1.Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood.
Juan YE ; Feng YE ; Ling HOU ; Wei WU ; Xiao-Ping LUO ; Yan LIANG
Chinese Journal of Contemporary Pediatrics 2025;27(1):94-100
OBJECTIVES:
To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.
METHODS:
A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.
RESULTS:
All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.
CONCLUSIONS
This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Male
;
Female
;
Child
;
Retrospective Studies
;
Glucokinase/genetics*
;
Adolescent
;
Child, Preschool
;
Glucose Tolerance Test
2.Research advances in maturity-onset diabetes of the young.
Chinese Journal of Contemporary Pediatrics 2025;27(1):121-126
Maturity-onset diabetes of the young (MODY) is a special type of diabetes characterized by clinical features including early onset of diabetes (before 30 years of age), autosomal dominant inheritance, impaired glucose-induced insulin secretion, and hyperglycemia. So far, 14 types of MODY have been reported, accounting for about 1%-5% of the patients with diabetes. MODY often presents with an insidious onset, and although 14 subtypes have been identified for MODY, it is frequently misdiagnosed as type 1 or type 2 diabetes due to overlapping clinical features and high costs and limitations of genetic testing. This article reviews the clinical features of MODY subtypes in order to improve the accuracy of the diagnosis and treatment of MODY.
Humans
;
Diabetes Mellitus, Type 2/genetics*
3.Causal relationship between gut microbiota and diabetes based on Mendelian randomization.
Manjun LUO ; Ziye LI ; Mengting SUN ; Jiapeng TANG ; Tingting WANG ; Jiabi QIN
Journal of Central South University(Medical Sciences) 2025;50(3):469-481
OBJECTIVES:
The gut microbiota plays a crucial role in the pathophysiology of various types of diabetes. However, the causal relationship between them has yet to be systematically elucidated. This study aims to explore the potential causal associations between gut microbiota and diabetes using a two-sample Mendelian randomization (MR) analysis, based on multiple taxonomic levels.
METHODS:
Eligible instrumental variables were extracted from the selected genome-wide association study (GWAS) data on gut microbiota. These were combined with GWAS datasets on type 1 diabetes (T1D), type 2 diabetes (T2D), and gestational diabetes mellitus (GDM) to conduct forward MR analysis, sensitivity analysis, reverse MR analysis, and validation of significant estimates. Microbial taxa with causal effects on T1D, T2D, and GDM were identified based on a comprehensive assessment of all analytical stages.
RESULTS:
A total of 2 179, 2 176, and 2 166 single nucleotide polymorphisms (SNP) were included in the MR analyses for gut microbiota with T1D, T2D, and GDM, respectively. MR results indicated causal associations between: Six microbial taxa (Eggerthella, Lachnospira, Bacillales, Desulfovibrionales, Parasutterella, and Turicibacter) and T1D; 9 microbial taxa (Verrucomicrobia, Deltaproteobacteria, Actinomycetales, Desulfovibrionale, Actinomycetaceae, Desulfovibrionaceae, Actinomyces, Alcaligenaceae, and Lachnospiraceae NC2004 group) and T2D; 10 microbial taxa (Betaproteobacteria, Coprobacter, Ruminococcus2, Tenericutes, Clostridia, Methanobacteria, Mollicutes, Methanobacteriales, Methanobacteriaceae, and Methanobrevibacter) and GDM.
CONCLUSIONS
This study identified specific gut microbial taxa that may significantly increase or decrease the risk of developing diabetes. Some findings were fully replicated in independent validation datasets. However, the underlying biological mechanisms of these causal relationships warrant further investigation through mechanistic studies and population-based research.
Gastrointestinal Microbiome/genetics*
;
Humans
;
Mendelian Randomization Analysis
;
Genome-Wide Association Study
;
Diabetes Mellitus, Type 2/genetics*
;
Diabetes Mellitus, Type 1/genetics*
;
Female
;
Polymorphism, Single Nucleotide
;
Diabetes, Gestational/genetics*
;
Pregnancy
4.Metagenomics reveals an increased proportion of an Escherichia coli-dominated enterotype in elderly Chinese people.
