ObjectiveTo investigate microbial contamination status and distribution characteristics in laboratory animal barrier facilities, so as to provide a scientific basis for environmental quality control in barrier facilities. MethodsIn accordance with the national standard "Laboratory Animals—Environment and Housing Facilities" and the "Standard Operating Procedures" of the barrier facility, bacterial monitoring was performed on samples of air-settling bacteria, materials, and personnel gloves in the single-corridor barrier facility of the Animal Core Facility, Center for Excellence in Molecular Cell Science, Chinese Academy of Sciences (CEMCS). The monitoring data from January 2020 to December 2024 were collected, organized and statistically analyzed, and partial samples were subjected to species identification using PCR and sequencing methods. ResultsA total of 7 898 samples were collected from 2020 to 2024, including 3 175 air-settling bacteria samples, 3 353 material samples, and 1 370 glove samples. The overall compliance rate was 95.7% (7 559/7 898), among which the compliance rate of air-settling bacteria was 97.1% (3 084/3 175), that of materials was 93.2% (3 125/3 353), and that of personnel gloves was 98.5% (1 350/1 370). Over the five years, the compliance rates of all three types of monitored samples were above 90%. There were statistically significant differences in the compliance rates of air-settling bacteria and material samples among different quarters (P<0.05). Further investigation was conducted on samples collected from January to March 2024, and 190 bacterial strains were obtained through isolation and culture, including 126 strains from air-settling bacteria, 52 strains from materials, and 12 strains from personnel gloves. The strains were identified by PCR amplification and sequencing, and the 190 bacterial strains belonged to 9 genera and 20 species. Gram-positive bacteria accounted for the majority, with Staphylococcus as the dominant genus, accounting for 77.9% (148/190). ConclusionMicroorganisms carried by air, materials, and personnel gloves in barrier facilities are mainly Gram-positive bacteria. Regular monitoring of air-settling bacteria, materials, and personnel gloves in barrier facilities enables timely detection and control of potential risks during husbandry management and facility operation, which is of great significance for maintaining the sound operation of the barrier facility system and ensuring the quality of animal experiments.

With the rapid development of mobile internet technology, mobile health application (mHealth APP) are increasingly widely used in the field of health management and have been proven to play an important role in the management of chronic diseases. Solid organ transplant recipients face complex health management needs after surgery, including postoperative follow-up, medication management, prevention and treatment of complications and comorbidities, and lifestyle adjustment. mHealth APP can provide solid organ transplant recipients with convenient self-management tools. Although some progress has been made in this field, there are still many challenges, such as insufficient user experience, technological dependence, and data security risks. Therefore, this article discusses the development process, main functions and current application status of mHealth APP, and analyzes its advantages in improving the self-management ability of solid organ transplant recipients, promoting doctor-patient communication and reducing the incidence of complications. At the same time, based on the practical experience of author’s team in developing the “TransMate” mHealth APP, we propose the directions that mHealth APPs should focus on in the future, in order to provide more effective support and services for the health management of solid organ transplant recipients.

Most tumor cells and healthy neurons are at rest during G0 phase.Once the cell cycle is abnormally re-entered under certain conditions,the proliferation of tumor cells and the degenerative necrosis of neurons can be initiated.From the perspective of the cell cycle,cancer and central nervous system diseases,two seemingly different disease types,have a common pathogenesis.This type of diseases is named aberrant cell cycle diseases.As a newly discovered microRNA(miR),miR-1976 is closely related to the regulation of the cell cycle.This review summarizes the progress in the research on miR-1976 in cancer and central nervous system diseases,aiming to provide a reference for the clinical application of miR-1976 in aberrant cell cycle diseases in the future.
MicroRNAs/genetics* ; Humans ; Cell Cycle/genetics* ; Neoplasms/genetics* ; Central Nervous System Diseases/genetics*

Forensic medicine has been designated as a first-level discipline,presenting new opportunities and challenges for the development of forensic medicine.Since the 1980s,the establishment of foren-sic medicine discipline and the cultivation of high-level forensic talents have become hot topics in the development of forensic medicine in China.Since the 13th Five-Year Plan,the forensic team of Shanxi Medical University has been aiming at the forefront,proposing the development goals of"Five First-class"and the discipline development path"Six Major Achievements".It has selected benchmark disci-plines,identified gaps in disciplinary development,unified thoughts,formulated completion timelines,concentrated superior resources,assigned tasks to individuals,and created an"Organized Fill-in-the-Blank Format"forensic medicine discipline construction model with the characteristics of the new era.The construction model of forensic medicine has achieved good results in the goals,discipline frame-work,scientific research,talent cultivation,discipline team and platform construction,forming a rela-tively complete discipline construction and management system,and accumulating valuable experience for the construction of first-level discipline and high-level talent cultivation of forensic medicine.

