OBJECTIVE: To investigate the association between long-term exposure to ambient fine particulate matter (PM _2.5) and its constituents and the risk of incident type 2 diabetes mellitus (T2DM), and to examine the modification roles of overweight status. METHODS: This prospective study included 27,507 adults living in rural China. The annual mean residential exposure to PM _2.5 and its constituents was estimated using a satellite-based statistical model. Cox models were used to estimate the risk of T2DM associated with PM _2.5 and its constituents. Stratified analysis quantified the role of overweight status in the association between PM _2.5 constituents and T2DM. RESULTS: Over a median follow-up of 9.4 years, 3,001 new T2DM cases were identified. The hazard ratio ( HR) for a 10 μg/m ³ increase in ambient PM _2.5 was 1.30 (95% confidence interval [ CI]: 1.17, 1.45). Among the constituents, the strongest association was observed with black carbon. Being overweight significantly modified the association between certain constituents and the risk of T2DM. Participants who were overweight and exposed to the highest quartile of PM _2.5 constituents had the highest risk of T2DM ( HR: 2.46, 95% CI: 2.04, 2.97). CONCLUSIONS Our findings indicate that PM _2.5 was associated with an increased risk of T2DM, with black carbon potentially being the primary contributor. Being overweight appeared to enhance the association between PM _2.5 and T2DM. This suggests that controlling both PM _2.5 exposure and overweight status may reduce the burden of T2DM.
Humans ; Diabetes Mellitus, Type 2/chemically induced* ; China/epidemiology* ; Particulate Matter/analysis* ; Overweight/epidemiology* ; Female ; Male ; Middle Aged ; Rural Population ; Air Pollutants/analysis* ; Adult ; Prospective Studies ; Environmental Exposure/adverse effects* ; Aged ; Risk Factors

Diabetic chronic wounds are characterized by difficult healing, recurrent progression, and high rates of disability and mortality, which make their clinical treatment a medical challenge urgent to be addressed. However, the complex local microenvironment conditions of chronic wounds, such as high protease activity and persistent inflammatory responses, result in low bioavailability of exogenous cytokines (e.g., chemokine CXCL12) at the wound site, limiting their clinical application. In this study, we utilized Lactobacillus plantarum WCFS1 as the chassis to develop an efficient CXCL12 delivery system based on synthetic biology. Subsequently, we evaluated the role of the engineered probiotic strain in promoting the chronic wound healing in diabetic mice. Firstly, we fused the endogenous secretion signal peptide lp_3050 (SP_{lp_3050}) of L. plantarum WCFS1 and the commonly used secretion signal peptide usp45 (SP_usp45) of lactic acid bacteria with the reporter gene gusA and inserted them into the pTRK892-P_32(pgm) plasmid by molecular cloning. Then, we prepared the engineered strains and characterized the efficacy of the two signal peptides in driving the secretion of GusA. The results showed that SP_{lp_3050} efficiently drove the secretion of GusA in L. plantarum WCFS1, increasing the activity of GusA in the culture supernatant by nearly five times compared with that of SP_{lp_3050}. Further, we fused SP_{lp_3050} and codon-optimized CXCL12 gene to construct an engineered probiotic strain Lpw-CXCL12 for CXCL12 delivery. The results demonstrated that the content of CXCL12 in the culture supernatant reached (13.40±0.20) μg/mL. Finally, we found that the engineered probiotic strain Lpw-CXCL12 accelerated chronic wound healing in a diabetic mouse model. In conclusion, these results support an engineered probiotic strain in promoting diabetic chronic wound healing, providing a new strategy and technological foundation for the management of diabetic chronic wounds in the future.
Probiotics ; Animals ; Chemokine CXCL12/biosynthesis* ; Mice ; Wound Healing ; Lactobacillus plantarum/metabolism* ; Diabetes Mellitus, Experimental/complications* ; Male

