1.Associations of systemic immune-inflammation index and systemic inflammation response index with maternal gestational diabetes mellitus: Evidence from a prospective birth cohort study.
Shuanghua XIE ; Enjie ZHANG ; Shen GAO ; Shaofei SU ; Jianhui LIU ; Yue ZHANG ; Yingyi LUAN ; Kaikun HUANG ; Minhui HU ; Xueran WANG ; Hao XING ; Ruixia LIU ; Wentao YUE ; Chenghong YIN
Chinese Medical Journal 2025;138(6):729-737
BACKGROUND:
The role of inflammation in the development of gestational diabetes mellitus (GDM) has recently become a focus of research. The systemic immune-inflammation index (SII) and systemic inflammation response index (SIRI), novel indices, reflect the body's chronic immune-inflammatory state. This study aimed to investigate the associations between the SII or SIRI and GDM.
METHODS:
A prospective birth cohort study was conducted at Beijing Obstetrics and Gynecology Hospital from February 2018 to December 2020, recruiting participants in their first trimester of pregnancy. Baseline SII and SIRI values were derived from routine clinical blood results, calculated as follows: SII = neutrophil (Neut) count × platelet (PLT) count/lymphocyte (Lymph) count, SIRI = Neut count × monocyte (Mono) count/Lymph count, with participants being grouped by quartiles of their SII or SIRI values. Participants were followed up for GDM with a 75-g, 2-h oral glucose tolerance test (OGTT) at 24-28 weeks of gestation using the glucose thresholds of the International Association of Diabetes and Pregnancy Study Groups (IADPSG). Logistic regression was used to analyze the odds ratios (ORs) (95% confidence intervals [CIs]) for the the associations between SII, SIRI, and the risk of GDM.
RESULTS:
Among the 28,124 women included in the study, the average age was 31.8 ± 3.8 years, and 15.76% (4432/28,124) developed GDM. Higher SII and SIRI quartiles were correlated with increased GDM rates, with rates ranging from 12.26% (862/7031) in the lowest quartile to 20.10% (1413/7031) in the highest quartile for the SII ( Ptrend <0.001) and 11.92-19.31% for the SIRI ( Ptrend <0.001). The ORs (95% CIs) of the second, third, and fourth SII quartiles were 1.09 (0.98-1.21), 1.21 (1.09-1.34), and 1.39 (1.26-1.54), respectively. The SIRI findings paralleled the SII outcomes. For the second through fourth quartiles, the ORs (95% CIs) were 1.24 (1.12-1.38), 1.41 (1.27-1.57), and 1.64 (1.48-1.82), respectively. These associations were maintained in subgroup and sensitivity analyses.
CONCLUSION
The SII and SIRI are potential independent risk factors contributing to the onset of GDM.
Humans
;
Female
;
Pregnancy
;
Diabetes, Gestational/immunology*
;
Prospective Studies
;
Adult
;
Inflammation/immunology*
;
Glucose Tolerance Test
;
Birth Cohort
2.Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood.
Juan YE ; Feng YE ; Ling HOU ; Wei WU ; Xiao-Ping LUO ; Yan LIANG
Chinese Journal of Contemporary Pediatrics 2025;27(1):94-100
OBJECTIVES:
To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.
METHODS:
A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.
RESULTS:
All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.
CONCLUSIONS
This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Male
;
Female
;
Child
;
Retrospective Studies
;
Glucokinase/genetics*
;
Adolescent
;
Child, Preschool
;
Glucose Tolerance Test
3.N6-methyladenosine modification and skin diseases.
