This study aims to investigate the mechanism of Qingrun Decoction in alleviating hepatic insulin resistance in type 2 diabetes mellitus(T2DM) rats through the reprogramming of amino acid metabolism. A T2DM rat model was established by inducing insulin resistance through a high-fat diet combined with intraperitoneal injection of streptozotocin. The model rats were randomly divided into five groups: model group, high-, medium-, and low-dose Qingrun Decoction groups, and metformin group. A normal control group was also established. The rats in the normal and model groups received 10 mL·kg~(-1) distilled water daily by gavage. The metformin group received 150 mg·kg~(-1) metformin suspension by gavage, and the Qingrun Decoction groups received 11.2, 5.6, and 2.8 g·kg~(-1) Qingrun Decoction by gavage for 8 weeks. Blood lipid levels were measured in different groups of rats. Pathological damage in rat liver tissue was assessed by hematoxylin-eosin(HE) staining and oil red O staining. Transcriptome sequencing and untargeted metabolomics were performed on rat liver and serum samples, integrated with bioinformatics analyses. Key metabolites(branched-chain amino acids, BCAAs), amino acid transporters, amino acid metabolites, critical enzymes for amino acid metabolism, resistin, adiponectin(ADPN), and mammalian target of rapamycin(mTOR) pathway-related molecules were quantified using quantitative real-time polymerase chain reaction(qRT-PCR), Western blot, and enzyme-linked immunosorbent assay(ELISA). The results showed that compared with the normal group, the model group had significantly increased serum levels of total cholesterol(TC), triglycerides(TG), low-density lipoprotein cholesterol(LDL-C), and resistin and significantly decreased ADPN levels. Hepatocytes in the model group exhibited loose arrangement, significant lipid accumulation, fatty degeneration, and pronounced inflammatory cell infiltration. In liver tissue, the mRNA transcriptional levels of solute carrier family 7 member 2(Slc7a2), solute carrier family 38 member 2(Slc38a2), solute carrier family 38 member 4(Slc38a4), and arginase(ARG) were significantly downregulated, while the mRNA transcriptional levels of solute carrier family 1 member 4(Slc1a4), solute carrier family 16 member 1(Slc16a1), and methionine adenosyltransferase(MAT) were upregulated. Furthermore, the mRNA transcription and protein expression levels of branched-chain α-keto acid dehydrogenase E1α(BCKDHA) and DEP domain-containing mTOR-interacting protein(DEPTOR) were downregulated, while mRNA transcription and protein expression levels of mTOR, as well as ribosomal protein S6 kinase 1(S6K1), were upregulated. The levels of BCAAs and S-adenosyl-L-methionine(SAM) were elevated. The serum level of 6-hydroxymelatonin was significantly reduced, while imidazole-4-one-5-propionic acid and N-(5-phospho-D-ribosyl)anthranilic acid levels were significantly increased. Compared with the model group, Qingrun Decoction significantly reduced blood lipid and resistin levels while increasing ADPN levels. Hepatocytes had improved morphology with reduced inflammatory cells, and fatty degeneration and lipid deposition were alleviated. Differentially expressed genes and differential metabolites were mainly enriched in amino acid metabolic pathways. The expression levels of Slc7a2, Slc38a2, Slc38a4, and ARG in the liver tissue were significantly upregulated, while Slc1a4, Slc16a1, and MAT expression levels were significantly downregulated. BCKDHA and DEPTOR expression levels were upregulated, while mTOR and S6K1 expression levels were downregulated. Additionally, the levels of BCAAs and SAM were significantly decreased. The serum level of 6-hydroxymelatonin was increased, while those of imidazole-4-one-5-propionic acid and N-(5-phospho-D-ribosyl)anthranilic acid were decreased. In summary, Qingrun Decoction may improve amino acid metabolism reprogramming, inhibit mTOR pathway activation, alleviate insulin resistance in the liver, and mitigate pathological damage of liver tissue in T2DM rats by downregulating hepatic BCAAs and SAM and regulating key enzymes involved in amino acid metabolism, such as BCKDHA, ARG, and MAT, as well as amino acid metabolites and transporters.
Animals ; Drugs, Chinese Herbal/administration & dosage* ; Rats ; Insulin Resistance ; Diabetes Mellitus, Type 2/genetics* ; Male ; Liver/drug effects* ; Amino Acids/metabolism* ; Rats, Sprague-Dawley ; Humans ; Metabolic Reprogramming

