall of prematurely attributing acute neurological deficits to abnormal thyroid function tests in pregnancy. Biochemical thyrotoxicosis, including GTT, should not preclude urgent evaluation for life-threatening neurological conditions such as GBS, particularly when weakness is progressive or refractory to metabolic correction.
Female ; Pregnancy ; Thyroid Function Tests

Introduction: ISPAD guidelines recommend continuous glucose monitoring (CGM) as the standard of care for paediatric type 1 diabetes (T1DM). However, a “real-world” adoption gap persists, particularly in resource-limited settings. The Introductions of the study were to evaluate CGM adoption prevalence, identify documented barriers, and compare glycemic outcomes between active and non-active users. Methodology: This retrospective review analyzed electronic medical records (EMR) of 125 paediatric T1DM patients at Hospital Putrajaya (2025). Data included CGM status, insulin delivery method, and documented barriers. Independent T-tests compared mean hemoglobin A1c (HbA1c) between groups, and multivariable logistic regression identified independent predictors of adoption. Results: Cohort mean age was 11.8 ± 3.8 years. Active CGM users were 32.8% (n = 41), of whom 29.3% (n = 12) utilized predominantly automated insulin delivery (AID) systems. The remaining 67.2% (n = 84) were classified as non-active users, comprising both never-users and ex-users (discontinued use). Active users achieved significantly lower mean HbA1c than non-active users (8.73% vs 9.86%; p <0.001), with no significant difference in rates of DKA (p = 0.564) or severe hypoglycemia (p = 0.250). Among never-users, 42.9% lacked documented technology counselling (p = 0.001). Multivariable analysis identified funding source as the sole independent predictor of CGM adoption (adjusted OR = 7.76, p <0.001). While the primary documented barrier was financial (31.0%), a lack of documented barriers was noted in 61.9% of non-active users. Conclusion A substantial technology gap exists, primarily driven by financial access rather than clinical demographics. The difference of 1.13% in HbA1c between groups underscores the need to address financial setbacks to improve technology access in Malaysia and prevent diabetes complications.
Child ; Blood Glucose ; Blood Glucose Self-Monitoring ; Continuous Glucose Monitoring ; Diabetes Mellitus, Type 1

Currently, research on N⁶-methyladenine (m⁶A) is extensive in the field of oncology, while studies involving m⁶A and skin diseases remain relatively limited. Based on existing reports, we searched PubMed and Web of Science for literature related to m⁶A and dermatological conditions. Analysis of citation counts and journal impact factors revealed a significant upward trend in the volume of m⁶A-related research. Term frequency analysis of titles and abstracts indicated that studies mainly focus on skin tumors and inflammatory or immune-related skin diseases, particularly melanoma, psoriasis, and skin development. Transcriptomic data from the Gene Expression Omnibus (GEO) were analyzed, revealing differential expression of m⁶A-related genes in 4 types of skin tumors (including squamous cell carcinoma and basal cell carcinoma) as well as in inflammatory skin diseases such as psoriasis and atopic dermatitis, and potential mechanisms of action were also explored. Findings suggest that m⁶A modifications exhibit heterogeneity between neoplastic and non-neoplastic skin diseases. However, the regulatory mechanisms of m⁶A dynamic modifications on key genes involved in dermatological disorders remain unclear and warrant further investigation.
Humans ; Skin Neoplasms/metabolism* ; Skin Diseases/metabolism* ; Adenosine/genetics* ; Psoriasis/genetics* ; Carcinoma, Squamous Cell/genetics* ; Carcinoma, Basal Cell/genetics* ; Melanoma/genetics*

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVES

Gestational diabetes mellitus (GDM), a pregnancy-induced hyperglycemia, affects approximately 17% of pregnancies globally. Its pathophysiology remains unclear, with inflammation and vascular remodeling playing key roles. CD248, a glycoprotein linked to inflammation and vascular remodeling, has been implicated in various conditions, but its role in GDM is uncertain.

METHODOLOGY

A prospective case-control study was conducted with 169 pregnant women aged 18 to 49 at a tertiary hospital. Serum CD248 levels were assessed at 24 to 28 weeks of gestation prior to the oral glucose tolerance test (OGTT). Statistical analyses evaluated the association between CD248 levels, BMI and GDM status.

RESULTS

Of the participants, 32 (18.9%) were diagnosed with GDM. CD248 levels were lower in GDM patients (8.15 ± 10.16 ng/mL) than in controls (11.42 ± 15.44 ng/mL), but the difference was not statistically significant (p = 0.084). Although CD248 levels did not correlate with OGTT values, it was positively associated with BMI (pCONCLUSION

Unlike earlier findings associating elevated CD248 levels with early pregnancy GDM risk, this study found no significant relationship during later gestational stages. These results highlight a potentially complex and context-dependent role for CD248 in GDM pathophysiology.

