1.Predicting Diabetic Retinopathy Using a Machine Learning Approach Informed by Whole-Exome Sequencing Studies.
Chong Yang SHE ; Wen Ying FAN ; Yun Yun LI ; Yong TAO ; Zu Fei LI
Biomedical and Environmental Sciences 2025;38(1):67-78
OBJECTIVE:
To establish and validate a novel diabetic retinopathy (DR) risk-prediction model using a whole-exome sequencing (WES)-based machine learning (ML) method.
METHODS:
WES was performed to identify potential single nucleotide polymorphism (SNP) or mutation sites in a DR pedigree comprising 10 members. A prediction model was established and validated in a cohort of 420 type 2 diabetic patients based on both genetic and demographic features. The contribution of each feature was assessed using Shapley Additive explanation analysis. The efficacies of the models with and without SNP were compared.
RESULTS:
WES revealed that seven SNPs/mutations ( rs116911833 in TRIM7, 1997T>C in LRBA, 1643T>C in PRMT10, rs117858678 in C9orf152, rs201922794 in CLDN25, rs146694895 in SH3GLB2, and rs201407189 in FANCC) were associated with DR. Notably, the model including rs146694895 and rs201407189 achieved better performance in predicting DR (accuracy: 80.2%; sensitivity: 83.3%; specificity: 76.7%; area under the receiver operating characteristic curve [AUC]: 80.0%) than the model without these SNPs (accuracy: 79.4%; sensitivity: 80.3%; specificity: 78.3%; AUC: 79.3%).
CONCLUSION
Novel SNP sites associated with DR were identified in the DR pedigree. Inclusion of rs146694895 and rs201407189 significantly enhanced the performance of the ML-based DR prediction model.
Diabetic Retinopathy/diagnosis*
;
Humans
;
Machine Learning
;
Male
;
Female
;
Polymorphism, Single Nucleotide
;
Middle Aged
;
Exome Sequencing
;
Aged
;
Adult
;
Pedigree
;
Diabetes Mellitus, Type 2/complications*
;
Genetic Predisposition to Disease
;
Mutation
2.Research on type 2 diabetes prediction algorithm based on photoplethysmography.
Mingying HU ; Quanyu WU ; Yifan CAO ; Jin CAO ; Yifan ZHAO ; Lin ZHANG ; Xiaojie LIU
Journal of Biomedical Engineering 2025;42(5):1005-1011
To address the current issues of data imbalance and scarcity in photoplethysmography (PPG) data for type 2 diabetes mellitus (T2DM) prediction, this study proposes an improved conditional Wasserstein generative adversarial network with gradient penalty (CWGAN-GP). The algorithm integrated gated recurrent unit (GRU) networks and self-attention mechanisms to construct a generator, aiming to produce high-quality PPG signals. Various data augmentation methods, including the improved CWGAN-GP, were employed to expand the PPG dataset, and multiple classifiers were applied for T2DM prediction analysis. Experimental results showed that the model trained on data generated by the improved CWGAN-GP achieved the optimal prediction performance. The highest accuracy reached 0.895 0, and compared with other data enhancement methods, this approach exhibited significant advantages in terms of precision and F1-score. The generated data notably enhances the accuracy and generalization ability of T2DM prediction models, providing a more reliable technical basis for non-invasive early T2DM screening based on PPG signals.
Photoplethysmography/methods*
;
Diabetes Mellitus, Type 2/diagnosis*
;
Humans
;
Algorithms
;
Neural Networks, Computer
;
Signal Processing, Computer-Assisted
;
Prediction Algorithms
3.Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood.
Juan YE ; Feng YE ; Ling HOU ; Wei WU ; Xiao-Ping LUO ; Yan LIANG
Chinese Journal of Contemporary Pediatrics 2025;27(1):94-100
OBJECTIVES:
To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.
METHODS:
A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.
RESULTS:
All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.
CONCLUSIONS
This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Male
;
Female
;
Child
;
Retrospective Studies
;
Glucokinase/genetics*
;
Adolescent
;
Child, Preschool
;
Glucose Tolerance Test
4.Research progress and optimization strategies for early screening of type 1 diabetes.
Chinese Journal of Contemporary Pediatrics 2025;27(11):1310-1316
The prevalence of type 1 diabetes (T1DM) is increasing annually, and its complications seriously impair the quality of life of affected children. Early screening for T1DM helps reduce the occurrence of diabetic ketoacidosis, protect β-cell function, and delay disease onset in high-risk populations. This article summarizes current domestic and international screening technologies for T1DM. Screening methods remain centered on detection of diabetes-related antibodies and glycometabolic markers, while factors related to disease pathogenesis hold promise as sensitive screening markers. Expanding T1DM screening in China is expected to improve early diagnosis and treatment.