Jinyou LI ; Yue WU ; Yichen YANG ; Lufang CHEN ; Caihong HE ; Shixian ZHOU ; Shunmei HUANG ; Xia ZHANG ; Yuming WANG ; Qifeng GUI ; Haifeng LU ; Qin ZHANG ; Yunmei YANG
Journal of Zhejiang University. Science. B 2025;26(5):477-492
Gut microbial communities are likely remodeled in tandem with accumulated physiological decline during aging, yet there is limited understanding of gut microbiome variation in advanced age. Here, we performed a metagenomics-based enterotype analysis in a geographically homogeneous cohort of 367 enrolled Chinese individuals between the ages of 60 and 94 years, with the goal of characterizing the gut microbiome of elderly individuals and identifying factors linked to enterotype variations. In addition to two adult-like enterotypes dominated by Bacteroides (ET-Bacteroides) and Prevotella (ET-Prevotella), we identified a novel enterotype dominated by Escherichia (ET-Escherichia), whose prevalence increased in advanced age. Our data demonstrated that age explained more of the variance in the gut microbiome than previously identified factors such as type 2 diabetes mellitus (T2DM) or diet. We characterized the distinct taxonomic and functional profiles of ET-Escherichia, and found the strongest cohesion and highest robustness of the microbial co-occurrence network in this enterotype, as well as the lowest species diversity. In addition, we carried out a series of correlation analyses and co-abundance network analyses, which showed that several factors were likely linked to the overabundance of Escherichia members, including advanced age, vegetable intake, and fruit intake. Overall, our data revealed an enterotype variation characterized by Escherichia enrichment in the elderly population. Considering the different age distribution of each enterotype, these findings provide new insights into the changes that occur in the gut microbiome with age and highlight the importance of microbiome-based stratification of elderly individuals.
Aged
;
Aged, 80 and over
;
Female
;
Humans
;
Male
;
Middle Aged
;
Bacteroides
;
China
;
Diabetes Mellitus, Type 2/microbiology*
;
Escherichia coli/classification*
;
Gastrointestinal Microbiome/genetics*
;
Metagenomics
;
East Asian People
5.CXCL12 is a potential therapeutic target for type 2 diabetes mellitus complicated by chronic obstructive pulmonary disease.
Huaiwen XU ; Li WENG ; Hong XUE
Journal of Southern Medical University 2025;45(1):100-109
OBJECTIVES:
To identify the key genes and immunological pathways shared by type 2 diabetes mellitus (T2DM) and chronic obstructive pulmonary disease (COPD) and explore the potential therapeutic targets of T2DM complicated by COPD.
METHODS:
GEO database was used for analyzing the gene expression profiles in T2DM and COPD to identify the common differentially expressed genes (DEGs) in the two diseases. A protein-protein interaction network was constructed to identify the candidate hub genes, which were validated in datasets and disease sets to obtain the target genes. The diagnostic accuracy of these target genes was assessed with ROC analysis, and their expression levels and association with pulmonary functions were investigated using clinical data and blood samples of patients with T2DM and COPD. The abundance of 22 immune cells was analyzed with CIBERSORT algorithm, and their relationship with the target genes was examined using correlation analysis. DGIdb database was used for analyzing the drug-gene interactions and the druggable genes followed by gene set enrichment analysis.
RESULTS:
We identified a total of 175 common DEGs in T2DM and COPD, mainly enriched in immune- and inflammation-related pathways. Among these genes, CXCL12 was identified as the final target gene, whose expression was elevated in both T2DM and COPD (P<0.05) and showed good diagnostic efficacy. Immune cell infiltration correlation analysis showed significant correlations of CXCL12 with various immune cells (P<0.01). GESA analysis showed that high CXCL12 expression was significantly correlated with "cytokine-cytokine receptor interaction". Drug-gene analysis showed that most of CXCL12-related drugs were not targeted drugs with significant cytotoxicity.
CONCLUSIONS
CXCL12 is a potential common key pathogenic gene of COPD and T2DM, and small-molecule targeted drugs against CXCL12 can provide a new strategy for treatment T2DM complicated by COPD.
Humans
;
Pulmonary Disease, Chronic Obstructive/complications*
;
Diabetes Mellitus, Type 2/genetics*
;
Chemokine CXCL12/metabolism*
;
Protein Interaction Maps
;
Gene Expression Profiling
6.Effect of moxibustion on central insulin resistance related proteins in diabetic rats with cognitive decline.
