Objective: To evaluate the efficacy and safety of plasma exchange (PE) in thymoma-associated myasthenia gravis (MG), thereby to provide theoretical support for its application in the treatment of thymoma-associated MG. Methods: A total of 133 patients with thymoma-associated MG admitted from January 2018 to September 2024 were retrospectively analyzed. Patients were matched using propensity score to reduce selection bias, yielding 22 matched pairs for both PE group (n=22) and non-PE group (n=22). Patient characteristics including gender, age of disease onset, course of disease, history of thymoma resection, clinical absolute scores [clinical absolute scores (CAS) and clinical relative scores (CRS)], and synchronized immunotherapy regimen of the two groups were analyzed. The CAS scores before and after treatment were compared between the two groups, and the CRS was used to assess the treatment efficiency. Safety of the two treatment regimens were also compared. Continuous variables were compared using the t-test or ANOVA, while categorical data were compared by the chi-square test. Results: A total of 133 patients were included and divided into two groups according to whether they underwent plasma exchange treatment: the PE group (n=22) and the non-PE group (n=111). To exclude bias caused by large difference in the number of cases between the two groups, we performed propensity score matching. After matching, the number of cases in both groups was 22. There was no significant difference in baseline clinical characteristics between the two groups (P>0.05), including gender, age of onset, duration of disease course, history of thymectomy and baseline CAS score before treatment. Compared to the non-PE group, patients in the PE group showed more significant improvement in CAS score (5.09±1.95 vs 3.59±1.50, P<0.05) and a higher CRS score (75.00% vs 50.00%, P<0.001). Compared to the non-PE group, PE group had significantly longer ICU stay, longer hospital stay and higher hospitalization cost (P<0.05). There was no statistically significant difference in adverse events between the two groups during treatment (P>0.05). During long-term follow-up, both the PE and non-PE groups showed relatively low 1-, 3-, and 5-year recurrence rate, with no significant difference between the two groups (P>0.05). Conclusion: This study indicates that plasma exchange has clear value in the treatment of patients with thymoma-associated myasthenia gravis. It can not only significantly improve patients' muscle strength to alleviate motor dysfunction and enhance quality of life, but also does not significantly increase the incidence of adverse reactions. Therefore, it can be regarded as one of the preferred treatment options that achieve a "balance between efficacy and safety" for such patients, and provides an important basis for optimizing treatment strategies, improving prognosis, and promoting the application of subsequent treatment regimens.

Kidney is one of the key target organs involved in autoinflammatory diseases (AIDs). The clinical manifestations of renal impairment associated with AIDs are diverse, including hematuria, proteinuria, nephrotic syndrome, hypertension, renal artery stenosis, renal insufficiency, and others. The pathogenesis is mostly renal amyloidosis and/or renal vasculitis/vasculopathy caused by inflammasome activation. Whether or not the kidney is involved and its degree is closely related to the prognosis of AIDs patients. This article introduces the pathogenesis of AIDs-related renal impairmen and highlights the clinical characteristics of renal damage in some AIDs, aiming to enhance clinicians′ understanding of AIDs-related renal damage, and to implement early diagnosis and treatment to improve patients′ quality of life and prognosis.

Deficiency of adenosine deaminase 2(DADA2) is a rare monogenic autoinflammatory disorder caused by genetic variations in the ADA2 gene. The disease has complex clinical manifestations. The hematological involvement is infrequent in the disease. Therefore, the disease is frequently wrongly diagnosed and missed diagnoses. This article reports a case of a child patient with DADA2 who was admitted to the Peking Union Medical College Hospital. The child had aplastic anemia. After inadequate response to treatment with glucocorticoids, cyclosporine, and various supportive measures, the patient exhibited pancytopenia. Genetic testing showed a novel homozygous mutation in the ADA2 gene (NM_001282225.2:c.712_750dupGACAACGTGCTCTACATGGAGATCAGAGCCAGGCTGCTG), with reduced ADA2 levels in peripheral blood. Based on the testing results and clinical manifestations, the patient was diagnosed DADA2. Genetic testing and monitoring of ADA2 levels proved helpful in the early diagnosis of DADA2. Treatment protocol should base on the disease phenotype and severity, and include glucocorticoids, immunosuppressants, biological agents, and hematopoietic stem cell transplantation.

