BACKGROUND: Gluconeogenesis is a critical metabolic pathway for maintaining glucose homeostasis, and its dysregulation can lead to glycometabolic disorders. This study aimed to identify hub biomarkers of these disorders to provide a theoretical foundation for enhancing diagnosis and treatment. METHODS: Gene expression profiles from liver tissues of three well-characterized gluconeogenesis mouse models were analyzed to identify commonly differentially expressed genes (DEGs). Weighted gene co-expression network analysis (WGCNA), machine learning techniques, and diagnostic tests on transcriptome data from publicly available datasets of type 2 diabetes mellitus (T2DM) patients were employed to assess the clinical relevance of these DEGs. Subsequently, we identified hub biomarkers associated with gluconeogenesis-related glycometabolic disorders, investigated potential correlations with immune cell types, and validated expression using quantitative polymerase chain reaction in the mouse models. RESULTS: Only a few common DEGs were observed in gluconeogenesis-related glycometabolic disorders across different contributing factors. However, these DEGs were consistently associated with cytokine regulation and oxidative stress (OS). Enrichment analysis highlighted significant alterations in terms related to cytokines and OS. Importantly, osteomodulin ( OMD ), apolipoprotein A4 ( APOA4 ), and insulin like growth factor binding protein 6 ( IGFBP6 ) were identified with potential clinical significance in T2DM patients. These genes demonstrated robust diagnostic performance in T2DM cohorts and were positively correlated with resting dendritic cells. CONCLUSIONS Gluconeogenesis-related glycometabolic disorders exhibit considerable heterogeneity, yet changes in cytokine regulation and OS are universally present. OMD , APOA4 , and IGFBP6  may serve as hub biomarkers for gluconeogenesis-related glycometabolic disorders.
Machine Learning ; Humans ; Computational Biology/methods* ; Biomarkers/metabolism* ; Diabetes Mellitus, Type 2/genetics* ; Animals ; Mice ; Gluconeogenesis/physiology* ; Gene Expression Profiling ; Transcriptome/genetics* ; Gene Regulatory Networks/genetics* ; Clinical Relevance

This study aims to investigate the mechanism of Qingrun Decoction in alleviating hepatic insulin resistance in type 2 diabetes mellitus(T2DM) rats through the reprogramming of amino acid metabolism. A T2DM rat model was established by inducing insulin resistance through a high-fat diet combined with intraperitoneal injection of streptozotocin. The model rats were randomly divided into five groups: model group, high-, medium-, and low-dose Qingrun Decoction groups, and metformin group. A normal control group was also established. The rats in the normal and model groups received 10 mL·kg~(-1) distilled water daily by gavage. The metformin group received 150 mg·kg~(-1) metformin suspension by gavage, and the Qingrun Decoction groups received 11.2, 5.6, and 2.8 g·kg~(-1) Qingrun Decoction by gavage for 8 weeks. Blood lipid levels were measured in different groups of rats. Pathological damage in rat liver tissue was assessed by hematoxylin-eosin(HE) staining and oil red O staining. Transcriptome sequencing and untargeted metabolomics were performed on rat liver and serum samples, integrated with bioinformatics analyses. Key metabolites(branched-chain amino acids, BCAAs), amino acid transporters, amino acid metabolites, critical enzymes for amino acid metabolism, resistin, adiponectin(ADPN), and mammalian target of rapamycin(mTOR) pathway-related molecules were quantified using quantitative real-time polymerase chain reaction(qRT-PCR), Western blot, and enzyme-linked immunosorbent assay(ELISA). The results showed that compared with the normal group, the model group had significantly increased serum levels of total cholesterol(TC), triglycerides(TG), low-density lipoprotein cholesterol(LDL-C), and resistin and significantly decreased ADPN levels. Hepatocytes in the model group exhibited loose arrangement, significant lipid accumulation, fatty degeneration, and pronounced inflammatory cell infiltration. In liver tissue, the mRNA transcriptional levels of solute carrier family 7 member 2(Slc7a2), solute carrier family 38 member 2(Slc38a2), solute carrier family 38 member 4(Slc38a4), and arginase(ARG) were significantly downregulated, while the mRNA transcriptional levels of solute carrier family 1 member 4(Slc1a4), solute carrier family 16 member 1(Slc16a1), and methionine adenosyltransferase(MAT) were upregulated. Furthermore, the mRNA transcription and protein expression levels of branched-chain α-keto acid dehydrogenase E1α(BCKDHA) and DEP domain-containing mTOR-interacting protein(DEPTOR) were downregulated, while mRNA transcription and protein expression levels of mTOR, as well as ribosomal protein S6 kinase 1(S6K1), were upregulated. The levels of BCAAs and S-adenosyl-L-methionine(SAM) were elevated. The serum level of 6-hydroxymelatonin was significantly reduced, while imidazole-4-one-5-propionic acid and N-(5-phospho-D-ribosyl)anthranilic acid levels were significantly increased. Compared with the model group, Qingrun Decoction significantly reduced blood lipid and resistin levels while increasing ADPN levels. Hepatocytes had improved morphology with reduced inflammatory cells, and fatty degeneration and lipid deposition were alleviated. Differentially expressed genes and differential metabolites were mainly enriched in amino acid metabolic pathways. The expression levels of Slc7a2, Slc38a2, Slc38a4, and ARG in the liver tissue were significantly upregulated, while Slc1a4, Slc16a1, and MAT expression levels were significantly downregulated. BCKDHA and DEPTOR expression levels were upregulated, while mTOR and S6K1 expression levels were downregulated. Additionally, the levels of BCAAs and SAM were significantly decreased. The serum level of 6-hydroxymelatonin was increased, while those of imidazole-4-one-5-propionic acid and N-(5-phospho-D-ribosyl)anthranilic acid were decreased. In summary, Qingrun Decoction may improve amino acid metabolism reprogramming, inhibit mTOR pathway activation, alleviate insulin resistance in the liver, and mitigate pathological damage of liver tissue in T2DM rats by downregulating hepatic BCAAs and SAM and regulating key enzymes involved in amino acid metabolism, such as BCKDHA, ARG, and MAT, as well as amino acid metabolites and transporters.
Animals ; Drugs, Chinese Herbal/administration & dosage* ; Rats ; Insulin Resistance ; Diabetes Mellitus, Type 2/genetics* ; Male ; Liver/drug effects* ; Amino Acids/metabolism* ; Rats, Sprague-Dawley ; Humans ; Metabolic Reprogramming