Wumei Pills, a classic traditional Chinese medicine(TCM) formula, are widely used in the treatment of biliary ascariasis and diarrhea. In recent years, studies have shown that Wumei Pills have advantages in the treatment of type 2 diabetes mellitus(T2DM), while there are no relevant reports that systematically evaluate the efficacy of Wumei Pills in the treatment of T2DM. This study addresses this issue by systematically evaluating the efficacy and safety of Wumei Pills, aiming to provide an evidence-based basis for clinical practice. PubMed, Cochrane Library, EMbase, Web of Science, CNKI, Wanfang, and VIP were researched for the randomized controlled trial(RCT) involving Wumei Pills for the treatment of T2DM that were published from inception to September 2024. RevMan 5.3 was used for the Meta-analysis of the data. A total of 18 RCTs were included, with a total of 1 437 patients. Meta-analysis produced the following results.(1)Treatment group outperformed control group in terms of overall response rate(RR=1.28, 95%CI[1.14, 1.43], P<0.000 1), fasting blood glucose(FPG)(WMD=-0.69, 95%CI[-0.93,-0.46], P<0.000 01), two-hour postprandial plasma glucose(2hPG)(WMD=-0.74, 95%CI[-1.17,-0.31], P<0.000 7), glycated hemoglobin(HbA1c)(WMD=-0.39, 95%CI[-0.60,-0.18], P=0.000 3), high-density lipoprotein(HDL)(WMD=0.38, 95%CI[0.28, 0.48], P<0.000 01), and body mass index(BMI)(WMD=-1.41, 95%CI[-2.40,-0.42], P=0.005).(2)The two groups had comparable effects regarding total cholesterol(TC)(WMD=-0.53, 95%CI[-1.13, 0.08], P=0.09) and low-density lipoprotein(LDL)(WMD=-0.25, 95%CI[-0.56, 0.06], P=0.12).(3)Triglycerides(TG)(WMD=-0.28,95%CI [-0.59,0.03],P=0.08), sensitivity analysis showed potential reduction effect(WMD=-0.20,95%CI[-0.36,-0.04],P=0.01). Occurrence of adverse drug reaction(RR=0.43,95%CI [0.23,0.80],P=0.007), sensitivity analysis showed significant disappearance(RR=0.56,95%CI[0.26,1.22],P=0.14), suggesting that the efficacy of treatment group was not better than that of control group. The results indicate that the treatment of T2DM with Wumei Pills is greatly related to the improvement of glucose metabolism, lipid metabolism, and clinical efficacy. The findings provide a basis for clinical application of Wumei Pills in treating T2DM, while the conclusion remains to be verified by clinical studies with higher quality.
Humans ; Diabetes Mellitus, Type 2/blood* ; Drugs, Chinese Herbal/administration & dosage* ; Randomized Controlled Trials as Topic ; Blood Glucose/metabolism* ; Hypoglycemic Agents/therapeutic use* ; Treatment Outcome ; Glycated Hemoglobin/metabolism* ; Female