Objective:To analyze the clinical and immunological characteristics of children with acute viral infection-related encephalopathy.Methods:Case-control study.A retrospective analysis was conducted on the clinical data of children diagnosed with acute viral infection-related encephalopathy during hospitalization at the Children′s Hospital, Capital Institute of Pediatrics from January 2020 to January 2023.According to the last follow-up modified Rankin scale (mRS) score, these children were divided into a good prognosis group (mRS score ≤2) and a poor prognosis group (mRS score >2), and the clinical and immunological characteristics of the children with different prognoses were analyzed.The binary Logistic regression was used to analyze the risk factors for poor prognosis.Results:A total of 28 children with acute viral infection-related encephalopathy aged 4 months to 11 years were included.There were 16 males (57%) and 12 females (43%). Among the preinfection viruses, there were 16 children of Corona virus disease 2019, 8 children of influenza A virus, 3 children of influenza B virus, and 1 child of norovirus.Among them, there were 21 children with acute necrotizing encephalopathy, 4 children with acute encephalopathy with biphasic seizures and late reduced diffusion, 2 children with mild encephalitis with a reversible splenial lesion, and 1 child with hemorrhagic shock and encephalopathy syndrome.Among the first symptoms, 24 children (85.7%) had consciousness disorders, 23 children (82.1%) had seizures, 17 children (60.7%) had speech disorders, 11 children (39.3%) had involuntary movements, and 10 children (35.7%) had abnormal mental behavior.For the site of lesion, the cranial nuclear magnetic resonance imaging revealed 17 in the thalamus, 10 in the brainstem, 9 in the basal ganglia, 8 in the cerebellar hemisphere, and 4 in the corpus callosum.In the last follow-up evaluation, 17 children had a mRS score of >2, and 11 children had a mRS score of ≤2.Univariate analysis showed that disturbance of consciousness, seizure cluster, brain stem lesion, absolute value of serum T lymphocytes, cerebrospinal fluid(CSF) protein, CSF cytokines [interleukin(IL)-1β, IL-6 and IL-8]were higher in the poor prognosis group than those in the good prognosis group.Multivariate Logistic regression analysis indicated that brain stem disease, CSF IL-1β and T lymphocyte absolute number were independent risk factors for poor prognosis.Conclusions:Brain stem lesions, cerebrospinal fluid IL-1β and the absolute number of T lymphocytes have predictive value for the prognosis of acute viral infection-associated encephalopathy.The more severe the conditions, the lower the T lymphocytes, and the higher the cytokines in some cerebrospinal fluid.

Objective:To summarize the clinical manifestations, diagnosis, treatment and prognosis of acute flaccid myelitis (AFM) in children.Methods:Clinical characteristics of 4 AFM cases from Department of Neurology, Children′s Hospital Affiliated to Capital Institute of Pediatrics, from September 2018 to November 2022, were analyzed retrospectively.Results:The age of 4 children with AFM was 7 years, 4 years and 3 months, 7 years and 1 month, 6 years and 5 months, respectively. There were 2 boys and 2 girls. Prodromal infection status showed 3 children of respiratory tract infection and 1 child of digestive tract infection. The main manifestation was asymmetrical limb weakness after infection, and the affected limb range was from monoplegia to quadriplegia. Cranial nerve injury was involved in 1 child, no encephalopathy. Magnetic resonance imaging in the spinal cord of all 4 children showed long T1 and T2 signals, mainly involving gray matter. Cerebrospinal fluid cell-protein separation was observed in 2 children. Pathogen detected in 1 child pharyngeal swab was enterovirus D68. Antibody IgM to adenovirus was positive in the blood of 1 child. Antibody IgG against Echo and Coxsackie B virus were positive in the blood of another child. After glucocorticoid, human immunoglobulin or simple symptomatic treatment and at the same time under later rehabilitation training, muscle strength recovered to different degrees, but there were disabilities left in 3 children.Conclusions:AFM should be considered in children with acute and asymmetrical flaccid paralysis accompanied by abnormal magnetic resonance imaging signal in the central region of spinal cord, especially post-infection. The effective treatment is limited and the prognosis is poor.