Human ; Diabetes, Gestational ; Inflammation ; Glucose Tolerance Test

BACKGROUND: The role of inflammation in the development of gestational diabetes mellitus (GDM) has recently become a focus of research. The systemic immune-inflammation index (SII) and systemic inflammation response index (SIRI), novel indices, reflect the body's chronic immune-inflammatory state. This study aimed to investigate the associations between the SII or SIRI and GDM. METHODS: A prospective birth cohort study was conducted at Beijing Obstetrics and Gynecology Hospital from February 2018 to December 2020, recruiting participants in their first trimester of pregnancy. Baseline SII and SIRI values were derived from routine clinical blood results, calculated as follows: SII = neutrophil (Neut) count × platelet (PLT) count/lymphocyte (Lymph) count, SIRI = Neut count × monocyte (Mono) count/Lymph count, with participants being grouped by quartiles of their SII or SIRI values. Participants were followed up for GDM with a 75-g, 2-h oral glucose tolerance test (OGTT) at 24-28 weeks of gestation using the glucose thresholds of the International Association of Diabetes and Pregnancy Study Groups (IADPSG). Logistic regression was used to analyze the odds ratios (ORs) (95% confidence intervals [CIs]) for the the associations between SII, SIRI, and the risk of GDM. RESULTS: Among the 28,124 women included in the study, the average age was 31.8 ± 3.8 years, and 15.76% (4432/28,124) developed GDM. Higher SII and SIRI quartiles were correlated with increased GDM rates, with rates ranging from 12.26% (862/7031) in the lowest quartile to 20.10% (1413/7031) in the highest quartile for the SII ( Ptrend <0.001) and 11.92-19.31% for the SIRI ( Ptrend <0.001). The ORs (95% CIs) of the second, third, and fourth SII quartiles were 1.09 (0.98-1.21), 1.21 (1.09-1.34), and 1.39 (1.26-1.54), respectively. The SIRI findings paralleled the SII outcomes. For the second through fourth quartiles, the ORs (95% CIs) were 1.24 (1.12-1.38), 1.41 (1.27-1.57), and 1.64 (1.48-1.82), respectively. These associations were maintained in subgroup and sensitivity analyses. CONCLUSION The SII and SIRI are potential independent risk factors contributing to the onset of GDM.
Humans ; Female ; Pregnancy ; Diabetes, Gestational/immunology* ; Prospective Studies ; Adult ; Inflammation/immunology* ; Glucose Tolerance Test ; Birth Cohort

BACKGROUND: The prevalence of pre-diabetes and diabetes mellitus type 2 (DMT2) among Filipinos exceeds 20%. Progressive loss of insulin sensitivity can occur with fasting blood sugar (FBS) ≥90 mg/dL. Studies among Asians with pre- diabetes show a higher prevalence of DMT2 diagnosed by 75 g oral glucose tolerance test (OGTT), the gold standard, which remains underutilized. OBJECTIVE: This prospective, observational, single-center study included adult patients admitted between January 2022 to August 2022 who were diagnosed with ARF type 1 and/or 2 and who were hooked to NIV as oxygen supplementation. METHODOLOGY: This cross-sectional analysis was conducted in the outpatient departments of two hospitals in Cebu City. Ninety-five adult Filipino patients with FBS < 126 mg/dL but with risk factors for DMT2 had HbA1c and 75 g OGTT taken. Test performance and receiver operating characteristic curves were computed for the optimal FBS and HbA1c threshold. RESULTS: Pre-diabetes or DMT2 was prevalent among 66% of participants. Using 75 g OGTT, 23% reached levels indicative of DMT2 but had normal or impaired fasting glucose, while this was found in 20% with pre-diabetic glycated hemoglobin (HbA1c) levels. HbA1c was more accurate than FBS. CONCLUSION Performing 75 g OGTT for high-risk Filipinos with FBS ≥94.2 mg/dL or HbA1c ≥5.6% is highly predictive of a change in glucose tolerance status to pre-diabetes, while an FBS ≥106 mg/dL or HbA1c ≥5.8% is predictive of DMT2. Lower cut-off levels promote earlier detection and intervention. Hypertension and age ≥35 years old were significantly associated with such conditions.
Human ; Diabetes Mellitus ; Prediabetic State ; Glycated Hemoglobin ; Glucose Tolerance Test