Objective To investigate the distribution and antimicrobial resistance profiles of clinically isolated Haemophilus influenzae and Moraxella catarrhalis in hospitals across China from 2015 to 2021,and provide evidence for rational use of antimicrobial agents.Methods Data of H.influenzae and M.catarrhalis strains isolated from 2015 to 2021 in CHINET program were collected for analysis,and antimicrobial susceptibility testing was performed by disc diffusion method or automated systems according to the uniform protocol of CHINET.The results were interpreted according to the CLSI breakpoints in 2022.Beta-lactamases was detected by using nitrocefin disk.Results From 2015 to 2021,a total of 43 642 strains of Haemophilus species were isolated,accounting for 2.91％of the total clinical isolates and 4.07％of Gram-negative bacteria in CHINET program.Among the 40 437 strains of H.influenzae,66.89％were isolated from children and 33.11％were isolated from adults.More than 90％of the H.influenzae strains were isolated from respiratory tract specimens.The prevalence of β-lactamase was 53.79％in H.influenzae strains.The H.influenzae strains isolated from children showed higher resistance rate than the strains isolated from adults.Overall,779 strains of H.influenzae did not produce β-lactamase but were resistant to ampicillin(BLNAR).Beta-lactamase-producing strains showed significantly higher resistance rates to these antimicrobial agents than the β-lactamase-nonproducing strains.Of the 16 191 M.catarrhalis strains,80.06％were isolated from children and 19.94％isolated from adults.M.catarrhalis strains were mostly susceptible to both amoxicillin-clavulanic acid and cefuroxime,evidenced by resistance rate lower than 2.0％.Conclusions The emergence of antibiotic-resistant H.influenzae due to β-lactamase production poses a challenge for clinical anti-infective treatment.Therefore,it is very important to implement antibiotic resistance surveillance for H.influenzae and guide rational antibiotic use.All local clinical microbiology laboratories should actively improve antibiotic susceptibility testing and strengthen antibiotic resistance surveillance for H.influenzae.

Objective To understand the changing composition and antibiotic resistance of bacterial species in the clinical isolates from outpatient and emergency department(hereinafter referred to as outpatients)and inpatient children over time in various hospitals,and to provide laboratory evidence for rational antibiotic use.Methods The data on clinically isolated pathogenic bacteria and antimicrobial susceptibility of isolates from outpatients and inpatient children in the CHINET program from 2015 to 2021 were collected and analyzed.Results A total of 278 471 isolates were isolated from pediatric patients in the CHINET program from 2015 to 2021.About 17.1％of the strains were isolated from outpatients,primarily group A β-hemolytic Streptococcus,Escherichia coli,and Staphylococcus aureus.Most of the strains(82.9％)were isolated from inpatients,mainly SS.aureus,E.coli,and H.influenzae.The prevalence of methicillin-resistant S.aureus(MRSA)in outpatients(24.5％)was lower than that in inpatient children(31.5％).The MRSA isolates from outpatients showed lower resistance rates to the antibiotics tested than the strains isolated from inpatient children.The prevalence of vancomycin-resistant Enterococcus faecalis or E.faecium and penicillin-resistant S.pneumoniae was low in either outpatients or inpatient children.S.pneumoniae,β-hemolytic Streptococcus and S.viridans showed high resistance rates to erythromycin.The prevalence of erythromycin-resistant group A β-hemolytic Streptococcus was higher in outpatients than that in inpatient children.The prevalence of β-lactamase-producing H.influenzae showed an overall upward trend in children,but lower in outpatients(45.1％)than in inpatient children(59.4％).The prevalence of carbapenem-resistant Klebsiella pneumoniae(CRKpn),carbapenem-resistant Pseudomonas aeruginosa(CRPae)and carbapenem-resistant Acinetobacter baumannii(CRAba)was 14％,11.7％,47.8％in outpatients,but 24.2％,20.6％,and 52.8％in inpatient children,respectively.The prevalence of multidrug-resistant E.coli,K.pneumoniae,Proteus mirabilis,P.aeruginosa and A.baumannii strains was lower in outpatients than in inpatient children.The prevalence of fluoroquinolone-resistant E.coli,ESBLs-producing K.pneumoniae,ESBLs-producing P.mirabilis,carbapenem-resistant E.coli(CREco),CRKpn,and CRPae was lower in children in outpatients than in inpatient children,but the prevalence of CRAba in 2021 was higher than in inpatient children.Conclusions The distribution of clinical isolates from children is different between outpatients and inpatients.The prevalence of MRSA,ESBL,and CRO was higher in inpatient children than in outpatients.Antibiotics should be used rationally in clinical practice based on etiological diagnosis and antimicrobial susceptibility test results.Ongoing antimicrobial resistance surveillance and prevention and control of hospital infections are crucial to curbing bacterial resistance.