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

Maturity-onset diabetes of the young (MODY) is a special type of diabetes characterized by clinical features including early onset of diabetes (before 30 years of age), autosomal dominant inheritance, impaired glucose-induced insulin secretion, and hyperglycemia. So far, 14 types of MODY have been reported, accounting for about 1%-5% of the patients with diabetes. MODY often presents with an insidious onset, and although 14 subtypes have been identified for MODY, it is frequently misdiagnosed as type 1 or type 2 diabetes due to overlapping clinical features and high costs and limitations of genetic testing. This article reviews the clinical features of MODY subtypes in order to improve the accuracy of the diagnosis and treatment of MODY.
Humans ; Diabetes Mellitus, Type 2/genetics*

OBJECTIVES: The gut microbiota plays a crucial role in the pathophysiology of various types of diabetes. However, the causal relationship between them has yet to be systematically elucidated. This study aims to explore the potential causal associations between gut microbiota and diabetes using a two-sample Mendelian randomization (MR) analysis, based on multiple taxonomic levels. METHODS: Eligible instrumental variables were extracted from the selected genome-wide association study (GWAS) data on gut microbiota. These were combined with GWAS datasets on type 1 diabetes (T1D), type 2 diabetes (T2D), and gestational diabetes mellitus (GDM) to conduct forward MR analysis, sensitivity analysis, reverse MR analysis, and validation of significant estimates. Microbial taxa with causal effects on T1D, T2D, and GDM were identified based on a comprehensive assessment of all analytical stages. RESULTS: A total of 2 179, 2 176, and 2 166 single nucleotide polymorphisms (SNP) were included in the MR analyses for gut microbiota with T1D, T2D, and GDM, respectively. MR results indicated causal associations between: Six microbial taxa (Eggerthella, Lachnospira, Bacillales, Desulfovibrionales, Parasutterella, and Turicibacter) and T1D; 9 microbial taxa (Verrucomicrobia, Deltaproteobacteria, Actinomycetales, Desulfovibrionale, Actinomycetaceae, Desulfovibrionaceae, Actinomyces, Alcaligenaceae, and Lachnospiraceae NC2004 group) and T2D; 10 microbial taxa (Betaproteobacteria, Coprobacter, Ruminococcus2, Tenericutes, Clostridia, Methanobacteria, Mollicutes, Methanobacteriales, Methanobacteriaceae, and Methanobrevibacter) and GDM. CONCLUSIONS This study identified specific gut microbial taxa that may significantly increase or decrease the risk of developing diabetes. Some findings were fully replicated in independent validation datasets. However, the underlying biological mechanisms of these causal relationships warrant further investigation through mechanistic studies and population-based research.
Gastrointestinal Microbiome/genetics* ; Humans ; Mendelian Randomization Analysis ; Genome-Wide Association Study ; Diabetes Mellitus, Type 2/genetics* ; Diabetes Mellitus, Type 1/genetics* ; Female ; Polymorphism, Single Nucleotide ; Diabetes, Gestational/genetics* ; Pregnancy