Humans ; Melanoma/therapy* ; Immunotherapy ; Syndrome ; Skin Neoplasms

Juvenile localized scleroderma is a rare childhood disease, the specific pathogenesis of this disease has not been fully clarified.Early recognition and timely diagnosis are crucial, early intervention is associated with good prognosis.But there is a lack of relatively reliable evaluation of disease activity and treatment response.At present, the main diagnostic basis of the disease is clinical manifestations.When there is doubt about the diagnosis, skin or subcutaneous tissue biopsy is required.In addition, high frequency Doppler ultrasound, shear-wave elastography, infrared thermal imaging, MRI, cone beam computed tomography, and dermatology evaluation tools, etc., all can reflect the patient′s condition to a certain extent.However, systematic evaluation should be improved in the process of diagnosis and treatment.In terms of treatment, hormones and methotrexate are still the first-line treatment for the disease, while evidence for second-line therapy is limited.Mycophenolate, hydroxychloroquine, cyclosporine A, tocilizumab and infliximab may play a certain role in the treatment of this disease.

Acute post streptococcal glomerulonephritis is one of the most common causes of acute post-infectious glomerulonephritis in developing countries.Now, the specific pathogenesis of the disease is unclear, the clinical manifestations are diverse, and the treatment of this disease is symptomatic support therapy.The study of the pathogenesis is helpful to improve the prevention and treatment of ASPGN.In this review, we focused on the pathogenesis, diagnosis and treatment of acute streptococcal glomerulonephritis in pediatrics.

Objective:To investigate the core competence of newly recruited nurses in ClassⅢ hospitals in Shanxi Province so as to provide a basis for the training of core competence of newly recruited nurses.Methods:From August 15 to 21, 2019, cluster sampling was used to select 2 913 newly recruited nurses and their real-time teachers from 46 Class Ⅲ general hospitals and 13 specialized hospitals in 11 cities in Shanxi Province. The Core Competency Self-rating Questionnaire of Newly Recruited Nurses and the Core Competency Observer Rating Questionnaire of Newly Recruited Nurses were used to investigate newly recruited nurses and evaluate the real-time teaching teachers of newly recruited nurses respectively.Results:In the end, 2 575 valid self-rating questionnaires and 2 400 valid observer rating questionnaires were recovered. Among 2 575 newly recruited nurses, the total score of self-rating core competence was (154.22±17.15) , and the scores of each dimension from high to low were quality accomplishment, personal traits, management ability, professional ability and professional development. Among 2 400 teachers of newly recruited nurses, the total score of the core competence evaluated by teachers in real-time teaching was (155.60±20.71) , and the scores in each dimension from high to low were quality cultivation, personal traits, professional ability, management ability and professional development. There was a statistically significant difference between the self-rating of the core competency scores of newly recruited nurses and the evaluation of teaching teachers ( P<0.05) . Conclusions:The core competence of newly recruited nurses in Shanxi Province is at the upper -middle level, and the professional development ability needs to be strengthened. There is a difference between the self -rating of the core competence of newly recruited nurses and the evaluation by teaching teachers. Therefore, the selection and training of newly recruited nurse teachers should be emphasized.