To address the current issues of data imbalance and scarcity in photoplethysmography (PPG) data for type 2 diabetes mellitus (T2DM) prediction, this study proposes an improved conditional Wasserstein generative adversarial network with gradient penalty (CWGAN-GP). The algorithm integrated gated recurrent unit (GRU) networks and self-attention mechanisms to construct a generator, aiming to produce high-quality PPG signals. Various data augmentation methods, including the improved CWGAN-GP, were employed to expand the PPG dataset, and multiple classifiers were applied for T2DM prediction analysis. Experimental results showed that the model trained on data generated by the improved CWGAN-GP achieved the optimal prediction performance. The highest accuracy reached 0.895 0, and compared with other data enhancement methods, this approach exhibited significant advantages in terms of precision and F1-score. The generated data notably enhances the accuracy and generalization ability of T2DM prediction models, providing a more reliable technical basis for non-invasive early T2DM screening based on PPG signals.
Photoplethysmography/methods* ; Diabetes Mellitus, Type 2/diagnosis* ; Humans ; Algorithms ; Neural Networks, Computer ; Signal Processing, Computer-Assisted ; Prediction Algorithms

BACKGROUND

Diabetes is a chronic metabolic condition that represents a major public health issue worldwide, with Type 2 diabetes comprising 80-90% of all cases1. It is estimated that individuals with diabetes will increase from 451 million in 2021 to 693 million by 2045, with around 4.3 million individuals affected in the Philippines as of 20212,3,4. While insulin therapy is vital for managing diabetes, acceptance among patients is frequently obstructed by concerns about side effects, potential disruptions to their lifestyle, and stigma associated with injections.

The objective of the study was to determine the barriers to insulin therapy among adult patients with Type 2 Diabetes mellitus of the Department of Family and Community Medicine of Quezon City General Hospital.

This is a cross-sectional study carried out between July and September 2024 involving 117 participants with Type 2 diabetes. Information was gathered through self-administered questionnaires consisting of the Insulin Treatment Appraisal Scale (ITAS) and the SCREEM-RES questionnaire.

Majority of the participants (67.06%) were aged between 60 and 65, predominantly female (56%) and unemployed with a monthly family household income of less than 8,000 pesos. ITAS revealed negative perceptions towards insulin treatment, primarily due to fear and perceived loss of control. Family resources among the participants was revealed to be inadequate, as reflected in the SCREEM-RES questionnaire.

Age, education, employment status, household income, high negative attitude towards insulin and inadequate family resources are found to be barriers to initiating insulin. The study highlights the need for improved education to foster a supportive environment for insulin use and emphasizes the importance of involving patients in their treatment decisions for effective diabetes management and better long-term health outcomes.

BACKGROUND

Diabetes mellitus (DM) is a significant and growing global health concern. Worldwide, 537 million adults have diabetes and 206 million of them are from the Western Pacific Region1. Local prevalence continues to remain high at 7.5%, with 4,303,899 adult Filipinos suffering from diabetes in 2021. DM significantly contributes to the growing burden of chronic kidney disease (CKD) worldwide with about 50% of end-stage renal disease (ESRD) being due to diabetic nephropathy alone. Likewise, 60% of Filipinos on maintenance dialysis have ESRD due to DM and hypertension. The primary care setting is the initial point of contact between healthcare providers and patients with type 2 diabetes, hence, the development of clinical practice guidelines that will provide guidance in caring for patients with stable complications of diabetes. The guideline is the first of 3 that are being developed by the Philippine Academy of Family Physicians for the diagnosis and management of adult patients with type 2 diabetes and stable microvascular complications – nephropathy, retinopathy and neuropathy.

This guideline aims to provide evidence-based recommendations on the diagnosis and management of adults with type 2 diabetes mellitus (T2DM) and early stage CKD and is divided into 5 main sections – Clinical Assessment, Diagnostic Tests, Pharmacologic Treatment, Non-pharmacologic Treatment and Patient Outcomes.