Objective To investigate the changing antibiotic resistance profiles of E.coli isolated from patients in the 52 hospitals participating in the CHINET program from 2015 to 2021.Methods Antimicrobial susceptibility was tested for clinical isolates of E.coli according to the unified protocol of CHINET program.WHONET 5.6 and SPSS 20.0 software were used for data analysis.Results Atotal of 289 760 nonduplicate clinical strains ofE.coli were isolated from 2015 to 2021,mainly from urine samples(44.7±3.2)％.The proportion of E.coli strains isolated from urine samples was higher in females than in males(59.0％vs 29.5％).The proportion of E.coli strains isolated from respiratory tract and cerebrospinal fluid samples was significantly higher in children than in adults(16.7％vs 7.8％,0.8％vs 0.1％,both P＜0.05).The isolates from internal medicine department accounted for the largest proportion(28.9±2.8)％with an increasing trend over years.Overall,the prevalence of ESBLs-producing E.coli and carbapenem resistant E.coli(CREco)was 55.9％and 1.8％,respectively during the 7-year period.The prevalence of ESBLs-producing E.coli was the highest in tertiary hospitals each year from 2015 to 2021 compared to secondary hospitals.The prevalence of CREco was higher in children's hospitals compared to secondary and tertiary hospitals each year from 2015 to 2021.The prevalence of ESBLs-producing E.coli in tertiary hospitals and children's hospitals and the prevalence of CREco in children's hospitals showed a decreasing trend over the 7-year period.The prevalence of CREco in secondary and tertiary hospitals increased slowly.Antibiotic resistance rates changed slowly from 2015 to 2021.Carbapenem drugs(imipenem,meropenem)were the most active drugs amongβ-lactams against E.coli(resistance rate≤2.1％).The resistance rates of E.coli to β-lactam/β-lactam inhibitor combinations(piperacillin-tazobactam,cefoperazone-sulbactam),aminoglycosides(amikacin),nitrofurantoin and fosfomycin(for urinary isolates only)were all less than 10％.The resistance rate of E.coli strains to antibiotics varied with the level of hospitals and the departments where the strains were isolated,especially for cefazolin and ciprofloxacin,to which the resistance rate of E.coli strains from children in non-ICU departments was significantly lower than that of the strains isolated from other departments(P＜0.05).The E.coli isolates from ICU showed higher resistance rate to most antimicrobial agents tested(excluding tigecycline)than the strains isolated from other departments.The E.coli strains isolated from tertiary hospitals showed higher resistance rates to the antimicrobial agents tested(excluding tigecycline,polymyxin B,cefepime and carbapenems)than the strains from secondary hospitals and children's hospitals.Conclusions E.coli is an important pathogen causing clinical infection.More than half of the clinical isolates produced ESBL.The prevalence of CREco is increasing in secondary and tertiary hospitals over the 7-year period even though the overall prevalence is still low.This is an issue of concern.