Min YE ; Aihong YUAN ; Lele ZHANG ; Hongyu XIE ; Hudie SONG ; Yinqiu FAN ; Jun YANG
Chinese Acupuncture & Moxibustion 2025;45(2):185-192
OBJECTIVE:
To investigate the effect of moxibustion on central insulin resistance related proteins of the rats suffering from diabetic cognitive decline, and analyze the underlying mechanism of moxibustion for cognition improvement.
METHODS:
Using the intraperitoneal injection of STZ combined with a high-fat diet, the rat model of diabetic cognitive decline were prepared. Twenty successfully-modeled rats were assigned randomly into a model group and a moxibustion group, 10 rats in each one. Besides, a blank group was set up with 10 rats collected. In the moxibustion group, suspending moxibustion was applied to "Baihui" (GV20), "Shenting" (GV24) and "Dazhui" (GV14) at the same time, 20 min in each intervention, once a day, and 6 interventions were delivered weekly and the duration of treatment was consecutive 4 weeks. The random blood glucose was measured using glucometer, and the learning-memory ability was detected by water maze test. HE staining was used to observe the morphology of neurons in the hippocampal tissue, real-time PCR assay was to detect mRNA expression of insulin receptor substrate 1 (IRS1), phosphatidylinositol 3-kinase (PI3K) and protein kinase B (AKT) in the hippocampal tissue. The Western blot method was employed to detect the protein expression of IRS1, PI3K, AKT, phosphorylated IRS1 (p-IRS1), phosphorylated PI3K (p-PI3K) and phosphorylated AKT (p-AKT) in the hippocampal tissue, and the ratio of p-IRS1/IRS1, p-PI3K/PI3K and p-AKT/AKT was calculated separately. The immunofluorescence intensity of p-IRS1, p-PI3K, and p-AKT was measured using immunofluorescence.
RESULTS:
Compared with the blank group, the rats of the model group exhibited higher random blood glucose (P<0.001), longer escape latency (P<0.001), severe pathological damage in the hippocampus, lower mRNA expression of IRS1, PI3K, and AKT (P<0.001), reduced ratio of p-IRS1/IRS1, p-PI3K/PI3K and p-AKT/AKT (P<0.001), and declined immunofluorescence intensity of p-IRS1, p-PI3K, and p-AKT in the hippocampal tissue (P<0.001). In comparison with the model group, for the rats of the moxibustion group, the random blood glucose decreased (P<0.05), the escape latency was shortened (P<0.01), the hippocampal pathological damage was attenuated, the mRNA expression of IRS1, PI3K and AKT increased (P<0.01), the ratio of p-IRS1/IRS1, p-PI3K/PI3K and p-AKT/AKT was elevated (P<0.01, P<0.05), and the immunofluorescence intensity of p-IRS1, p-PI3K, and p-AKT in the hippocampal tissue was strengthened (P<0.01, P<0.05).
CONCLUSION
In diabetic rats experiencing cognitive decline, moxibustion can enhance the learning-memory ability, which may be attributed to modulating the protein expression of IRS1, PI3K, and AKT, and their phosphorylation, activating insulin signal transduction, and reducing central insulin resistance.
Animals
;
Moxibustion
;
Insulin Resistance
;
Rats
;
Male
;
Insulin Receptor Substrate Proteins/genetics*
;
Rats, Sprague-Dawley
;
Humans
;
Proto-Oncogene Proteins c-akt/genetics*
;
Cognitive Dysfunction/genetics*
;
Diabetes Mellitus, Experimental/therapy*
;
Hippocampus/metabolism*
;
Acupuncture Points
;
Phosphatidylinositol 3-Kinases/genetics*
7.Hub biomarkers and their clinical relevance in glycometabolic disorders: A comprehensive bioinformatics and machine learning approach.
Liping XIANG ; Bing ZHOU ; Yunchen LUO ; Hanqi BI ; Yan LU ; Jian ZHOU
Chinese Medical Journal 2025;138(16):2016-2027
BACKGROUND:
Gluconeogenesis is a critical metabolic pathway for maintaining glucose homeostasis, and its dysregulation can lead to glycometabolic disorders. This study aimed to identify hub biomarkers of these disorders to provide a theoretical foundation for enhancing diagnosis and treatment.