Ling JIANG ; Yibo HU ; Jing CHEN
Journal of Central South University(Medical Sciences) 2025;50(3):382-395
Currently, research on N6-methyladenine (m6A) is extensive in the field of oncology, while studies involving m6A and skin diseases remain relatively limited. Based on existing reports, we searched PubMed and Web of Science for literature related to m6A and dermatological conditions. Analysis of citation counts and journal impact factors revealed a significant upward trend in the volume of m6A-related research. Term frequency analysis of titles and abstracts indicated that studies mainly focus on skin tumors and inflammatory or immune-related skin diseases, particularly melanoma, psoriasis, and skin development. Transcriptomic data from the Gene Expression Omnibus (GEO) were analyzed, revealing differential expression of m6A-related genes in 4 types of skin tumors (including squamous cell carcinoma and basal cell carcinoma) as well as in inflammatory skin diseases such as psoriasis and atopic dermatitis, and potential mechanisms of action were also explored. Findings suggest that m6A modifications exhibit heterogeneity between neoplastic and non-neoplastic skin diseases. However, the regulatory mechanisms of m6A dynamic modifications on key genes involved in dermatological disorders remain unclear and warrant further investigation.
Humans
;
Skin Neoplasms/metabolism*
;
Skin Diseases/metabolism*
;
Adenosine/genetics*
;
Psoriasis/genetics*
;
Carcinoma, Squamous Cell/genetics*
;
Carcinoma, Basal Cell/genetics*
;
Melanoma/genetics*
4.Effect of maternal iodine excess during pregnancy on neonatal thyroid function and neurodevelopmental status at 12 weeks
Deepashree K Rao ; Ankur Jindal ; Aashima Dabas ; Haseena Sait ; Sangeeta Yadav ; Seema Kapoor
Journal of the ASEAN Federation of Endocrine Societies 2024;39(2):27-32
Objective:
This study aims to determine the effect of iodine excess in pregnant mothers on thyroid function, growth and neurodevelopment in the neonates when assessed at 12 weeks of age.
Methodology:
This prospective study enrolled term neonates with birth weight >2500 gm of mothers having urine iodine concentration (UIC) ≥500 µg/L documented in the third trimester of the peripartum period. Neonatal TSH was collected by heel prick on dried blood spots within 24-72 hours of age and measured by time-resolved fluroimmunoassay. Neonates with TSH ≥11 mIU/L at birth were followed up at 2 and 12 weeks to monitor thyroid dysfunction, growth and development.
Results:
A total of 2354 (n = 1575 in the delivery room) maternal urine samples were collected of which 598 (25.4%) had elevated UIC. Forty-nine (12.2%) neonates had TSH ≥11mIU/L on newborn screening of whom 18 and 3 neonates had residual elevated TSH at 2 and 12 weeks of life, respectively. Maternal iodine levels correlated weakly with TSH at 2 weeks (rho = 0.299; p = 0.037). No child required treatment for congenital hypothyroidism. Eight babies additionally had TSH >5 mIU/L at 12 weeks of life. The growth and development of babies with or without TSH elevation was comparable at three months (p > 0.05).
Conclusion
Maternal iodine excess in pregnancy and peripartum period causes transient hyperthyrotropinemia in neonates that did not affect the growth and development at 3 months of age.
Thyroid
;
Thyroid Gland
;
Hypothyroidism
;
Thyroid Function Tests
5.A systematic review of the accuracy of Insulin and C-peptide secretion ratios during the oral glucose tolerance test to diagnose insulinoma
Fransiskus Mikael Chandra ; Dicky Tahapary
Journal of the ASEAN Federation of Endocrine Societies 2024;39(1):79-83
Background:
Insulinoma is one of the causes of recurrent hypoglycemia, one of the chief complaints for emergency department admission. The gold standard in diagnosing insulinoma is a 72-hour fasting test which is inconvenient and inefficient as it requires hospitalization. Research has found that measurement of insulin and C-peptide during OGTT may help diagnose insulinoma. We aimed to assess the diagnostic value of OGTT in diagnosing insulinoma.