Objective:To investigate the clinical features and etiologies of hospitalized patients with spike-and-wave activation in sleep(SWAS).Methods:Case-series study.The clinical features and etiologies of patients diagnosed with SWAS in the Department of Neurology, Capital Center for Children′s Health, Capital Medical University from September 2016 to March 2023 were retrospectively analyzed.The measurement data were analyzed by normality testing, and those conforming to the normal distribution were characterized by Mean± SD deviation.After the homogeneity test of variance, either the independent sample t test or the completely random analysis of variance (ANOVA) was employed for data comparison between groups.If the results of ANOVA were statistically significant, the LSD test was utilized for pairwise comparison. Results:(1)Basic data: a total of 140 patients with SWAS were included, with the onset age of (7.4±2.1) years.There were 134 cases (134/140, 95.7%) complicated by epilepsy, and the age of epilepsy onset was (5.3±2.2) years.Seventy-four cases (74/137, 54.0%) had self-limited epilepsy and centrotemporal spikes.Twenty-one cases (21/137, 15.3%) had epileptic encephalopathy and SWAS.Eight cases (8/137, 5.8%) had developmental and epileptic encephalopathy and SWAS.Pulse Methylprednisolone therapy, Clonazepam or Clobazam, callosotomy, and left temporo-parietal-occipital craniotomy for epileptogenic lesion resection were effective in 20 cases (20/32, 62.5%), 3 cases (3/13, 23.1%), 1 case (1/2, 50.0%) and 1 case, respectively.One patient achieved development improvement and a decrease in discharge index after vagus nerve stimulation.(2) Etiologies: ①Genetic etiology: 6 patients carried pathogenic or suspected pathogenic mutations, including GRIN2A (c.87_106dupGGGTCCCCCCGCGCTAAATA/p.I36Rfs*6), GRIN2A (c.2069C>T/p.T690M), CREBBP (c.4844A>G/p.N1615S), KAT6A(c.2203C>T/p.R735X), GRIN1 (c.2326_2327insACCTCT-GGAAGCAGAACGTCTCCCTGTCCA/p.S775_I776insNLWKQNVSLS) and MECP2 (c.916C>T/p.R306C).Among them, there were no reports on the association of CREBBP and KAT6A with SWAS.②Structural etiology: there were 7 cases with perinatal brain injury and 1 case with bilateral temporo-parietal gyrus.③Metabolic etiology: 1 patient with cerebrotendinous xanthomatosis carried the pathogenic gene CYP27A1 (c.379C>T/p.R127W, c.1415G>C/p.G472A), which was not related to SWAS.④Infectious etiology: 1 case had congenital cytomegalovirus infection.⑤ Immune etiology: 1 case had autoimmune encephalitis.⑥ There were 123 cases with unknown etiologies.(3) Etiologies and clinical characteristics: SWAS occurred earlier in patients with structural etiology than that in patients with unknown etiologies ( F=4.478, P<0.05).The proportions of discharge index ≥85% ( χ2=10.079, P<0.05) and encephalopathy ( χ2=9.385, P<0.05) were higher in patients with genetic etiology than those in patients with unknown etiologies.(4) Discharge index: the patients were divided into a group with a discharge index ≥85% and a group with a discharge index < 85%.Compared with the latter group, the former group had a higher proportion of developmental retardation ( χ2=15.976, P<0.001), suffered epilepsy ( t=-3.498, P<0.05) and SWAS at a younger age ( t=-2.044, P<0.05), and used more types of antiepileptic drugs ( t=2.079, P<0.05).(5) Neurodevelopmental outcomes: 21 patients had neurodevelopmental disorders and 75 had normal neurodevelopment. Conclusions:There are various etiologies for encephalopathy or epilepsy complicated by SWAS.The patients with structural etiology may develop SWAS at a younger age, whereas those with a clearly identified pathogenic gene may exhibit a higher discharge index and a higher rate of encephalopathy.When patients present with encephalopathy or refractory epilepsy, surgical treatment should be considered if structural lesions are found.The proportion of developing encephalopathy in patients with a discharge index ≥85% is the same as that in patients with a discharge index <85%.However, the patients with a higher discharge index develop epilepsy and SWAS at a younger age, and are more difficult to treat.