METHODS:
Gene expression profiles from liver tissues of three well-characterized gluconeogenesis mouse models were analyzed to identify commonly differentially expressed genes (DEGs). Weighted gene co-expression network analysis (WGCNA), machine learning techniques, and diagnostic tests on transcriptome data from publicly available datasets of type 2 diabetes mellitus (T2DM) patients were employed to assess the clinical relevance of these DEGs. Subsequently, we identified hub biomarkers associated with gluconeogenesis-related glycometabolic disorders, investigated potential correlations with immune cell types, and validated expression using quantitative polymerase chain reaction in the mouse models.
RESULTS:
Only a few common DEGs were observed in gluconeogenesis-related glycometabolic disorders across different contributing factors. However, these DEGs were consistently associated with cytokine regulation and oxidative stress (OS). Enrichment analysis highlighted significant alterations in terms related to cytokines and OS. Importantly, osteomodulin ( OMD ), apolipoprotein A4 ( APOA4 ), and insulin like growth factor binding protein 6 ( IGFBP6 ) were identified with potential clinical significance in T2DM patients. These genes demonstrated robust diagnostic performance in T2DM cohorts and were positively correlated with resting dendritic cells.
CONCLUSIONS
Gluconeogenesis-related glycometabolic disorders exhibit considerable heterogeneity, yet changes in cytokine regulation and OS are universally present. OMD , APOA4 , and IGFBP6 may serve as hub biomarkers for gluconeogenesis-related glycometabolic disorders.
Machine Learning
;
Humans
;
Computational Biology/methods*
;
Biomarkers/metabolism*
;
Diabetes Mellitus, Type 2/genetics*
;
Animals
;
Mice
;
Gluconeogenesis/physiology*
;
Gene Expression Profiling
;
Transcriptome/genetics*
;
Gene Regulatory Networks/genetics*
;
Clinical Relevance
8.Diabetic vascular calcification inhibited by soluble epoxide hydrolase gene deletion via regressing NID2-mediated IGF2-ERK1/2 signaling pathway.
Yueting CAI ; Shuiqing HU ; Jingrui LIU ; Jinlan LUO ; Wenhua LI ; Jiaxin TANG ; Siyang LIU ; Ruolan DONG ; Yan YANG ; Ling TU ; Xizhen XU
Chinese Medical Journal 2025;138(20):2657-2668
BACKGROUND:
Epoxyeicosatrienoic acids (EETs), which are metabolites of arachidonic acid catalyzed by cytochrome P450 epoxygenase, are degraded into inactive dihydroxyeicosatrienoic acids by soluble epoxide hydrolase (sEH). Many studies have revealed that sEH gene deletion exerts protective effects against diabetes. Vascular calcification is a common complication of diabetes, but the potential effects of sEH on diabetic vascular calcification are still unknown.
METHODS:
The level of aortic calcification in wild-type and Ephx2-/- C57BL/6 diabetic mice induced with streptozotocin was evaluated by measuring the aortic calcium content through alizarin red staining, immunohistochemistry staining, and immunofluorescence staining. Mouse vascular smooth muscle cell lines (MOVAS cells) treated with β-glycerol phosphate (0.01 mol/L) plus advanced glycation end products (50 mg/L) were used to investigate the effects of sEH inhibitors or sEH knockdown and EETs on the calcification of vascular smooth muscle cells, which was detected by Western blotting, alizarin red staining, and Von Kossa staining.
RESULTS:
sEH gene deletion significantly inhibited diabetic vascular calcification by increasing levels of EETs in the aortas of mice. EETs (especially 11,12-EET and 14,15-EET) efficiently prevented the osteogenic transdifferentiation of MOVAS cells by decreasing nidogen-2 (NID2) expression. Interestingly, suppressing sEH activity by small interfering ribonucleic acid or specific inhibitors did not block osteogenic transdifferentiation of MOVAS cells induced by β-glycerol phosphate and advanced glycation end products. NID2 overexpression significantly abolished the inhibitory effect of sEH gene deletion on diabetic vascular calcification. Moreover, NID2 overexpression mediated by adeno-associated virus 9 vectors markedly increased insulin-like growth factor 2 (IGF2) and phospho-ERK1/2 expression in MOVAS cells. Overall, sEH gene knockout inhibited diabetic vascular calcification by decreasing aortic NID2 expression and, then, inactivating the downstream IGF2-ERK1/2 signaling pathway.
CONCLUSIONS
sEH gene deletion markedly inhibited diabetic vascular calcification through repressed osteogenic transdifferentiation of vascular smooth muscle cells mediated by increased aortic EET levels, which was associated with decreased NID2 expression and inactivation of the downstream IGF2-ERK1/2 signaling pathway.