Diabetes Mellitus, Type 1/diagnosis*
;
Humans
;
Early Diagnosis
;
Autoantibodies/blood*
;
Mass Screening/methods*
5.Application of salivary micro-ecosystem in early prevention and control of oral and systemic diseases.
Xiangyu SUN ; Chao YUAN ; Xinzhu ZHOU ; Jing DIAO ; Shuguo ZHENG
Journal of Peking University(Health Sciences) 2025;57(5):859-863
Saliva is an important body fluid in the oral cavity containing lots of biomarkers, whose inherent micro-ecosystem holds significant value for early diagnosis and monitoring of oral diseases. Simultaneously, saliva has particular advantages, such as ease of sampling, painless and non-invasive collection, and suitability for repeated sampling, making it highly appropriate for surveillance and follow-up of diseases. In a series of studies conducted by the research group for preventive dentistry in Peking University School and Hospital of Stomatology, we compared different segments of saliva and those samples collected via different sampling methods using proteomic/peptidomic and microbiomic technologies to explore the stability of saliva samples. Besides, the significance of applying representative salivary biomarkers in early prevention and control of representative oral diseases (e.g. dental caries, periodontal diseases) and systemic conditions (e.g. type 2 diabetes mellitus, chronic kidney disease) was confirmed as well.
Humans
;
Saliva/chemistry*
;
Dental Caries/diagnosis*
;
Biomarkers/analysis*
;
Periodontal Diseases/diagnosis*
;
Mouth Diseases/diagnosis*
;
Proteomics/methods*
;
Diabetes Mellitus, Type 2/diagnosis*
;
Microbiota
;
Renal Insufficiency, Chronic/prevention & control*
7.Associations between glycated hemoglobin and glucose indicators in adults in areas at different altitude in China.
Xiao ZHANG ; Mei ZHANG ; Chun LI ; Zheng Jing HUANG ; Meng Ting YU ; Li Min WANG
Chinese Journal of Epidemiology 2023;44(3):401-407
Objective: To explore the associations of glycated hemoglobin (HbA1c) with FPG and oral glucose tolerance test 2-hour (OGTT-2 h) in areas at different altitude in China. Methods: Subjects who participated in 2018-2019 China Chronic Disease and Risk Factor Surveillance and had no prior type 2 diabetes diagnosis were included. Subsequently, they were categorized into three groups based on altitude of living area (<2 000, 2 000- and ≥3 000 m). With adjustment for intracluster correlation, multivariable linear regression analysis was performed to evaluate the associations of HbA1c with FPG and OGTT-2 h in the context of HbA1c was normal (<5.7%) or abnormal (≥5.7%). Furthermore, the shape of relationships between HbA1c and glucose indicators was examined using restricted cubic spline. Finally, receiver operating characteristic curve was used to evaluate the diagnostic performance of HbA1c for diabetes. Results: A total of 157 277 subjects were included in the analysis. While FPG and OGTT-2 h levels gradually decreased with increase of altitude, HbA1c level was similar among the three groups. When HbA1c was <5.7%, its association with FPG and OGTT-2 h was weak and no obvious difference was observed among the three groups. When HbA1c was ≥5.7%, the FPG and OGTT-2 h increased by 15.45% (95%CI:14.71%- 16.18%) and 24.54% (95%CI:23.18%-25.91%) respectively per one standard deviation increase in HbA1c in group in area at altitude <2 000 m. However, the FPG and OGTT-2 h increased by 13.08% (95%CI:10.46%-15.76%) and 21.72% (95%CI:16.39%-27.31%), respectively, in group in area at altitude 2 000- m, and increased by 11.41% (95%CI:9.32%-13.53%) and 20.03% (95%CI:15.38%- 24.86%), respectively, in group of altitude ≥3 000 m. The restricted cubic spline indicated that the curve showing the association of HbA1c with FPG and OGTT-2 h was flat when HbA1c was <5.7%, but showed a positive linear relationship when HbA1c was ≥5.7%. The area under curve for detecting diabetes was 0.808 (95%CI:0.803-0.812) in group of altitude <2 000 m and 0.728 (95%CI:0.660-0.796, P=0.022) in group of altitude ≥3 000 m. The relevant optimal cutoff value of HbA1c was 5.7%, with a sensitivity of 65.4% and a specificity of 83.0%, and 6.0%, with a sensitivity of 48.3% and a specificity of 93.7%, respectively. Conclusions: When HbA1c was ≥5.7%, the association between HbA1c and glucose indicators became weaker as the increase of altitude. In the area at altitude ≥3 000 m, it may not be appropriate to use HbA1c in the diagnosis of diabetes.
Adult
;
Humans
;
Glycated Hemoglobin
;
Diabetes Mellitus, Type 2/diagnosis*
;
Blood Glucose/analysis*
;
Glucose
;
Altitude
;
Fasting
;
China/epidemiology*
;
Diabetes Mellitus/epidemiology*
8.Prevalence of maturity-onset diabetes of the young in phenotypic type 2 diabetes in young adults: a nationwide, multi-center, cross-sectional survey in China.