Methodology:
The literature search was conducted on 19 August 2022 using several databases (MEDLINE, Scopus, Embase, and ScienceDirect). All studies that measured OGTT as diagnostic tools in diagnosing insulinoma and 72-hour fasting test as reference standard were included. The quality assessment of the selected studies was based on the Centre of Evidence-Based Medicine University of Oxford and the Quality Assessment of Diagnostic Accuracy-2 tool (QUADAS-2). Analysis of the included studies was performed qualitatively. This study was registered on PROSPERO (CRD42022360205).
Results:
A total of two case-control studies (106 patients) were included, which were at risk of bias and low concern of applicability. Both studies demonstrated that the combination of insulin and C-peptide levels measured during OGTT had high specificity, sensitivity, positive predictive value, and negative predictive value in diagnosing insulinoma compared to the reference standard. A logistic regression model of 8.305 – (0.441 × insulin 2-h/0-h) – (1.679 × C-peptide 1-h/0-h) > 0.351 has the highest diagnostic value in one study (AUC 0.97, Sensitivity 86.5%, Specificity 95.2%, PPV 94.1, NPV 88.9).
Conclusion
The measurement of 0-h and 2-h insulin and C-peptide levels during 2-h OGTT was found in two small case-control studies with a total of 106 patients to have good sensitivity and specificity. However, due to these limitations, future research is still needed to validate the potential use of OGTT for the diagnosis of insulinoma.
Insulinoma
;
Glucose Tolerance Test
6.Effectiveness of smartphone applications in achieving glycemic control among adult diabetic patients: A meta-analysis.
Eron Allen C. Tan ; Janella Jillian G. Abella ; Marie Ruth A. Echavez
The Filipino Family Physician 2024;62(1):145-154
BACKGROUND
Diabetes Mellitus Type 2 is a significant global health issue with a high prevalence in the Philippines. Managing this condition effectively is crucial, and digital technologies, particularly smartphone (mHealth) applications, have emerged as a potential tool in diabetes self-management.
OBJECTIVEThis study evaluated the effectiveness of smartphone (mHealth) application use in achieving glycemic control among adults with Type 2 Diabetes Mellitus, focusing on HbA1c levels and medication adherence.
METHODThis systematic review and meta-analysis, adhering to PRISMA guidelines, analyzed randomized controlled trials from databases like PubMed and Embase, comparing interventions using mHealth applications with standard care. The primary measures were HbA1c levels and medication adherence.
RESULTSTen studies involving 20,984 participants were included in the meta-analysis. Using mHealth applications led to an average HbA1c reduction of 0.36%, indicating improved glycemic control. There was considerable heterogeneity (I2 = 91%) because of the clinical and methodological diversity of the included studies. Subgroup analysis showed that the younger and older age groups, shorter and longer T2DM duration, and lower and higher HbA1c baseline benefited from its use. Sensitivity analysis still showed high heterogeneity (95%-97%), reflecting clinical diversity. A narrative analysis of two studies highlighted the utility of mHealth applications in tracking diet, physical activity, and vital stats, aiding medication adherence through reminders and data sharing with healthcare providers.
CONCLUSION/RECOMMENDATIONSThis systematic review and meta-analysis showed the effectiveness of mHealth application use in achieving glycemic control among adults with Type 2 Diabetes Mellitus by improving HbA1c levels and medication adherence. Integrating mHealth applications as adjuncts in family and community medicine as part of personalized care for managing type 2 diabetes in the Philippines can help achieve glycemic control and medication adherence. Future studies should focus on longitudinal assessments, exploring cultural and linguistic factors in the Filipino context to optimize diabetes care within this specialized medical framework.
Blood Glucose Self-monitoring ; Mobile Applications ; Diabetes Mellitus
7.Research progress on automated insulin delivery system in the field of diabetes management.