Gut microbial communities are likely remodeled in tandem with accumulated physiological decline during aging, yet there is limited understanding of gut microbiome variation in advanced age. Here, we performed a metagenomics-based enterotype analysis in a geographically homogeneous cohort of 367 enrolled Chinese individuals between the ages of 60 and 94 years, with the goal of characterizing the gut microbiome of elderly individuals and identifying factors linked to enterotype variations. In addition to two adult-like enterotypes dominated by Bacteroides (ET-Bacteroides) and Prevotella (ET-Prevotella), we identified a novel enterotype dominated by Escherichia (ET-Escherichia), whose prevalence increased in advanced age. Our data demonstrated that age explained more of the variance in the gut microbiome than previously identified factors such as type 2 diabetes mellitus (T2DM) or diet. We characterized the distinct taxonomic and functional profiles of ET-Escherichia, and found the strongest cohesion and highest robustness of the microbial co-occurrence network in this enterotype, as well as the lowest species diversity. In addition, we carried out a series of correlation analyses and co-abundance network analyses, which showed that several factors were likely linked to the overabundance of Escherichia members, including advanced age, vegetable intake, and fruit intake. Overall, our data revealed an enterotype variation characterized by Escherichia enrichment in the elderly population. Considering the different age distribution of each enterotype, these findings provide new insights into the changes that occur in the gut microbiome with age and highlight the importance of microbiome-based stratification of elderly individuals.
Aged ; Aged, 80 and over ; Female ; Humans ; Male ; Middle Aged ; Bacteroides ; China ; Diabetes Mellitus, Type 2/microbiology* ; Escherichia coli/classification* ; Gastrointestinal Microbiome/genetics* ; Metagenomics ; East Asian People

OBJECTIVES: To identify the key genes and immunological pathways shared by type 2 diabetes mellitus (T2DM) and chronic obstructive pulmonary disease (COPD) and explore the potential therapeutic targets of T2DM complicated by COPD. METHODS: GEO database was used for analyzing the gene expression profiles in T2DM and COPD to identify the common differentially expressed genes (DEGs) in the two diseases. A protein-protein interaction network was constructed to identify the candidate hub genes, which were validated in datasets and disease sets to obtain the target genes. The diagnostic accuracy of these target genes was assessed with ROC analysis, and their expression levels and association with pulmonary functions were investigated using clinical data and blood samples of patients with T2DM and COPD. The abundance of 22 immune cells was analyzed with CIBERSORT algorithm, and their relationship with the target genes was examined using correlation analysis. DGIdb database was used for analyzing the drug-gene interactions and the druggable genes followed by gene set enrichment analysis. RESULTS: We identified a total of 175 common DEGs in T2DM and COPD, mainly enriched in immune- and inflammation-related pathways. Among these genes, CXCL12 was identified as the final target gene, whose expression was elevated in both T2DM and COPD (P<0.05) and showed good diagnostic efficacy. Immune cell infiltration correlation analysis showed significant correlations of CXCL12 with various immune cells (P<0.01). GESA analysis showed that high CXCL12 expression was significantly correlated with "cytokine-cytokine receptor interaction". Drug-gene analysis showed that most of CXCL12-related drugs were not targeted drugs with significant cytotoxicity. CONCLUSIONS CXCL12 is a potential common key pathogenic gene of COPD and T2DM, and small-molecule targeted drugs against CXCL12 can provide a new strategy for treatment T2DM complicated by COPD.
Humans ; Pulmonary Disease, Chronic Obstructive/complications* ; Diabetes Mellitus, Type 2/genetics* ; Chemokine CXCL12/metabolism* ; Protein Interaction Maps ; Gene Expression Profiling