Yan CHEN ; Jing ZHAO ; Xia LI ; Zhiguo XIE ; Gan HUANG ; Xiang YAN ; Houde ZHOU ; Li ZHENG ; Tao XU ; Kaixin ZHOU ; Zhiguang ZHOU
Chinese Medical Journal 2023;136(1):56-64
BACKGROUND:
Maturity-onset diabetes of the young (MODY) is the most common monogenic diabetes. The aim of this study was to assess the prevalence of MODY in phenotypic type 2 diabetes (T2DM) among Chinese young adults.
METHODS:
From April 2015 to October 2017, this cross-sectional study involved 2429 consecutive patients from 46 hospitals in China, newly diagnosed between 15 years and 45 years, with T2DM phenotype and negative for standardized glutamic acid decarboxylase antibody at the core laboratory. Sequencing using a custom monogenic diabetes gene panel was performed, and variants of 14 MODY genes were interpreted as per current guidelines.
RESULTS:
The survey determined 18 patients having genetic variants causing MODY (6 HNF1A , 5 GCK , 3 HNF4A , 2 INS , 1 PDX1 , and 1 PAX4 ). The prevalence of MODY was 0.74% (95% confidence interval [CI]: 0.40-1.08%). The clinical characteristics of MODY patients were not specific, 72.2% (13/18) of them were diagnosed after 35 years, 47.1% (8/17) had metabolic syndrome, and only 38.9% (7/18) had a family history of diabetes. No significant difference in manifestations except for hemoglobin A1c levels was found between MODY and non-MODY patients.
CONCLUSION
The prevalence of MODY in young adults with phenotypic T2DM was 0.74%, among which HNF1A -, GCK -, and HNF4A -MODY were the most common subtypes. Clinical features played a limited role in the recognition of MODY.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Cross-Sectional Studies
;
Mutation
;
Prevalence
;
Phenotype
9.Decreasing complexity of glucose time series derived from continuous glucose monitoring is correlated with deteriorating glucose regulation.
Cheng LI ; Xiaojing MA ; Jingyi LU ; Rui TAO ; Xia YU ; Yifei MO ; Wei LU ; Yuqian BAO ; Jian ZHOU ; Weiping JIA
Frontiers of Medicine 2023;17(1):68-74
Most information used to evaluate diabetic statuses is collected at a special time-point, such as taking fasting plasma glucose test and providing a limited view of individual's health and disease risk. As a new parameter for continuously evaluating personal clinical statuses, the newly developed technique "continuous glucose monitoring" (CGM) can characterize glucose dynamics. By calculating the complexity of glucose time series index (CGI) with refined composite multi-scale entropy analysis of the CGM data, the study showed for the first time that the complexity of glucose time series in subjects decreased gradually from normal glucose tolerance to impaired glucose regulation and then to type 2 diabetes (P for trend < 0.01). Furthermore, CGI was significantly associated with various parameters such as insulin sensitivity/secretion (all P < 0.01), and multiple linear stepwise regression showed that the disposition index, which reflects β-cell function after adjusting for insulin sensitivity, was the only independent factor correlated with CGI (P < 0.01). Our findings indicate that the CGI derived from the CGM data may serve as a novel marker to evaluate glucose homeostasis.
Humans
;
Glucose
;
Blood Glucose
;
Insulin Resistance/physiology*
;
Diabetes Mellitus, Type 2/diagnosis*
;
Blood Glucose Self-Monitoring
;
Time Factors
;
Insulin
10.HbA1c comparison and diagnostic efficacy analysis of multi center different glycosylated hemoglobin detection systems.