The method of guideline development followed the ADAPTE process. The Technical Working Group identified 19 key questions after consultation with colleagues and patients. Recommendations were adopted from high-quality clinical practice guidelines whenever applicable for most of the key clinical questions. On the other hand, the De Novo method of evidence review was used to answer key clinical questions for which recommendations from reviewed guidelines were not available. A modified GRADEPro was used in assessing the quality of evidence – high, moderate, low or very low. Following external review by a nephrologist, the draft recommendations were sent to the members of the consensus panel. Voting on whether to include or not by the consensus panel was facilitated to determine the strength of each recommendation – strong, moderate or weak.

After reviewing 3 high-quality clinical practice guidelines and the current evidence, the technical working group was able to develop 40 recommendations for the 19 key clinical questions.

OBJECTIVE: To investigate the effectiveness of tibial transverse transport (TTT) in treating Wagner grade 3-4 type 2 diabetic foot ulcers and analyze dynamic changes in immunoglobulin levels. METHODS: The clinical data of 68 patients with Wagner grade 3-4 type 2 diabetic foot ulcers treated with TTT between May 2022 and September 2023 was retrospectively analyzed. The cohort included 49 males and 19 females, aged 44-91 years (mean, 67.3 years), with 40 Wagner grade 3 and 28 grade 4 ulcers. The duration of type 2 diabetes ranged from 5 to 23 years, with an average of 10 years. The number of wound healing cases, healing time, amputation cases, death cases, and complications were observed and recorded. Serum samples were collected at 6 key time points [1 day before TTT and 3 days, 7 days (the first day of upward transverse transfer), 14 days (the first day of downward transverse transfer), 21 days (the first day after the end of transfer), 36 days (the first day after the removal of the transfer device)], and the serum immunoglobulin levels were detected by flow cytometry including immunoglobulin G (IgG), IgA, IgM, IgE, complement C3 (C3), C4, immunoglobulin light chain κ (KAP), immunoglobulin light chain λ (LAM). RESULTS: All the 68 patients were followed up 6 months. Postoperative pin tract infection occurred in 3 cases and incision infection in 2 cases. Amputation occurred in 5 patients (7.4%) at 59-103 days after operation, and 8 patients (11.8%) died at 49-77 days after operation; the wounds of the remaining 55 patients (80.9%) healed in 48-135 days, with an average of 80 days. There was no recurrence of ulcer, peri-osteotomy fracture, or local skin necrosis during follow-up. The serum immunoglobulin levels of 55 patients with wound healing showed that the levels of IgG and IgM decreased significantly on the 3rd and 7th day after operation compared with those before operation ( P<0.05), and gradually returned to the levels before operation after 14 days, and reached the peak on the 36th day. IgA levels continued to decrease with time, and there were significant differences at all time points when compared with those before operation ( P<0.05). The level of IgE significantly decreased at 21 days after operation compared with that before operation ( P<0.05), while it was higher at other time points than that before operation, but the difference was not significant ( P>0.05). The level of C3 showed a clear treatment-related increase, which was significantly higher on the 7th, 14th, and 21st days after operation than that before operation ( P<0.05), and the peak appeared on the 14th day. The change trend of C4 level was basically synchronous with that of C3, but the amplitude was smaller, and the difference was significant at 7 and 14 days after operation compared with that before operation ( P<0.05). There was no significant difference in KAP/LAM between different time points before and after operation ( P>0.05). CONCLUSION TTT can accelerate wound healing, effectively treat diabetic foot ulcer, and reduce amputation rate, and has definite effectiveness. The potential mechanisms of TTT in the treatment of diabetic foot ulcers include the dynamic regulation of IgG, IgA, IgM, and IgE levels to balance the process of inflammation and repair, and the periodic increase of C3 and C4 levels may promote tissue cleaning, angiogenesis, and anti-infection defense.
Humans ; Male ; Female ; Middle Aged ; Aged ; Diabetic Foot/immunology* ; Wound Healing ; Adult ; Retrospective Studies ; Aged, 80 and over ; Treatment Outcome ; Tibia/transplantation* ; Diabetes Mellitus, Type 2/complications* ; Amputation, Surgical ; Immunoglobulins/blood* ; Immunoglobulin G/blood*