Animals
;
Mice
;
Vascular Calcification/metabolism*
;
Mice, Inbred C57BL
;
Epoxide Hydrolases/metabolism*
;
Diabetes Mellitus, Experimental/genetics*
;
Male
;
Gene Deletion
;
MAP Kinase Signaling System/genetics*
;
Cell Line
;
Immunohistochemistry
;
Muscle, Smooth, Vascular/metabolism*
;
Signal Transduction/genetics*
;
Mice, Knockout
9.Mechanism of Qingrun Decoction in alleviating hepatic insulin resistance in type 2 diabetic rats based on amino acid metabolism reprogramming pathways.
Xiang-Wei BU ; Xiao-Hui HAO ; Run-Yun ZHANG ; Mei-Zhen ZHANG ; Ze WANG ; Hao-Shuo WANG ; Jie WANG ; Qing NI ; Lan LIN
China Journal of Chinese Materia Medica 2025;50(12):3377-3388
This study aims to investigate the mechanism of Qingrun Decoction in alleviating hepatic insulin resistance in type 2 diabetes mellitus(T2DM) rats through the reprogramming of amino acid metabolism. A T2DM rat model was established by inducing insulin resistance through a high-fat diet combined with intraperitoneal injection of streptozotocin. The model rats were randomly divided into five groups: model group, high-, medium-, and low-dose Qingrun Decoction groups, and metformin group. A normal control group was also established. The rats in the normal and model groups received 10 mL·kg~(-1) distilled water daily by gavage. The metformin group received 150 mg·kg~(-1) metformin suspension by gavage, and the Qingrun Decoction groups received 11.2, 5.6, and 2.8 g·kg~(-1) Qingrun Decoction by gavage for 8 weeks. Blood lipid levels were measured in different groups of rats. Pathological damage in rat liver tissue was assessed by hematoxylin-eosin(HE) staining and oil red O staining. Transcriptome sequencing and untargeted metabolomics were performed on rat liver and serum samples, integrated with bioinformatics analyses. Key metabolites(branched-chain amino acids, BCAAs), amino acid transporters, amino acid metabolites, critical enzymes for amino acid metabolism, resistin, adiponectin(ADPN), and mammalian target of rapamycin(mTOR) pathway-related molecules were quantified using quantitative real-time polymerase chain reaction(qRT-PCR), Western blot, and enzyme-linked immunosorbent assay(ELISA). The results showed that compared with the normal group, the model group had significantly increased serum levels of total cholesterol(TC), triglycerides(TG), low-density lipoprotein cholesterol(LDL-C), and resistin and significantly decreased ADPN levels. Hepatocytes in the model group exhibited loose arrangement, significant lipid accumulation, fatty degeneration, and pronounced inflammatory cell infiltration. In liver tissue, the mRNA transcriptional levels of solute carrier family 7 member 2(Slc7a2), solute carrier family 38 member 2(Slc38a2), solute carrier family 38 member 4(Slc38a4), and arginase(ARG) were significantly downregulated, while the mRNA transcriptional levels of solute carrier family 1 member 4(Slc1a4), solute carrier family 16 member 1(Slc16a1), and methionine adenosyltransferase(MAT) were upregulated. Furthermore, the mRNA transcription and protein expression levels of branched-chain α-keto acid dehydrogenase E1α(BCKDHA) and DEP domain-containing mTOR-interacting protein(DEPTOR) were downregulated, while mRNA transcription and protein expression levels of mTOR, as well as ribosomal protein S6 kinase 1(S6K1), were upregulated. The levels of BCAAs and S-adenosyl-L-methionine(SAM) were elevated. The serum level of 6-hydroxymelatonin was significantly reduced, while imidazole-4-one-5-propionic acid and N-(5-phospho-D-ribosyl)anthranilic acid levels were significantly increased. Compared with the model group, Qingrun Decoction significantly reduced blood lipid and resistin levels while increasing ADPN levels. Hepatocytes had improved morphology with reduced inflammatory cells, and fatty degeneration and lipid deposition were alleviated. Differentially expressed genes and differential metabolites were mainly enriched in amino acid metabolic pathways. The expression levels of Slc7a2, Slc38a2, Slc38a4, and ARG in the liver tissue were significantly upregulated, while Slc1a4, Slc16a1, and MAT expression levels were significantly downregulated. BCKDHA and DEPTOR expression levels were upregulated, while mTOR and S6K1 expression levels were downregulated. Additionally, the levels of BCAAs and SAM were significantly decreased. The serum level of 6-hydroxymelatonin was increased, while those of imidazole-4-one-5-propionic acid and N-(5-phospho-D-ribosyl)anthranilic acid were decreased. In summary, Qingrun Decoction may improve amino acid metabolism reprogramming, inhibit mTOR pathway activation, alleviate insulin resistance in the liver, and mitigate pathological damage of liver tissue in T2DM rats by downregulating hepatic BCAAs and SAM and regulating key enzymes involved in amino acid metabolism, such as BCKDHA, ARG, and MAT, as well as amino acid metabolites and transporters.