Ping LI ; Ying WU ; Yan XIE ; Feng CHEN ; Shao qiang CHEN ; Yun Hao LI ; Qing Qing LU ; Jing LI ; Yong Wei LI ; Dong Xu PEI ; Ya Jun CHEN ; Hui CHEN ; Yan LI ; Wei WANG ; Hai WANG ; He Tao YU ; Zhu BA ; De CHENG ; Le Ping NING ; Chang Liang LUO ; Xiao Song QIN ; Jin ZHANG ; Ning WU ; Hui Jun XIE ; Jina Hua PAN ; Jian SHUI ; Jian WANG ; Jun Ping YANG ; Xing Hui LIU ; Feng Xia XU ; Lei YANG ; Li Yi HU ; Qun ZHANG ; Biao LI ; Qing Lin LIU ; Man ZHANG ; Shou Jun SHEN ; Min Min JIANG ; Yong WU ; Jin Wei HU ; Shuang Quan LIU ; Da Yong GU ; Xiao Bing XIE
Chinese Journal of Preventive Medicine 2023;57(7):1047-1058
Objective: Compare and analyze the results of the domestic Lanyi AH600 glycated hemoglobin analyzer and other different detection systems to understand the comparability of the detection results of different detectors, and establish the best cut point of Lanyi AH600 determination of haemoglobin A1c (HbA1c) in the diagnosis of diabetes. Methods: Multi center cohort study was adopted. The clinical laboratory departments of 18 medical institutions independently collected test samples from their respective hospitals from March to April 2022, and independently completed comparative analysis of the evaluated instrument (Lanyi AH600) and the reference instrument HbA1c. The reference instruments include four different brands of glycosylated hemoglobin meters, including Arkray, Bio-Rad, DOSOH, and Huizhong. Scatter plot was used to calculate the correlation between the results of different detection systems, and the regression equation was calculated. The consistency analysis between the results of different detection systems was evaluated by Bland Altman method. Consistency judgment principles: (1) When the 95% limits of agreement (95% LoA) of the measurement difference was within 0.4% HbA1c and the measurement score was≥80 points, the comparison consistency was good; (2) When the measurement difference of 95% LoA exceeded 0.4% HbA1c, and the measurement score was≥80 points, the comparison consistency was relatively good; (3) The measurement score was less than 80 points, the comparison consistency was poor. The difference between the results of different detection systems was tested by paired sample T test or Wilcoxon paired sign rank sum test; The best cut-off point of diabetes was analyzed by receiver operating characteristic curve (ROC). Results: The correlation coefficient R2 of results between Lanyi AH600 and the reference instrument in 16 hospitals is≥0.99; The Bland Altman consistency analysis showed that the difference of 95% LoA in Nanjing Maternity and Child Health Care Hospital in Jiangsu Province (reference instrument: Arkray HA8180) was -0.486%-0.325%, and the measurement score was 94.6 points (473/500); The difference of 95% LoA in the Tibetan Traditional Medical Hospital of TAR (reference instrument: Bio-Rad Variant II) was -0.727%-0.612%, and the measurement score was 89.8 points; The difference of 95% LoA in the People's Hospital of Chongqing Liang Jiang New Area (reference instrument: Huizhong MQ-2000PT) was -0.231%-0.461%, and the measurement score was 96.6 points; The difference of 95% LoA in the Taihe Hospital of traditional Chinese Medicine in Anhui Province (reference instrument: Huizhong MQ-2000PT) was -0.469%-0.479%, and the measurement score was 91.9 points. The other 14 hospitals, Lanyi AH600, were compared with 4 reference instrument brands, the difference of 95% LoA was less than 0.4% HbA1c, and the scores were all greater than 95 points. The results of paired sample T test or Wilcoxon paired sign rank sum test showed that there was no statistically significant difference between Lanyi AH600 and the reference instrument Arkray HA8180 (Z=1.665,P=0.096), with no statistical difference. The mean difference between the measured values of the two instruments was 0.004%. The comparison data of Lanyi AH600 and the reference instrument of all other institutions had significant differences (all P<0.001), however, it was necessary to consider whether it was within the clinical acceptable range in combination with the results of the Bland-Altman consistency analysis. The ROC curve of HbA1c detected by Lanyi AH600 in 985 patients with diabetes and 3 423 patients with non-diabetes was analyzed, the area under curve (AUC) was 0.877, the standard error was 0.007, and the 95% confidence interval 95%CI was (0.864, 0.891), which was statistically significant (P<0.001). The maximum value of Youden index was 0.634, and the corresponding HbA1c cut point was 6.235%. The sensitivity and specificity of diabetes diagnosis were 76.2% and 87.2%, respectively. Conclusion: Among the hospitals and instruments currently included in this study, among these four hospitals included Nanjing Maternity and Child Health Care Hospital in Jiangsu Province (reference instrument: Arkray HA8180), Tibetan Traditional Medical Hospital of TAR (reference instrument: Bio-Rad Variant Ⅱ), the People's Hospital of Chongqing Liang Jiang New Area (reference instrument: Huizhong MQ-2000PT), and the Taihe Hospital of traditional Chinese Medicine in Anhui Province (reference instrument: Huizhong MQ-2000PT), the comparison between Lanyi AH600 and the reference instruments showed relatively good consistency, while the other 14 hospitals involved four different brands of reference instruments: Arkray, Bio-Rad, DOSOH, and Huizhong, Lanyi AH600 had good consistency with its comparison. The best cut point of the domestic Lanyi AH600 for detecting HbA1c in the diagnosis of diabetes is 6.235%.
Pregnancy
;
Child
;
Humans
;
Female
;
Glycated Hemoglobin
;
Cohort Studies
;
Diabetes Mellitus/diagnosis*
;
Sensitivity and Specificity
;
ROC Curve

Result Analysis
Print
Save
E-mail