Objective To investigate the alterations of cerebral blood flow(CBF)in type 2 diabetic mellitus(T2DM) patients without cognitive impairment by using arterial spin labeling(ASL)technique.Methods A total of 23 T2DM patients without cognitive impairment and 23 healthy controls(HC)matched by age,sex,and education attainment were recruited.Their clinical data were collected,and neuropsychological tests and cerebral magnetic resonance imaging were performed.Then,the outcomes of clinical features,neuropsychological tests,and global and regional CBF were compared between the two groups.The significant regional zCBF(z-transformed relative CBF)values were extracted and correlated with clinical data and neuropsychological scores in T2DM patients,controlling age,sex,and education.Results No significant difference was found in whole brain CBF between the two groups(P=0.155),while significantly higher CBF was identified in the left superior temporal gyrus and left insula in the T2DM group(Gaussian random field correction,initial threshold P < 0.001,cluster level P < 0.05).No correlation was observed between the significant regional zCBF values and the clinical data or the neuropsychological scores in T2DM patients(all P>0.05).Conclusion Alterations in cerebral hemodynamics may precede cognitive function changes in T2DM,suggesting that the ASL technique is promising for early monitoring of cerebral hemodynamic changes associated with cognitive impairment in patients with T2DM.
Humans ; Diabetes Mellitus, Type 2/physiopathology* ; Cerebrovascular Circulation ; Middle Aged ; Male ; Female ; Magnetic Resonance Imaging ; Case-Control Studies ; Cognitive Dysfunction ; Neuropsychological Tests ; Aged

Ankle fractures are common traumatic injuries, especially among diabetic patients, and their treatment faces many challenges. Diabetic patients, due to factors such as long-term high blood sugar, osteoporosis, microvascular lesions and neuropathy, are prone to problems such as delayed fracture healing, increased risk of infection, non-union of fractures and postoperative complications, which affect their treatment effect and recovery process. Diabetes significantly affects the treatment of ankle fractures, mainly through factors such as high blood sugar, osteoporosis, microvascular lesions, and hypercoagulable state of the blood. In recent years, advancements in strong fixation techniques, blood glucose control and postoperative rehabilitation have achieved remarkable results in the treatment of ankle fractures for diabetic patients. However, at present, there are many studies on the treatment of ankle fractures in patients with diabetes, but there is still a lack of large-scale data reports. With the continuous advancement of medical technology, through precise admission assessment, perfect perioperative management, advanced fixation techniques and the latest treatment concepts, postoperative complications could be significantly reduced, and the fracture healing and prognosis of patients with ankle fractures combined with diabetes could be improved.
Humans ; Ankle Fractures/complications* ; Diabetes Complications/surgery* ; Diabetes Mellitus ; Fracture Fixation, Internal