Zhichao YU ; Yufan SUN ; Zhijian HUANG ; Zhanhong LI ; Jianjun LONG ; Zhigang ZHU
Journal of Biomedical Engineering 2024;41(6):1279-1285
Diabetes and its complications pose a serious threat to human life and health. It has become a public health problem of wide concern worldwide. Currently, diabetes is mainly treated with insulin injection in clinic. However, manual insulin injection still has many shortcomings. In recent years, with the deepening of research, it has been found that an automated insulin delivery system (AID), which combines a continuous glucose monitoring device with an insulin pump, can significantly improve the effectiveness of diabetes treatment and reduce the incidence of complications in patients. This paper firstly introduces the composition of the AID system and its working principle, and then details the development history and current status of the related technologies from the aspects of continuous glucose monitoring technology, insulin pumps and the development of closed-loop control algorithms, etc. Finally, this paper looks forward to the application prospect and future development of AID system in the field of diabetes treatment, providing theoretical reference for further research.
Humans
;
Insulin Infusion Systems
;
Insulin/administration & dosage*
;
Blood Glucose Self-Monitoring/instrumentation*
;
Diabetes Mellitus/drug therapy*
;
Algorithms
;
Hypoglycemic Agents/administration & dosage*
;
Blood Glucose/analysis*
;
Pancreas, Artificial
;
Automation
8.Relationships of habitual daily alcohol consumption with all-day and time-specific average glucose levels among non-diabetic population samples.
Maho ISHIHARA ; Hironori IMANO ; Isao MURAKI ; Kazumasa YAMAGISHI ; Koutatsu MARUYAMA ; Mina HAYAMA-TERADA ; Mari TANAKA ; Mikako YASUOKA ; Tomomi KIHARA ; Masahiko KIYAMA ; Takeo OKADA ; Midori TAKADA ; Yuji SHIMIZU ; Tomotaka SOBUE ; Hiroyasu ISO
Environmental Health and Preventive Medicine 2023;28():20-20
BACKGROUND:
Alcohol consumption is a prevalent behavior that is bi-directionally related to the risk of type 2 diabetes. However, the effect of daily alcohol consumption on glucose levels in real-world situations in the general population has not been well elucidated. This study aimed to clarify the relationship between alcohol consumption and all-day and time-specific glucose levels among non-diabetic individuals.
METHODS:
We investigated 913 non-diabetic males and females, aged 40-69 years, during 2018-2020 from four communities across Japan. The daily alcohol consumption was assessed using a self-report questionnaire. All-day and time-specific average glucose levels were estimated from the interstitial glucose concentrations measured using the Flash glucose monitoring system for a median duration of 13 days. Furthermore, we investigated the association between all-day and time-specific average glucose levels and habitual daily alcohol consumption levels, using never drinkers as the reference, and performed multiple linear regression analyses after adjusting for age, community, and other diabetes risk factors for males and females separately.
RESULTS:
All-day average glucose levels did not vary according to alcohol consumption categories in both males and females. However, for males, the average glucose levels between 5:00 and 11:00 h and between 11:00 and 17:00 h were higher in moderate and heavy drinkers than in never drinkers, with the difference values of 4.6 and 4.7 mg/dL for moderate drinkers, and 5.7 and 6.8 mg/dL for heavy drinkers. Conversely, the average glucose levels between 17:00 and 24:00 h were lower in male moderate and heavy drinkers and female current drinkers than in never drinkers; the difference values of mean glucose levels were -5.8 for moderate drinkers, and -6.1 mg/dL for heavy drinkers in males and -2.7 mg/dL for female current drinkers.
CONCLUSIONS
Alcohol consumption was associated with glucose levels in a time-dependent biphasic pattern.
Humans
;
Male
;
Female
;
Diabetes Mellitus, Type 2
;
Blood Glucose Self-Monitoring
;
Blood Glucose
;
Alcohol Drinking/epidemiology*
;
Risk Factors
;
Alcoholic Intoxication
9.Decreasing complexity of glucose time series derived from continuous glucose monitoring is correlated with deteriorating glucose regulation.
