OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

To explore the mechanisms for Type 2 diabetes mellitus (T2DM) in children and provide genomic evidence for its early diagnosis and treatment.
 Methods: The peripheral blood gene chip datasets from 12 children with T2DM and 24 healthy children were retrieved from the Gene Expression Omnibus (GEO) at National Center for Biotechnology Information (NCBI). The differentially expressed genes were screened by R language software. GenCLiP 2.0, STRING, and Cytoscape software were used to analyze the biological functions, protein-protein interaction network, signal pathway, gene-pathway network, expression of key genes, and predictive value between the two differentially expressed genes.
 Results: A total of 79 differentially expressed genes were identified. Among them, 58 (73.42%) were up-regulated, and 21 (26.58%) were down-regulated. Differentially expressed genes mainly involved molecular functions and biological processes, such as defensive response, response to external stimulus, and inflammatory responses. At the same time, they were mainly involved in the Leishmaniasis, cytokine-cytokine receptor interaction, Toll-like receptor signaling pathway. interleukin 1β (IL-1β), jun proto-oncogene (JUN), and IL-8 were 3 important linking nodes in the protein-protein interaction network. JUN and IL-1β were key genes, which were related to interleukin 17 (1L-17) signaling pathway, Toll-like receptor signaling pathway and so on. The expression of JUN gene in peripheral blood of children with T2DM was decreased while the expression of IL-1β gene was increased. JUN and IL-1β genes possessed certain diagnostic and predictive value in children with T2DM.
 Conclusion: The gene expression profile of peripheral blood in children with T2DM changes significantly. The genes of JUN and IL-1β are closely related to T2DM in children. IL-1β gene expression level shows a better predictive value on T2DM in children.
Child ; Diabetes Mellitus, Type 2 ; diagnosis ; genetics ; therapy ; Down-Regulation ; Gene Expression Profiling ; Humans ; Interleukin-1beta ; genetics ; Oligonucleotide Array Sequence Analysis ; Proto-Oncogene Proteins c-jun ; genetics ; Signal Transduction ; genetics ; Software ; Transcriptome ; Up-Regulation

Contribution of genetic predisposition to risk prediction of type 2 diabetes mellitus (T2DM) was investigated using a prospective study in middle-aged adults in Korea. From a community cohort of 6,257 subjects with 8 yr' follow-up, genetic predisposition score with subsets of 3, 18, 36 selected single nucleotide polymorphisms (SNPs) (genetic predisposition score; GPS-3, GPS-18, GPS-36) in association with T2DM were determined, and their effect was evaluated using risk prediction models. Rs5215, rs10811661, and rs2237892 were in significant association with T2DM, and hazard ratios per risk allele score increase were 1.11 (95% confidence intervals: 1.06-1.17), 1.09 (1.01-1.05), 1.04 (1.02-1.07) with GPS-3, GPS-18, GPS-36, respectively. Changes in AUC upon addition of GPS were significant in simple and clinical models, but the significance disappeared in full clinical models with glycated hemoglobin (HbA1c). For net reclassification index (NRI), significant improvement observed in simple (range 5.1%-8.6%) and clinical (3.1%-4.4%) models were no longer significant in the full models. Influence of genetic predisposition in prediction ability of T2DM incidence was no longer significant when HbA1c was added in the models, confirming HbA1c as a strong predictor for T2DM risk. Also, the significant SNPs verified in our subjects warrant further research, e.g. gene-environmental interaction and epigenetic studies.
Adult ; Aged ; Cohort Studies ; Diabetes Mellitus, Type 2/diagnosis/*epidemiology/*genetics ; Female ; Genetic Association Studies ; Genetic Predisposition to Disease/*epidemiology/*genetics ; Genetic Testing/methods ; Humans ; Incidence ; Male ; Middle Aged ; Polymorphism, Single Nucleotide/*genetics ; *Proportional Hazards Models ; Reproducibility of Results ; Republic of Korea/epidemiology ; Risk Assessment/methods ; Sensitivity and Specificity

OBJECTIVETo explore the clinical and gene mutation characteristics of a child with maturity-onset diabetes of the young 2 (MODY2).

METHODThe clinical and follow-up data of 1 patient with MODY2 were reviewed. GCK mutational analysis was performed by PCR and direct sequencing in the proband and his family members.

RESULTThe 9 years and 6 months old boy was referred to our department for short stature and mild hyperglycemia. His fasting blood glucose was elevated to 7.4-7.8 mmol/L, hemoglobin A1C 6.7%. His height was 122 cm (-2 s), weight 25 kg (-1 s), body mass index (BMI) 16.8 kg/m(2). His physical exam was unremarkable without dysmorphic features or acanthosis nigricans. The oral glucose tolerance test (OGTT) showed fasting glucose 8.17 mmol/L, insulin <2.0 mU/L, 2 h glucose 8.69 mmol/L, insulin 5.06 mU /L. The boy was treated with insulin injection for half a year. His fasting blood glucose was stable at 5.6-8.5 mmol/L, hemoglobin A1C 6.7%-6.8%. His mother's fasting blood glucose was 6.86 mmol/L, OGTT 2 h blood glucose 10.36 mmol/L, hemoglobin A1C 6.8%. GCK sequence revealed a novel GCK mutation c.34_44+15del26 in the proband and his mother, which was co-segregated with diabetes. The boy's treatment was shifted from insulin injection to diet and exercise after the diagnosis of MODY2 was confirmed. Being followed up for 2 and a half years, his fasting blood glucose was stable at 4.6-8.0 mmol/L and hemoglobin A1C 6.8%-7.1%.

CONCLUSIONThe clinical features of MODY2 are persistent and stable fasting hyperglycemia over a period of months or years and small blood glucose increment (less than 3 mmol/L) after an OGTT (2 h glucose-fasting glucose). We identified a novel c.34_44+15del26 mutation in GCK which co-segregated with diabetes phenotype in this family.