Objective To investigate the effect and mechanism of baicalin on blood lipid metabolism and immune function in rats with gestational diabetes mellitus (GDM). Methods Female rats fed with high-fat and high-sugar diet and male rats fed with ordinary diet were caged together to prepare pregnant rats, and the GDM rat model was established by intraperitoneal injection of streptozotocin (35 mg/kg). GDM rats were randomly divided into a model group, a fasudil (FA) (RhoA/RocK inhibitor) group (10 mg/kg), low-dose (100 mg/kg) and high-dose (200 mg/kg) baicalin groups, and a high-dose baicalin combined with LPA (RhoA/RocK activator) group (200 mg/kg baicalin+1 mg/kg LPA ), with 12 rats in each group. Another 12 pregnant rats fed with high-fat and high-sugar diet were selected as the control group. After 2 weeks of corresponding drug intervention in each group, the level of fasting blood glucose (FBG) was detected by blood glucose meter. The level of fasting insulin (FINS) in serum was detected by ELISA, and the insulin resistance index (HOMA-IR) was calculated. The levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), total cholesterol (TC), triglyceride (TG), low density lipoprotein cholesterol (LDL-C), high density lipoprotein cholesterol (HDL-C) in serum, and the levels of immunomodulator tumor necrosis factor α (TNF-α), interleukin 6 (IL-6), and IL-10 in peripheral blood were detected by the kit. The histopathological changes of liver were observed by HE staining. The proportion of T lymphocyte subsets in peripheral blood was detected by flow cytometry. The mRNA and protein expressions of Ras homolog gene family member A (RhoA), Rho associated coiled-coil forming protein kinase 1 (ROCK1), and ROCK2 in liver tissue were detected by real-time quantitative PCR and Western blot. Results Compared with the control group, the levels of FBG, FINS, HOMA-IR, ALT, AST, TG, TC, and LDL-C in serum, the levels of TNF-α, IL-6, the percentage of CD8⁺T cell in peripheral blood, and the mRNA and protein expression of RhoA, ROCK1, and ROCK2 in liver tissue in the model group were higher; the level of HDL-C in serum, the percentage of IL-10 levels, CD3⁺T cells, CD4⁺T cell, and CD4⁺T/CD8⁺T ratio in peripheral blood were lower. Compared with the model group, the levels of FBG, FINS, HOMA-IR, ALT, AST, TG, TC, and LDL-C in serum, the levels of TNF-α, IL-6, the percentage of CD8⁺T cell in peripheral blood, and the mRNA and protein expression of RhoA, ROCK1, and ROCK2 in liver tissue in the the FA group and low-dose and high-dose baicalin groups were lower; the level of HDL-C in serum, IL-10 level, the percentage of CD3⁺T cells, CD4⁺T cell, and CD4⁺T/CD8⁺T ratio in peripheral blood were higher. LPA could obviously weaken the improvement effects of baicalin on blood lipid metabolism and immune function in GDM rats. Conclusion Baicalin may improve blood lipid metabolism and immune function in GDM rats by inhibiting the RhoA/ROCK pathway.
Animals ; Female ; Diabetes, Gestational/metabolism* ; Pregnancy ; rho-Associated Kinases/genetics* ; Flavonoids/pharmacology* ; Rats ; rhoA GTP-Binding Protein/genetics* ; Lipid Metabolism/drug effects* ; Male ; Signal Transduction/drug effects* ; Rats, Sprague-Dawley ; Blood Glucose/metabolism* ; Lipids/blood* ; Tumor Necrosis Factor-alpha/blood* ; rho GTP-Binding Proteins

Non-obstructive azoospermia is a common condition associated with significant health risks, including increased mortality, cancer, and chronic diseases such as metabolic and cardiovascular disorders. This review aims to highlight the potential health challenges faced by men with this condition compared to fertile counterparts. Through a comprehensive bibliographic search on PubMed, using the following algorithm: ("infertility, male" [MeSH Terms] OR "azoospermia" [MeSH Terms]) AND ("mortality" [MeSH Terms] OR "neoplasms" [MeSH Terms] OR "chronic disease" [MeSH Terms] OR "diabetes mellitus" [MeSH Terms] OR "heart diseases" [MeSH Terms]), we analyzed existing literature to explore the associations between infertility, specifically azoospermia, and adverse health outcomes. Findings indicate that infertile men are at a higher risk of death, various cancers (particularly testicular cancer), metabolic syndrome, diabetes, hypogonadism, and cardiovascular disease. Although research specifically addressing azoospermia is limited, available studies support the notion that men with this condition may experience heightened health vulnerabilities. Given these risks, it is imperative for healthcare professionals, especially urologists, to conduct thorough health assessments for men diagnosed with azoospermia. Informing patients of these potential health issues and integrating comprehensive evaluations into their care can facilitate early detection and intervention for life-threatening conditions. Ultimately, men with azoospermia should receive ongoing monitoring to address their specific health concerns, thus improving their long-term health outcomes.
Humans ; Male ; Azoospermia/epidemiology* ; Cardiovascular Diseases/etiology* ; Metabolic Syndrome/epidemiology* ; Infertility, Male/complications* ; Testicular Neoplasms/epidemiology* ; Hypogonadism/epidemiology* ; Diabetes Mellitus/epidemiology* ; Risk Factors ; Neoplasms/epidemiology*

