BACKGROUND

Diabetes is a chronic metabolic condition that represents a major public health issue worldwide, with Type 2 diabetes comprising 80-90% of all cases1. It is estimated that individuals with diabetes will increase from 451 million in 2021 to 693 million by 2045, with around 4.3 million individuals affected in the Philippines as of 20212,3,4. While insulin therapy is vital for managing diabetes, acceptance among patients is frequently obstructed by concerns about side effects, potential disruptions to their lifestyle, and stigma associated with injections.

The objective of the study was to determine the barriers to insulin therapy among adult patients with Type 2 Diabetes mellitus of the Department of Family and Community Medicine of Quezon City General Hospital.

This is a cross-sectional study carried out between July and September 2024 involving 117 participants with Type 2 diabetes. Information was gathered through self-administered questionnaires consisting of the Insulin Treatment Appraisal Scale (ITAS) and the SCREEM-RES questionnaire.

Majority of the participants (67.06%) were aged between 60 and 65, predominantly female (56%) and unemployed with a monthly family household income of less than 8,000 pesos. ITAS revealed negative perceptions towards insulin treatment, primarily due to fear and perceived loss of control. Family resources among the participants was revealed to be inadequate, as reflected in the SCREEM-RES questionnaire.

Age, education, employment status, household income, high negative attitude towards insulin and inadequate family resources are found to be barriers to initiating insulin. The study highlights the need for improved education to foster a supportive environment for insulin use and emphasizes the importance of involving patients in their treatment decisions for effective diabetes management and better long-term health outcomes.

BACKGROUND

Diabetes mellitus (DM) is a significant and growing global health concern. Worldwide, 537 million adults have diabetes and 206 million of them are from the Western Pacific Region1. Local prevalence continues to remain high at 7.5%, with 4,303,899 adult Filipinos suffering from diabetes in 2021. DM significantly contributes to the growing burden of chronic kidney disease (CKD) worldwide with about 50% of end-stage renal disease (ESRD) being due to diabetic nephropathy alone. Likewise, 60% of Filipinos on maintenance dialysis have ESRD due to DM and hypertension. The primary care setting is the initial point of contact between healthcare providers and patients with type 2 diabetes, hence, the development of clinical practice guidelines that will provide guidance in caring for patients with stable complications of diabetes. The guideline is the first of 3 that are being developed by the Philippine Academy of Family Physicians for the diagnosis and management of adult patients with type 2 diabetes and stable microvascular complications – nephropathy, retinopathy and neuropathy.

This guideline aims to provide evidence-based recommendations on the diagnosis and management of adults with type 2 diabetes mellitus (T2DM) and early stage CKD and is divided into 5 main sections – Clinical Assessment, Diagnostic Tests, Pharmacologic Treatment, Non-pharmacologic Treatment and Patient Outcomes.

The method of guideline development followed the ADAPTE process. The Technical Working Group identified 19 key questions after consultation with colleagues and patients. Recommendations were adopted from high-quality clinical practice guidelines whenever applicable for most of the key clinical questions. On the other hand, the De Novo method of evidence review was used to answer key clinical questions for which recommendations from reviewed guidelines were not available. A modified GRADEPro was used in assessing the quality of evidence – high, moderate, low or very low. Following external review by a nephrologist, the draft recommendations were sent to the members of the consensus panel. Voting on whether to include or not by the consensus panel was facilitated to determine the strength of each recommendation – strong, moderate or weak.

After reviewing 3 high-quality clinical practice guidelines and the current evidence, the technical working group was able to develop 40 recommendations for the 19 key clinical questions.

INTRODUCTION

There is significantly increased morbidity among patients who undergo major amputation because of diabetic foot ulcers (DFU) . Various risk factors contribute to this outcome with endothelial dysfunction potentially linked to poor wound healing. The Neutrophil Lymphocyte Ratio (NLR) may indicate endothelial dysfunction.

This study aimed to evaluate the accuracy and utility of NLR as a predictor of major amputation in patients admitted for DFU, whose white blood cell counts (WBCs) were elevated or normal. Major amputation is defined as amputation above the tibiotalar joint.