Asian Continental Ancestry Group ; genetics ; Blood Glucose ; Child ; Diabetes Mellitus, Type 2 ; diagnosis ; genetics ; Fasting ; Follow-Up Studies ; Glucokinase ; genetics ; Glucose Tolerance Test ; Glycated Hemoglobin A ; Humans ; Hyperglycemia ; Insulin ; Male ; Mutation ; Phenotype

No abstract available.
Aged ; Anti-Bacterial Agents/therapeutic use ; Bursitis/*diagnosis/drug therapy/microbiology ; Cefoperazone/therapeutic use ; Diabetes Mellitus, Type 2/complications/*diagnosis ; Humans ; Male ; Nocardia/genetics/*isolation & purification ; Polymerase Chain Reaction ; RNA, Ribosomal, 16S/chemistry/genetics ; Sequence Analysis, RNA ; Sulbactam/therapeutic use

No abstract available.
Asian Continental Ancestry Group ; Bacteremia/complications/*diagnosis/microbiology ; Base Sequence ; Diabetes Mellitus, Type 2/*complications ; Diabetic Foot/microbiology ; Gram-Positive Cocci/genetics/*isolation & purification ; Humans ; Male ; Middle Aged ; RNA, Ribosomal, 16S/chemistry/genetics ; Republic of Korea

No abstract available.
Acupuncture Therapy ; Ampicillin/pharmacology/therapeutic use ; Ankle/ultrasonography ; Anti-Bacterial Agents/pharmacology/therapeutic use ; Cellulitis/complications/diagnosis/drug therapy/*microbiology ; Diabetes Mellitus, Type 2/complications ; Gram-Negative Bacterial Infections/complications/diagnosis/drug therapy/*microbiology ; Humans ; Hypertension/complications ; Magnetic Resonance Imaging ; Male ; Microbial Sensitivity Tests ; Middle Aged ; Prevotella nigrescens/drug effects/*genetics/isolation & purification ; RNA, Ribosomal, 16S/*analysis ; Sulbactam/pharmacology/therapeutic use ; Tomography, X-Ray Computed

Biomarkers ; blood ; metabolism ; Diabetes Mellitus, Type 2 ; blood ; diagnosis ; genetics ; metabolism ; Humans ; MicroRNAs ; genetics ; Polymorphism, Single Nucleotide ; genetics ; Precision Medicine ; methods

BACKGROUND/AIMS: This study was conducted to examine the relationship between family history of type 2 diabetes (T2DM) and risk of developing gestational diabetes mellitus (GDM) in Korean women. METHODS: We performed a 100-g oral glucose tolerance test in 858 pregnant women who had abnormal glucose tolerance in 50-g oral glucose challenge. In addition, we reviewed the incidence of T2DM in the parents and siblings and analyzed the association between the familial history of T2DM and the risk of GDM. RESULTS: Of the 858 subjects, 427 were normal, and 431 were diagnosed with GDM. Compared with women with no family history of T2DM, women with first degree family history of T2DM displayed higher risk of T2DM (odd ratio: parent only 1.91, sibling only 6.24, any 2.27). CONCLUSIONS: The risk of developing GDM was significantly increased in Korean women with a family history of T2DM in first-degree relatives.
Adult ; Cluster Analysis ; Diabetes Mellitus, Type 2/*genetics ; Diabetes, Gestational/diagnosis/*genetics ; Female ; Genetic Predisposition to Disease ; Glucose Tolerance Test ; Humans ; Korea ; Male ; Parents ; Pregnancy ; Risk Factors ; Siblings

OBJECTIVETo study the function of pancreatic islet beta cells, insulin resistance (IR) and features of TCM symptoms and syndromes in the non-diabetic first-grade relatives (ND1GR) of patients with type 2 diabetes mellitus (DM2).

METHODSA total of 68 ND1GR of DM2 patients were enrolled in the observed group and 45 healthy subjects with matched sex, age and body mass index (BMI) but without family history of DM were selected into the control group. Levels of fasting blood glucose (FBG), 2 hrs postprandial glucose (2hPG), fasting insulin (FINS) and 2 hrs postprandial insulin (2h INS) in all the subjects were measured to calculate and compare the IR and beta-cell function of the homeostatic model analog (HOMA-IR and HOMA-beta), and the insulin sensitive index (ISI). Moreover, the symptoms manifested in the ND1GR were also observed to analyze the features in them.

RESULTSFBG and FINS were obviously higher in the observed group than those in the control group (P < 0.01), while no significant difference was found in 2hPG or 2h INS (P > 0.05). HOMA-IR and HOMA-beta were significantly higher (P < 0.05) and ISI were significantly lower (P < 0.01) in the observed group than those in the control group. Compared with the control group, the main symptoms such as dark purplish tongue, listlessness, thready and thin pulse, lassitude in loin and legs in the observed group were seen more frequently. In the observed group syndrome of deficiency of Qi and Yin accounted for 51.47%, syndrome of deficiency of Yin for 30.88%, subjects with syndrome of blood stasis as the main accompanying syndrome accounts for 61.76%.

CONCLUSIONHigher beta cell secretion function and lower insulin sensitivity appear in ND1GR of DM2 patients, suggesting the existence of insulin resistance. The feature of TCM syndrome in them is characterized by deficiency of Qi and Yin with inner obstruction of blood stasis.

Adult ; Diabetes Mellitus, Type 2 ; genetics ; Diagnosis, Differential ; Female ; Glucose Tolerance Test ; Humans ; Insulin Resistance ; Insulin-Secreting Cells ; physiology ; Male ; Medicine, Chinese Traditional ; Middle Aged