OBJECTIVE: To observe the hypoglycemic effect of electroacupuncture (EA) at "Tianshu" (ST 25) combined with metformin on rats with type 2 diabetes mellitus (T2DM) as well as its effect on expression of adenosine monophosphate activated protein kinase (AMPK) in liver and pancreas. METHODS: Thirty-six male SD rats were randomly divided into a blank group (6 rats) and a model establishing group (30 rats). The rats in the model establishing group were fed with high-fat diet and treated with intraperitoneal injection of low-dose streptozotocin (STZ) to establish T2DM model. The rats with successful model establishment were randomly divided into a model group, a control group, a metformin group, an EA group and a combination group, 6 rats in each group. The rats in the EA group were treated with EA at "Tianshu" (ST 25), dense-disperse wave, 2 Hz/15 Hz in frequency and 2 mA in current intensity, 20 min each time. The rats in the metformin group were treated with intragastric administration of metformin (190 mg/kg) dissolved in 0.9% sodium chloride solution (2 mL/kg). The rats in the combination group were treated with EA at "Tianshu" (ST 25) and intragastric administration of metformin. The rats in the control group were treated with intragastric administration of 0.9% sodium chloride solution with the same dose. All the treatments were given once a day for 5 weeks. After the intervention, the body mass and random blood glucose were detected; the serum insulin level was detected by ELISA; the expression of AMPK and phosphorylated adenosine monophosphate activated protein kinase (p-AMPK) in liver and pancreas was detected by Western blot method; the expression of protein gene product 9.5 (PGP9.5) was detected by immunofluorescence. RESULTS: ①Compared with the blank group, the body mass in the model group was decreased (P<0.05); compared with the model group, the body mass in the EA group and the combination group was decreased (P<0.05); the body mass in the EA group and the combination group was lower than the metformin group (P<0.05). Compared with the blank group, the random blood glucose in the model group was increased (P<0.01); compared with the model group, the random blood glucose in the metformin group, the EA group and the combination group was decreased (P<0.01). The random blood glucose in the combination group was lower than the metformin group and the EA group (P<0.05). ②Compared with the blank group, the insulin level in the model group was decreased (P<0.05); compared with the model group, the insulin level in the metformin group, the EA group and the combination group was all increased (P<0.05). The insulin level in the combination group was higher than the metformin group and the EA group (P<0.05). ③Compared with the blank group, the protein expression of AMPK and p-AMPK in liver tissue was decreased (P<0.05), and the protein expression of AMPK and p-AMPK in pancreatic tissue was increased (P<0.05) in the model group. Compared with the model group, the protein expression of AMPK and p-AMPK in liver tissue in the metformin group, the EA group and the combination group was increased (P<0.05, P<0.01); the protein expression of AMPK in pancreatic tissue in the metformin group was increased (P<0.05); the protein expression of AMPK in pancreatic tissue in the EA group and the combination group was decreased (P<0.05); the protein expression of p-AMPK in pancreatic tissue in the metformin group, the EA group and the combination group was decreased (P<0.05). The protein expression of AMPK and p-AMPK in liver tissue in the combination group was higher than that in the metformin group and the EA group (P<0.05); the protein expression of AMPK in pancreatic tissue in the EA group and the combination group was less than that in the metformin group (P<0.05), and the expression of p-AMPK protein in pancreatic tissue in the combination group was less than that in the metformin group and the EA group (P<0.05). ④Compared with the blank group, the expression of PGP9.5 in pancreatic tissue in the model group was increased (P<0.01); compared with the model group, the expression of PGP9.5 in pancreatic tissue in the metformin group, the EA group and the combination group was decreased (P<0.05, P<0.01). The expression of PGP9.5 in pancreatic tissue in the EA group was lower than the metformin group and the combination group (P<0.05). CONCLUSION Electroacupuncture at "Tianshu" (ST 25) could promote the effect of metformin on activating AMPK in liver tissue of T2DM rats, improve the negative effect of metformin on AMPK in pancreatic tissue, and enhance the hypoglycemic effect of metformin. The mechanism may be related to the inhibition of pancreatic intrinsic nervous system.
Animals ; Male ; Rats ; Acupuncture Points ; AMP-Activated Protein Kinases/genetics* ; Blood Glucose ; Diabetes Mellitus, Type 2/drug therapy* ; Electroacupuncture ; Hypoglycemic Agents ; Insulins ; Metformin ; Rats, Sprague-Dawley