Objective To investigate the feasibility of using optimized protocol of iodine contrast agent with fixed injection time in triple-rule-out CT examination of acute chest pain patients. Methods A prospective study was conducted. The patients who underwent triple-rule-out CT examination of acute chest pain at the Second Hospital of Shanxi Medical University from September 2017 to June 2018 were enrolled. According to the patient's body mass index (BMI), they were divided into BMI ≤ 23 kg/m2 group and BMI > 23 kg/m2 group. The patients in each group were subdivided into two subgroups according to the random number table, and they were given two iodine contrast injection protocols with fixed injection time (14 s). Protocol 1 was performed with 55 mL of total iodinated contrast media: iodinated contrast media was first injected at 5.0 mL/s for 8 s, followed by the same contrast media injection at 2.5 mL/s for 6 s, finally followed by injection of 40 mL of saline at a rate of 2.5 mL/s. Protocol 2 with 60 mL of total iodinated contrast media: iodinated contrast media was first injected at 5.0 mL/s for 10 s, followed by the same contrast media injection at 2.5 mL/s for 4 s, finally followed by injection of 40 mL of saline at a rate of 2.5 mL/s. The primary and objective evaluation was conducted on the image quality of the patients' blood vessels in different segments. The primary score, CT value and contrast-to-noise ratio (CNR) of the pulmonary artery, coronary artery, aorta and total effective radiation dose for the examination were recorded. Results A total of 92 patients were enrolled in the analysis. There were 44 patients in BMI≤ 23 kg/m2 group, in which 22 patients received in protocol 1 and protocol 2, 48 patients in BMI > 23 kg/m2 group, in which 24 patients in protocol 1 and protocol 2, respectively. There was no significant difference in the effective radiation dose between the two subgroups receiving different injection protocols in different BMI groups (mSv: 6.7±1.1 vs. 6.5±0.8 between protocol 1 and protocol 2 in BMI ≤ 23 kg/m2 group; 7.8±1.0 vs. 8.0±1.1 between protocol 1 and protocol 2 in BMI > 23 kg/m2 group, both P > 0.05). In BMI ≤ 23 kg/m2 group, the CT value, CNR and primary scores of pulmonary artery images in patients receiving protocol 2 were significantly higher than those receiving protocol 1 [CT value (HU): 584±110 vs. 472±86 for main pulmonary artery, 561±93 vs. 467±78 for left pulmonary artery, 555±91 vs. 472±83 for right pulmonary artery; CNR: 24.2±7.5 vs. 18.7±4.6 for main pulmonary artery, 23.2±6.8 vs. 18.6±4.8 for left pulmonary artery, 22.9±6.7 vs. 18.8±4.7 for right pulmonary artery; primary score:4.0 (4.0, 4.0) vs. 3.5 (3.0, 4.0), all P < 0.05]; and there was no statistically significant difference in the primary or objective evaluation of coronary artery or aortic image quality between the two protocols. In BMI > 23 kg/m2 group, the CT value, CNR and primary scores of coronary artery and aortic images in patients receiving protocol 2 were significantly higher than those receiving protocol 1 [CT value (HU): 369±63 vs. 315±61 for proximal right coronary artery (RCA), 388±63 vs. 323±63 for proximal left coronary artery (LCA), 328±83 vs. 272±51 for ascending aorta, 348±82 vs. 272±49 for aortic arch; CNR: 15.0±4.6 vs. 12.3±4.7 for proximal RCA, 15.7±3.8 vs. 12.8±5.2 for proximal LCA, 13.2±5.3 vs. 10.4±4.1 for ascending aorta, 14.1±5.3 vs. 10.4±3.9 for aortic arch; primary score: 4.0 (3.0, 4.0) vs. 3.0 (3.0, 4.0) for coronary, 4.0 (3.0, 4.0) vs. 3.0 (2.0, 4.0) for aorta; all P < 0.05]; and there was no statistically significant difference in the primary or objective evaluation of pulmonary artery image quality between the two protocols. Conclusions The effective radiation dose of triple-rule-out CT examination of acute chest pain is relatively low. The low-dose iodine contrast agent application program with fixed injection time can meet the needs of clinical diagnosis of triple-rule-out CT examination of acute chest pain patients. For patients with BMI ≤ 23 kg/m2, both protocols 1 and 2 can obtain excellent image quality; in order to avoid the influence of superior vena cava artifacts, protocol 1 is recommended. For patients with BMI > 23 kg/m2, application protocol 2 can obtain stable, excellent image quality that is more suitable for clinical applications.