This retrospective cohort analysis included patients admitted at East Avenue Medical Center for DFU. The primary endpoint was major amputation of the lower extremities. Data were analyzed using Receiver Operating Characteristic (ROC) analysis and logistic regression.

The study included 280 DFU patients, predominantly male (62.86%) with a mean age of 57.01±10.72 years. Elevated WBC was found in 176 patients (62.86%) while 104 had normal WBC (37.14%). Major amputation of the lower extremity was performed on 112 patients (40%), with 81 having elevated WBC and 31 normal WBC. The median NLR in patients with elevated WBC undergoing major amputation was 12.86 (IQR: 2.36-95) compared to 5.71 (IQR: 1.91-31.67) in those who did not, indicating NLR as an independent predictor of major amputation (Adjusted OR 1.23; 95% CI 1.14-1.34; p < 0.001). ROC analysis showed an AUC of 0.8234 with an optimal cutoff of 9.33 (72.8% sensitivity, 86.3% specificity). Other predictive variables included University of Texas Stage 3D (Adjusted OR 8.20; 95% CI 2.52-26.75; p < 0.001), Wagner Grade 4 (Adjusted OR 4.6; 95% CI 1.28-16.55; p=0.019), and severe infection (Adjusted OR 2.91; 95% CI 1.22-6.93; p=0.016). For patients with normal WBC, median NLR was 18 (IQR: 1.54-45.5) in those who had major amputation versus 3.13 (IQR: 1.14-12.29) in those who did not undergo major amputation. ROC analysis showed an AUC of 0.9068 with an optimal cutoff of 6.92 (87.1% sensitivity, 98.6% specificity). NLR was also an independent predictor in these subjects (Adjusted OR 1.48; 95% CI 1.14-1.92; p=0.003) alongside smoking history (Adjusted OR 9.14; 95% CI 1.26-66.56; p=0.029) and UT3D (Adjusted OR 17.38; 95% CI 2.21-136.59; p=0.007).

Forty percent of DFU patients had major amputations. NLR independently predicted major amputation in DFU patients with both elevated and normal WBC.

Non-obstructive azoospermia is a common condition associated with significant health risks, including increased mortality, cancer, and chronic diseases such as metabolic and cardiovascular disorders. This review aims to highlight the potential health challenges faced by men with this condition compared to fertile counterparts. Through a comprehensive bibliographic search on PubMed, using the following algorithm: ("infertility, male" [MeSH Terms] OR "azoospermia" [MeSH Terms]) AND ("mortality" [MeSH Terms] OR "neoplasms" [MeSH Terms] OR "chronic disease" [MeSH Terms] OR "diabetes mellitus" [MeSH Terms] OR "heart diseases" [MeSH Terms]), we analyzed existing literature to explore the associations between infertility, specifically azoospermia, and adverse health outcomes. Findings indicate that infertile men are at a higher risk of death, various cancers (particularly testicular cancer), metabolic syndrome, diabetes, hypogonadism, and cardiovascular disease. Although research specifically addressing azoospermia is limited, available studies support the notion that men with this condition may experience heightened health vulnerabilities. Given these risks, it is imperative for healthcare professionals, especially urologists, to conduct thorough health assessments for men diagnosed with azoospermia. Informing patients of these potential health issues and integrating comprehensive evaluations into their care can facilitate early detection and intervention for life-threatening conditions. Ultimately, men with azoospermia should receive ongoing monitoring to address their specific health concerns, thus improving their long-term health outcomes.
Humans ; Male ; Azoospermia/epidemiology* ; Cardiovascular Diseases/etiology* ; Metabolic Syndrome/epidemiology* ; Infertility, Male/complications* ; Testicular Neoplasms/epidemiology* ; Hypogonadism/epidemiology* ; Diabetes Mellitus/epidemiology* ; Risk Factors ; Neoplasms/epidemiology*

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

Maturity-onset diabetes of the young (MODY) is a special type of diabetes characterized by clinical features including early onset of diabetes (before 30 years of age), autosomal dominant inheritance, impaired glucose-induced insulin secretion, and hyperglycemia. So far, 14 types of MODY have been reported, accounting for about 1%-5% of the patients with diabetes. MODY often presents with an insidious onset, and although 14 subtypes have been identified for MODY, it is frequently misdiagnosed as type 1 or type 2 diabetes due to overlapping clinical features and high costs and limitations of genetic testing. This article reviews the clinical features of MODY subtypes in order to improve the accuracy of the diagnosis and treatment of MODY.
Humans ; Diabetes Mellitus, Type 2/genetics*