To compare the pancreatic proteomics and autophagy between Rehmanniae Radix-and Rehmanniae Radix Praeparata-treated mice with type 2 diabetes mellitus(T2DM). The T2DM mouse model was established by high-fat diet coupled with streptozotocin(STZ, intraperitoneal injection, 100 mg·kg~(-1), once a day for three consecutive days). The mice were then randomly assigned into a control group, low-(5 g·kg~(-1)) and high-dose(15 g·kg~(-1)) Rehmanniae Radix groups, low-(150 mg·kg~(-1)) and high-dose(300 mg·kg~(-1)) catalpol groups, low-(5 g·kg~(-1)) and high-dose(15 g·kg~(-1)) Rehmanniae Radix Praeparata groups, low-(150 mg·kg~(-1)) and high-dose(300 mg·kg~(-1)) 5-hydroxymethyl furfuraldehyde(5-HMF) groups, and a metformin(250 mg·kg~(-1)) group. In addition, a normal group was also set and each group included 8 mice. The pancreas was collected after four weeks of administration and proteomics tools were employed to study the effects of Rehmanniae Radix and Rehmanniae Radix Praeparata on protein expression in the pancreas of T2DM mice. The expression levels of proteins involved in autophagy, inflammation, and oxidative stress response in the pancreatic tissues of T2DM mice were determined by western blotting, immunohistochemical assay, and transmission electron microscopy. The results showed that the differential proteins between the model group and Rehmanniae Radix/Rehmanniae Radix Prae-parata group were enriched in 7 KEGG pathways, such as autophagy-animal, which indicated that the 7 pathways may be associated with T2DM. Compared with the control group, drug administration significantly up-regulated the expression levels of beclin1 and phosphorylated mammalian target of rapamycin(p-mTOR)/mTOR and down-regulated those of the inflammation indicators, Toll-like receptor-4(TLR4) and Nod-like receptor protein 3(NLRP3), in the pancreas of T2DM mice, and Rehmanniae Radix showed better performance. In addition, the expression levels of inducible nitric oxide synthase(iNOS), nuclear factor erythroid 2-related factor 2(Nrf2), and heine oxygenase-1(HO-1) in the pancreas of T2DM mice were down-regulated after drug administration, and Rehmanniae Radix Praeparata demonstrated better performance. The results indicate that both Rehmanniae Radix and Rehmanniae Radix Praeparata can alleviate the inflammatory symptoms, reduce oxidative stress response, and increase the autophagy level in the pancreas of T2DM mice, while they exert the effect on different autophagy pathways.
Mice ; Animals ; Diabetes Mellitus, Type 2/genetics* ; Streptozocin/pharmacology* ; Diet, High-Fat/adverse effects* ; Proteomics ; Inflammation ; TOR Serine-Threonine Kinases ; Autophagy ; Mammals

BACKGROUND: Type 2 diabetes mellitus (T2DM) is an independent risk factor for colorectal cancer (CRC), and the patients with CRC and T2DM have worse survival. The human gut microbiota (GM) is linked to the development of CRC and T2DM, respectively. However, the GM characteristics in patients with CRC and T2DM remain unclear. METHODS: We performed fecal metagenomic and targeted metabolomics studies on 36 samples from CRC patients with T2DM (DCRC group, n = 12), CRC patients without diabetes (CRC group, n = 12), and healthy controls (Health group, n = 12). We analyzed the fecal microbiomes, characterized the composition and function based on the metagenomics of DCRC patients, and detected the short-chain fatty acids (SCFAs) and bile acids (BAs) levels in all fecal samples. Finally, we performed a correlation analysis of the differential bacteria and metabolites between different groups. RESULTS: Compared with the CRC group, LefSe analysis showed that there is a specific GM community in DCRC group, including an increased abundance of Eggerthella , Hungatella , Peptostreptococcus , and Parvimonas , and decreased Butyricicoccus , Lactobacillus , and Paraprevotella . The metabolomics analysis results revealed that the butyric acid level was lower but the deoxycholic acid and 12-keto-lithocholic acid levels were higher in the DCRC group than other groups ( P < 0.05). The correlation analysis showed that the dominant bacterial abundance in the DCRC group ( Parvimonas , Desulfurispora , Sebaldella , and Veillonellales , among others) was negatively correlated with butyric acid, hyodeoxycholic acid, ursodeoxycholic acid, glycochenodeoxycholic acid, chenodeoxycholic acid, cholic acid and glycocholate. However, the abundance of mostly inferior bacteria was positively correlated with these metabolic acid levels, including Faecalibacterium , Thermococci , and Cellulophaga . CONCLUSIONS Unique fecal microbiome signatures exist in CRC patients with T2DM compared to those with non-diabetic CRC. Alterations in GM composition and SCFAs and secondary BAs levels may promote CRC development.
Humans ; Gastrointestinal Microbiome/genetics* ; Diabetes Mellitus, Type 2 ; Microbiota ; Bacteria/genetics* ; Fatty Acids, Volatile ; Colorectal Neoplasms/metabolism* ; Butyrates ; Feces/microbiology*