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

Maturity-onset diabetes of the young (MODY) is a special type of diabetes characterized by clinical features including early onset of diabetes (before 30 years of age), autosomal dominant inheritance, impaired glucose-induced insulin secretion, and hyperglycemia. So far, 14 types of MODY have been reported, accounting for about 1%-5% of the patients with diabetes. MODY often presents with an insidious onset, and although 14 subtypes have been identified for MODY, it is frequently misdiagnosed as type 1 or type 2 diabetes due to overlapping clinical features and high costs and limitations of genetic testing. This article reviews the clinical features of MODY subtypes in order to improve the accuracy of the diagnosis and treatment of MODY.
Humans ; Diabetes Mellitus, Type 2/genetics*

OBJECTIVES: To investigate the current status and influencing factors of quality of life in children and adolescents with type 1 diabetes (T1DM) in Xinjiang. METHODS: A convenience sampling method was used to select 259 children with T1DM and their primary caregivers who attended three tertiary hospitals in Xinjiang from January 2023 to February 2024. The Pediatric Quality of Life Inventory^TM Version 4.0 Generic Core Scales (PedsQL^TM4.0) and Pediatric Quality of Life Inventory^TM Version 3.2 Diabetes Module (PedsQL^TM3.2-DM) were used to assess the quality of life of the children. Information on family demographics, caregiver burden, and caregiving ability was also collected. Multiple linear regression analysis was employed to identify factors associated with the quality of life of the children. RESULTS: The scores for PedsQL^TM4.0 and PedsQL^TM3.2-DM were 77±16 and 71±16, respectively. Both were negatively correlated with caregiver burden (P<0.05) and positively correlated with caregiving ability (P<0.05). Multiple linear regression analysis indicated that caregiver burden, caregiving ability, family income, and parent-child relationship were significantly associated with generic quality of life (P<0.05), whereas caregiver burden, caregiving ability, disease duration, place of residence, and glycated hemoglobin level were significantly associated with diabetes-specific quality of life (P<0.05). CONCLUSIONS The overall quality of life of children and adolescents with T1DM in Xinjiang is relatively low. The quality of life is influenced by a combination of factors including family caregiver burden, caregiving ability, family income, parent-child relationship, disease duration, place of residence, and glycated hemoglobin level. Strategies to improve quality of life should consider the combined impact of individual disease characteristics and family factors.
Humans ; Quality of Life ; Diabetes Mellitus, Type 1/psychology* ; Adolescent ; Child ; Male ; Female ; Caregivers/psychology* ; Child, Preschool ; Linear Models

OBJECTIVES

Diabetic ketoacidosis (DKA) is the most common initial presentation in children with newly diagnosed type 1 diabetes. Severe dehydration/acidosis, shock at admission, and hyperchloremia contribute to acute kidney injury (AKI). This retrospective study was done to determine the proportion of children hospitalized for DKA who had AKI and to compare clinical parameters between children with DKA and with AKI and without AKI to identify the risk factors associated with AKI.

A retrospective review of all DKA admissions with type 1 diabetes was done. AKI was diagnosed as per KDIGO-2012 criteria. The analysis was done using a Chi-square test to assess the association between the status of AKI and other parameters. The Independent t-test was applied for comparison with the mean score between the No AKI / AKI group for numerical variables with normal distribution. A multivariable logistic regression analysis was performed to compare clinical parameters between both groups.

Out of 32 children with DKA, 13 (40.63%) developed AKI. Among them, 9 had AKI at admission and 4 children developed AKI within the first 48 hours of admission. Optimum fluid management resolved AKI in 10 patients, but 3 of them required dialysis. Parameters like higher heart rate (p = 0.0390), higher respiratory rate (p = 0.0402), high leukocyte count (p = 0.0005), severe hyperglycemia (p = 0.0204), severe acidosis (p = 0.0001), hyperchloremia (p = 0.016) and shock at admission (p = 0.0001) were present in children with DKA and AKI.

In our study, a high proportion of children with DKA had AKI, which causes prolonged acidosis and hospital stay. Hence, comparing clinical parameters between both groups helps in identifying risk factors associated with AKI in persons with type 1 diabetes with DKA.