OBJECTIVES: To investigate the current status and influencing factors of quality of life in children and adolescents with type 1 diabetes (T1DM) in Xinjiang. METHODS: A convenience sampling method was used to select 259 children with T1DM and their primary caregivers who attended three tertiary hospitals in Xinjiang from January 2023 to February 2024. The Pediatric Quality of Life Inventory^TM Version 4.0 Generic Core Scales (PedsQL^TM4.0) and Pediatric Quality of Life Inventory^TM Version 3.2 Diabetes Module (PedsQL^TM3.2-DM) were used to assess the quality of life of the children. Information on family demographics, caregiver burden, and caregiving ability was also collected. Multiple linear regression analysis was employed to identify factors associated with the quality of life of the children. RESULTS: The scores for PedsQL^TM4.0 and PedsQL^TM3.2-DM were 77±16 and 71±16, respectively. Both were negatively correlated with caregiver burden (P<0.05) and positively correlated with caregiving ability (P<0.05). Multiple linear regression analysis indicated that caregiver burden, caregiving ability, family income, and parent-child relationship were significantly associated with generic quality of life (P<0.05), whereas caregiver burden, caregiving ability, disease duration, place of residence, and glycated hemoglobin level were significantly associated with diabetes-specific quality of life (P<0.05). CONCLUSIONS The overall quality of life of children and adolescents with T1DM in Xinjiang is relatively low. The quality of life is influenced by a combination of factors including family caregiver burden, caregiving ability, family income, parent-child relationship, disease duration, place of residence, and glycated hemoglobin level. Strategies to improve quality of life should consider the combined impact of individual disease characteristics and family factors.
Humans ; Quality of Life ; Diabetes Mellitus, Type 1/psychology* ; Adolescent ; Child ; Male ; Female ; Caregivers/psychology* ; Child, Preschool ; Linear Models

The prevalence of type 1 diabetes (T1DM) is increasing annually, and its complications seriously impair the quality of life of affected children. Early screening for T1DM helps reduce the occurrence of diabetic ketoacidosis, protect β-cell function, and delay disease onset in high-risk populations. This article summarizes current domestic and international screening technologies for T1DM. Screening methods remain centered on detection of diabetes-related antibodies and glycometabolic markers, while factors related to disease pathogenesis hold promise as sensitive screening markers. Expanding T1DM screening in China is expected to improve early diagnosis and treatment.
Diabetes Mellitus, Type 1/diagnosis* ; Humans ; Early Diagnosis ; Autoantibodies/blood* ; Mass Screening/methods*