Cheng LI ; Xiaojing MA ; Jingyi LU ; Rui TAO ; Xia YU ; Yifei MO ; Wei LU ; Yuqian BAO ; Jian ZHOU ; Weiping JIA
Frontiers of Medicine 2023;17(1):68-74
Most information used to evaluate diabetic statuses is collected at a special time-point, such as taking fasting plasma glucose test and providing a limited view of individual's health and disease risk. As a new parameter for continuously evaluating personal clinical statuses, the newly developed technique "continuous glucose monitoring" (CGM) can characterize glucose dynamics. By calculating the complexity of glucose time series index (CGI) with refined composite multi-scale entropy analysis of the CGM data, the study showed for the first time that the complexity of glucose time series in subjects decreased gradually from normal glucose tolerance to impaired glucose regulation and then to type 2 diabetes (P for trend < 0.01). Furthermore, CGI was significantly associated with various parameters such as insulin sensitivity/secretion (all P < 0.01), and multiple linear stepwise regression showed that the disposition index, which reflects β-cell function after adjusting for insulin sensitivity, was the only independent factor correlated with CGI (P < 0.01). Our findings indicate that the CGI derived from the CGM data may serve as a novel marker to evaluate glucose homeostasis.
Humans
;
Glucose
;
Blood Glucose
;
Insulin Resistance/physiology*
;
Diabetes Mellitus, Type 2/diagnosis*
;
Blood Glucose Self-Monitoring
;
Time Factors
;
Insulin
10.Mediating effect of self-efficacy on self-management ability and self-management behavior in patients with type 2 diabetes mellitus.
Xiao Yue ZHANG ; Yu Xin LIN ; Ying JIANG ; Lan Chao ZHANG ; Mang Yan DONG ; Hai Yi CHI ; Hao Yu DONG ; Li Jun MA ; Zhi Jing LI ; Chun CHANG
Journal of Peking University(Health Sciences) 2023;55(3):450-455
OBJECTIVE:
To investigate the mechanism of self-efficacy between self-management ability and self-management behavior and its differences among patients with different disease courses through mediation tests.
METHODS:
In the study, 489 patients with type 2 diabetes who attended the endocrinology departments of four hospitals in Shanxi Province and Inner Mongolia Autonomous Region from July to September 2022 were enrolled as the study population. They were investigated by General Information Questionnaire, Diabetes Self-Management Scale, Chinese version of Diabetes Empowerment Simplified Scale, and Diabetes Self-Efficacy Scale. Mediation analyses were performed using the linear regression model, Sobel test, and Bootstrap test in the software Stata version 15.0 and divided the patients into different disease course groups for subgroup analysis according to whether the disease course was > 5 years.
RESULTS:
In this study, the score of self-management behavior in the patients with type 2 diabetes was 6.16±1.41, the score of self-management ability was 3.99±0.74, and the score of self-efficacy was 7.05±1.90. The results of the study showed that self-efficacy was positively correlated with self-management ability (r=0.33) as well as self-management behavior (r=0.47) in the patients with type 2 diabetes (P < 0.01). The mediating effect of self-efficacy accounted for 38.28% of the total effect of self-management ability on self-management behaviors and was higher in the behaviors of blood glucose monitoring (43.45%) and diet control (52.63%). The mediating effect of self-efficacy accounted for approximately 40.99% of the total effect for the patients with disease course ≤ 5 years, while for the patients with disease course > 5 years, the mediating effect accounted for 39.20% of the total effect.
CONCLUSION
Self-efficacy enhanced the effect of self-management ability on the behavior of the patients with type 2 diabetes, and this positive effect was more significant for the patients with shorter disease course. Targeted health education should be carried out to enhance patients' self-efficacy and self-management ability according to their disease characteristics, to stimulate their inner action, to promote the development of their self-management behaviors, and to form a more stable and long-term mechanism for disease management.
Humans
;
Diabetes Mellitus, Type 2/therapy*
;
Self Efficacy
;
Self-Management
;
Blood Glucose Self-Monitoring
;
Blood Glucose
;
Self Care


Result Analysis
Print
Save
E-mail