OBJECTIVE: To investigate the clinical characteristics and prognosis of patients with IgD multiple myeloma (MM). METHODS: The clinical data of 8 patients with IgD MM admitted to Gansu Provincial Hospital from September 2013 to February 2023 were collected, and their clinical characteristics and prognosis were retrospectively analyzed and summarized. RESULTS: Among the 8 enrolled patients, there were 4 males and 4 females, with a median age of 60 (44-74) years. All patients had symptoms of renal insufficiency and anemia. There were 3 cases of bone invasion, 3 cases of splenomegaly, 7 cases of IgD-λ type, and 1 case of IgD-κ type. FISH examination was performed in 7 cases, and 6 of them were positive for 1q21 . There were 6 cases in DS stage III and 2 cases in DS stage II; According to ISS staging, there were 6 cases in stage III, 1 case in stage II, and 1 case in stage I; According to R-ISS staging, there were 5 cases in stage III and 3 cases in stage II. All patients received bortezomib-based combination chemotherapy, with 1 case undergoing autologous stem cell transplantation (ASCT) and 2 cases receiving daratumumab in combination. The median treatment period was 6 (1-15) cycles. The short-term efficacy was evaluated after 4-6 courses of treatment. Among the 6 patients with assessable efficacy, 1 case experienced disease progression (PD), and 5 cases achieved complete remission (CR). The median follow-up time was 26 (11-33) months, and the median progression-free survival (PFS) and median overall survival (OS) of the patients were 11.25 (3-26) months and 18.5 (4-33) months, respectively. Among the 8 patients, 4 cases died. Among the deceased patients, 3 cases were in R-ISS stage III and 3 cases were 1q21 positive. 2 of the 5 patients with early CR died due to disease progression. CONCLUSION The incidence of IgD MM is low, the symptoms of early renal damage, blood system damage and bone erosion in IgD MM patients are obvious, and the median survival time is short. ASCT and / or daratumumab may bring lasting relief for IgD MM patients, but large-scale clinical studies are still needed.
Humans ; Multiple Myeloma/therapy* ; Middle Aged ; Male ; Female ; Aged ; Prognosis ; Immunoglobulin D ; Adult ; Retrospective Studies

OBJECTIVE: To analyze the clinical characteristics and prognosis of patients with T-cell large granular lymphocytic leukemia (T-LGLL). METHODS: The clinical data of 7 patients with T-LGLL in Gansu Provincial Hospital from March 2016 to June 2023 were analyzed retrospectively. RESULTS: Among the 7 patients, 5 were male and 2 were female, with a median age of 51(28-83) years old. At the onset of illness, 6 cases showed symptoms of fatigue and anemia, 4 cases had enlarged lymph nodes, and 5 cases had splenomegaly. Examination showed that 4 cases were antinuclear antibody(ANA) positive, 5 cases were anemia. The median hemoglobin (Hb) level was 83(61-151) g/L, the median white blood cell count (WBC) was 5.6(2.0-8.7)×10⁹ /L, and the median percentage of lymphocytes in peripheral blood was 66.2(13.9-89.1)%. There were 3 cases with extremely active bone marrow hyperplasia, 2 cases with active hyperplasia, and 2 cases with decreased hyperplasia. There were 5 cases with mild myelofibrosis (MF-1), and 1 case with moderate myelofibrosis (MF-2). The median percentage of T cells was 64.3 (31.5-80.6)%. 5 cases showed the classic immunophenotype (CD3 ⁺ CD4^- CD8 ⁺), 6 cases were CD57 ⁺, 3 cases were TCRα/β ⁺, and 3 cases were TCRγ/δ ⁺. TCRG rearrangement was detected in 5 cases.The median follow-up time was 55(4-87) months, one patient died of heart disease, and the other 6 patients are surviving. CONCLUSION The incidence of T-LGLL is low. The initial symptoms of T-LGLL include anemia, fatigue, lymph node enlargement, splenomegaly, and higher percentage of lymphocytes in peripheral blood, the percentage of abnormal T cells in bone marrow was significantly increased. Analysis of flow cytometric immunophenotyping, TCR gene rearrangement, and hot spot genes such as STAT3 and STAT5b, can improve the diagnostic accuracy.
Humans ; Leukemia, Large Granular Lymphocytic/diagnosis* ; Male ; Middle Aged ; Female ; Aged ; Prognosis ; Adult ; Aged, 80 and over ; Retrospective Studies