Animals
;
Drugs, Chinese Herbal/administration & dosage*
;
Rats
;
Insulin Resistance
;
Diabetes Mellitus, Type 2/genetics*
;
Male
;
Liver/drug effects*
;
Amino Acids/metabolism*
;
Rats, Sprague-Dawley
;
Humans
;
Metabolic Reprogramming
10.Blood glucose-lowering mechanism of Poria aqueous extract by UPLC-Q-TOF-MS/MS combined with network pharmacology and experimental verification.
Dan-Dan ZHANG ; Wen-Biao WAN ; Qing YAO ; Fang LI ; Zi-Yin YAO ; Xiao-Chuan YE
China Journal of Chinese Materia Medica 2025;50(14):3980-3989
Ultra performance liquid chromatography-quadrupole-time-of-flight-mass spectrometry/mass spectrometry(UPLC-Q-TOF-MS/MS), network pharmacology, and animal experiments were integrated o explore the blood glucose-lowering effects and mechanisms of Poria aqueous extract. Firstly, the active components of Poria aqueous extract were identified by UPLC-Q-TOF-MS/MS. Subsequently, network pharmacology was employed to predict the blood glucose-lowering components and mechanisms of Poria aqueous extract. Finally, a rat model of diabetes mellitus, 16S rDNA sequencing, and Western blot were employed to investigate the blood glucose-lowering effect and mechanism of Poria aqueous extract. A total of 39 triterpenoids were identified in the Poria aqueous extract, among them, 25-hydroxypachymic acid, 25α-hydroxytumulosic acid, 16α-hydroxytrametenolic acid, polyporenic acid C, and tumulosic acid may be the main active ingredients for treating diabetes. The Kyoto Encyclopedia of Genes and Genomes(KEGG) pathway enrichment analysis revealed that Poria might exert its therapeutic effects through multiple pathways such as NOD-like receptor signaling pathway, nuclear factor-kappa B(NF-κB) signaling pathway, and tumor necrosis factor(TNF) signaling pathway. The results of animal experiments demonstrated that Poria aqueous extract significantly reduced the levels of blood glucose and lipids and regulated the intestinal flora in diabetic rats. The main affected taxa included g_Escherichia-Shigella, g_Corynebacterium, g_Prevotella_9, g_Prevotellaceae_UCG-001, and g_Bacteroidota_unclassified. In addition, Poria aqueous extract lowered the levels of D-lactic acid and lipopolysaccharide, alleviated colonic mucosal damage, significantly down-regulated the protein levels of NOD-like receptor pyrin domain-containing protein 3(NLRP3), NF-κB, and TNF-α, and significantly up-regulated the protein levels of zonula occludens 1 and occludin in diabetic rates. Poria aqueous extract may play a role in treating diabetes mellitus by repairing the intestinal flora disturbance, protecting the intestinal barrier function, and inhibiting the NF-κB/NLRP3 signaling pathway. The results provide a scientific basis for clinical application and expansion of indications of Poria.
Animals
;
Rats
;
Network Pharmacology
;
Tandem Mass Spectrometry
;
Male
;
Drugs, Chinese Herbal/pharmacology*
;
Chromatography, High Pressure Liquid
;
Blood Glucose/drug effects*
;
Rats, Sprague-Dawley
;
Hypoglycemic Agents/administration & dosage*
;
Poria/chemistry*
;
Diabetes Mellitus, Experimental/metabolism*
;
NF-kappa B/genetics*
;
Gastrointestinal Microbiome/drug effects*
;
Humans

Result Analysis
Print
Save
E-mail