OBJECTIVES: To analyze the multimorbidity patterns and core diseases among hospitalized patients in different age groups and to explore the impacts of multimorbidity patterns on hospitalization costs. METHODS: Electronic medical records of adult inpatients (aged ≥18 years) from Ningbo Medical Center Lihuili Hospital between January 1, 2018, and June 30, 2023 were collected. The multimorbidity status involving 53 specific diseases was analyzed across different age groups. Association rule mining was used to identify common multimorbidity patterns. Complex network analysis was used to identify core diseases within the multimorbidity networks. Generalized estimating equations (GEE) were used to analyze the impact of different multimorbidity patterns on hospitalization costs. RESULTS: The prevalence of multimorbidity among the 359 402 adult inpatients was 38.51%, with higher rates observed in males (43.60%) and elderly patients (58.29%). Association rule mining identified 15 common multimorbidity patterns, which exhibited differences across age groups. The most prevalent multimorbidity pattern overall was "diabetes→hypertension" (support=7.04%, confidence=62.17%, lift=2.17). In the young adult group, the most prevalent pattern was "dyslipidemia→chronic liver disease" (support=1.19%, confidence=53.17%, lift=6.04). In the middle-aged group, it was "diabetes→hypertension" (support=4.84%, confidence=50.28%, lift=2.15). In the elderly group, it was "coronary heart disease, diabetes→hypertension" (support=2.38%, confidence=77.43%, lift=1.63). Complex network analysis revealed that the core diseases within multimorbidity networks differed across age groups. The core disease identified in the young adult group was chronic liver disease (degree centrality=50, betweenness centrality=0.055, closeness centrality=0.963). Core diseases in the middle-aged group included hypertension, chronic liver disease, and diabetes (all with degree centrality=52, betweenness centrality=0.022, closeness centrality=1.000). Core diseases in the elderly group comprised hypertension, diabetes, malignant tumors, chronic liver disease, thyroid disease, anemia, and arrhythmia (all with degree centrality=52, betweenness centrality=0.009, closeness centrality=1.000). Generalized estimating equations analysis indicated that, most multimorbidity patterns were significantly associated with increased hospitalization costs. However, the magnitude of cost increase varied across different multimorbidity patterns. Specifically, hospitalization costs for patients with patterns such as "heart failure→hypertension", "stroke→hypertension", "malignant tumor, diabetes→hypertension", "stroke, diabetes→hypertension", and "diabetes, heart failure→hypertension" were more than double those of patients without any target diseases. CONCLUSIONS Multimorbidity patterns and core diseases among hospitalized patients differ significantly across age groups, and different patterns exert varying impacts on hospitalization costs. These findings underscore the necessity for age-stratified and multimorbidity pattern specific management strategies.
Humans ; Multimorbidity ; Male ; Hospitalization/economics* ; Female ; Aged ; Middle Aged ; Adult ; Age Factors ; Young Adult ; Adolescent ; Diabetes Mellitus/epidemiology* ; Electronic Health Records ; Aged, 80 and over ; Hospital Costs ; China/epidemiology* ; Hypertension/economics* ; Liver Diseases/epidemiology*

BACKGROUND

Type 2 diabetes is the most common type of diabetes in the Philippines. Diabetic foot complications represent a prevalent and significant chronic concern for individuals with type 2 diabetes. This poses an immediate community health concern, as diabetic complications may threaten an individual's well-being.

This study intends to cross-culturally adapt the Diabetic Foot Knowledge Subscale (DFKS) and Foot Self-Care Behavior Scale (FSCBS) questionnaires into the Filipino language as an assessment tool among Filipinos with diabetes.

The study employed a psychometric research design, where it entailed Phase A and Phase B. Phase A involved the forward translation of the DFKS and FSCBS questionnaires, followed by the synthesis of the translations and backward translation. Subsequently, an expert committee reviewed the translations and concluded the final version. The final translated versions of the questionnaires ensured that it can be understood by an individual who has a Grade 6 level of reading proficiency. Phase B entailed the validity testing with the evaluation of the expert committee, and reliability testing of the said questionnaires with a sample size of 30 participants. A wash-out period of 24 hours was given for the test-retest reliability, followed by data analysis. The validity and reliability of the questionnaires were measured using the item and scale content validity indices and the internal consistency and test-retest reliability, respectively, to ensure their accuracy and appropriateness. The content validity of the questionnaires was evaluated individually by the experts using a Likert scale from 1-4, with 4 being the highest meaning the item was very relevant and succinct. Scores per item were between 3 and 4, which indicate that the translated version of the items were relevant and succinct or were relevant but needed minor revisions.

The validity scores for the translated DFKS and FSCBS questionnaires were obtained using the Scale Content Validity Index (S-CVI) with a score of 0.96 and 0.92, respectively. Moreover, all items in the questionnaires obtained an Item Content Validity Index (I-CVI) of 0.88-1.00. The DFKS also has an acceptable internal consistency with a Cronbach’s alpha of 0.72, while the FSCBS has a good internal consistency with a Cronbach’s alpha of 0.85. The test-retest reliability shows an acceptable Spearman’s correlation at 0.76 for the DFKS and a strong positive Pearson correlation coefficient at 0.73 for the FSCBS.

The validity of the two questionnaires was acceptable and the test-retest reliability showed a strong positive correlation among the items thereby making the cross-cultural adaptation of the questionnaires successful. The Filipino versions of the DFKS and FSCBS questionnaires accurately measure the knowledge and behavior of individuals with type 2 diabetes, respectively.