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

Maturity-onset diabetes of the young (MODY) is a special type of diabetes characterized by clinical features including early onset of diabetes (before 30 years of age), autosomal dominant inheritance, impaired glucose-induced insulin secretion, and hyperglycemia. So far, 14 types of MODY have been reported, accounting for about 1%-5% of the patients with diabetes. MODY often presents with an insidious onset, and although 14 subtypes have been identified for MODY, it is frequently misdiagnosed as type 1 or type 2 diabetes due to overlapping clinical features and high costs and limitations of genetic testing. This article reviews the clinical features of MODY subtypes in order to improve the accuracy of the diagnosis and treatment of MODY.
Humans ; Diabetes Mellitus, Type 2/genetics*

BACKGROUND: Prior studies have shown that drivers with type 2 diabetes are more likely to be involved in motor vehicle collisions (MVCs) compared to the general population. Certain meteorological factors have been increasingly recognized as contributors to MVC risk. This study aims to examine the association of MVCs with temperature, rainfall, wind speed, and sunshine duration among drivers with type 2 diabetes. METHODS: Using Taiwan's National Health Insurance data (2019-2021), we identified individuals diagnosed with type 2 diabetes and linked their records to the Police-Reported Traffic Accident Registry to obtain daily MVC counts. Meteorological data were sourced from the Central Weather Administration. Associations between daily weather conditions and MVCs were assessed using a Distributed Lag Non-Linear Model. RESULTS: Over the 1,096-day study period, 170,468 MVC events involving drivers with type 2 diabetes were recorded. A U-shaped association was observed between same-day temperature and MVC rates. Compared with the reference temperature of 17.5 °C, both lower temperatures (≤15 °C; rate ratio [RR] = 1.014-1.053) and higher temperatures (≥30 °C; RR = 1.062) were associated with increased MVC risk. Rainfall showed an inverse relationship with MVCs. Compared with 70 mm of rainfall, the lowest MVC rate occurred at 129 mm (RR = 0.873), while the highest was on rain-free days (0 mm; RR = 1.068). Stronger effects were observed when lag periods up to 14 days were considered. Wind speed and sunshine duration were not significantly associated with MVC risk. CONCLUSIONS These findings suggest that drivers with type 2 diabetes should exercise greater caution on days with extreme temperatures or in days with lesser rainfall, as these conditions may elevate MVC risk.
Humans ; Diabetes Mellitus, Type 2/epidemiology* ; Taiwan/epidemiology* ; Accidents, Traffic/statistics & numerical data* ; Male ; Middle Aged ; Female ; Weather ; Aged ; Adult ; Temperature ; Risk Factors

Saliva is an important body fluid in the oral cavity containing lots of biomarkers, whose inherent micro-ecosystem holds significant value for early diagnosis and monitoring of oral diseases. Simultaneously, saliva has particular advantages, such as ease of sampling, painless and non-invasive collection, and suitability for repeated sampling, making it highly appropriate for surveillance and follow-up of diseases. In a series of studies conducted by the research group for preventive dentistry in Peking University School and Hospital of Stomatology, we compared different segments of saliva and those samples collected via different sampling methods using proteomic/peptidomic and microbiomic technologies to explore the stability of saliva samples. Besides, the significance of applying representative salivary biomarkers in early prevention and control of representative oral diseases (e.g. dental caries, periodontal diseases) and systemic conditions (e.g. type 2 diabetes mellitus, chronic kidney disease) was confirmed as well.
Humans ; Saliva/chemistry* ; Dental Caries/diagnosis* ; Biomarkers/analysis* ; Periodontal Diseases/diagnosis* ; Mouth Diseases/diagnosis* ; Proteomics/methods* ; Diabetes Mellitus, Type 2/diagnosis* ; Microbiota ; Renal Insufficiency, Chronic/prevention & control*