Objective: To evaluate the efficacy and safety of plasma exchange (PE) in thymoma-associated myasthenia gravis (MG), thereby to provide theoretical support for its application in the treatment of thymoma-associated MG. Methods: A total of 133 patients with thymoma-associated MG admitted from January 2018 to September 2024 were retrospectively analyzed. Patients were matched using propensity score to reduce selection bias, yielding 22 matched pairs for both PE group (n=22) and non-PE group (n=22). Patient characteristics including gender, age of disease onset, course of disease, history of thymoma resection, clinical absolute scores [clinical absolute scores (CAS) and clinical relative scores (CRS)], and synchronized immunotherapy regimen of the two groups were analyzed. The CAS scores before and after treatment were compared between the two groups, and the CRS was used to assess the treatment efficiency. Safety of the two treatment regimens were also compared. Continuous variables were compared using the t-test or ANOVA, while categorical data were compared by the chi-square test. Results: A total of 133 patients were included and divided into two groups according to whether they underwent plasma exchange treatment: the PE group (n=22) and the non-PE group (n=111). To exclude bias caused by large difference in the number of cases between the two groups, we performed propensity score matching. After matching, the number of cases in both groups was 22. There was no significant difference in baseline clinical characteristics between the two groups (P>0.05), including gender, age of onset, duration of disease course, history of thymectomy and baseline CAS score before treatment. Compared to the non-PE group, patients in the PE group showed more significant improvement in CAS score (5.09±1.95 vs 3.59±1.50, P<0.05) and a higher CRS score (75.00% vs 50.00%, P<0.001). Compared to the non-PE group, PE group had significantly longer ICU stay, longer hospital stay and higher hospitalization cost (P<0.05). There was no statistically significant difference in adverse events between the two groups during treatment (P>0.05). During long-term follow-up, both the PE and non-PE groups showed relatively low 1-, 3-, and 5-year recurrence rate, with no significant difference between the two groups (P>0.05). Conclusion: This study indicates that plasma exchange has clear value in the treatment of patients with thymoma-associated myasthenia gravis. It can not only significantly improve patients' muscle strength to alleviate motor dysfunction and enhance quality of life, but also does not significantly increase the incidence of adverse reactions. Therefore, it can be regarded as one of the preferred treatment options that achieve a "balance between efficacy and safety" for such patients, and provides an important basis for optimizing treatment strategies, improving prognosis, and promoting the application of subsequent treatment regimens.

Deficiency of adenosine deaminase 2(DADA2) is a rare monogenic autoinflammatory disorder caused by genetic variations in the ADA2 gene. The disease has complex clinical manifestations. The hematological involvement is infrequent in the disease. Therefore, the disease is frequently wrongly diagnosed and missed diagnoses. This article reports a case of a child patient with DADA2 who was admitted to the Peking Union Medical College Hospital. The child had aplastic anemia. After inadequate response to treatment with glucocorticoids, cyclosporine, and various supportive measures, the patient exhibited pancytopenia. Genetic testing showed a novel homozygous mutation in the ADA2 gene (NM_001282225.2:c.712_750dupGACAACGTGCTCTACATGGAGATCAGAGCCAGGCTGCTG), with reduced ADA2 levels in peripheral blood. Based on the testing results and clinical manifestations, the patient was diagnosed DADA2. Genetic testing and monitoring of ADA2 levels proved helpful in the early diagnosis of DADA2. Treatment protocol should base on the disease phenotype and severity, and include glucocorticoids, immunosuppressants, biological agents, and hematopoietic stem cell transplantation.

Objective To analyze the influencing factors on clinical response to conbercept for diabetic maeular edema (DME).Methods A total of 51 patients (51 eyes) with DME who underwent intravitreal injection of conbercept were included in this retrospective study.The general information (age,sex,body mass index,smoking history,drinking history),blood glucose indicators (duration of diabetes,fasting blood glucose,HbA 1 c),blood pressure indicators (history of hypertension,systolic blood pressure,diastolic blood pressure),lipid indicators [total cholesterol (TC),high-density lipoprotein (HDL),apolipoprotein A (APOA)],biochemical indicators [neutrophil concentration,hemoglobin (HB),serum creatinine (Scr)] were collected.The best corrected visual acuity (BCVA) and macular central macular thickness (CMT) before and after treatment were comparatively analyzed.CMT reduced not less than 20％ and BCVA increased by 2 lines as effective standards.Univariate analysis and multivariate logistic regression analysis were used to determine the factors affecting the efficacy ofintravitreal injection ofconbercept in patients with DME.Results Univariate analysis showed that diastolic blood pressure,HDL,serum neutrophil concentration,baseline CMT and baseline BCVA were associated with edema regression (P＜ 0.05);HbA 1 c was associated with vision improvement (P＜ 0.05).Multivariate logistic regression analysis showed that there was a history of smoking (OR=0.122,95％ CI 0.017-0.887),low diastolic blood pressure (OR=0.850,95％CI 0.748-0.966),low HDL (OR=0.007,95％CI 0.000 1-0.440),thin baseline CMT (OR=0.986,95％CI 0.977-0.995) were independent risk factors for failure outcome of edema regression (P＜0.05);long duration of diabetes (OR=1.191,95％CI 1.011-1.404),high APOA (OR=l.007,95％ CI 1.000-1.013) were independent risk factors for failure outcome of vision improvement.Age,fasting blood glucose,systolic blood pressure,TC,HB,Scr and other indicators had no effect on the efficacy of edema regression and vision improvement after treatment (P＞ 0.05).Conclusions Smoking history,long duration of diabetes,low diastolic blood pressure,low HDL level,high APOA level and thin baseline CMT are independent risk factors for the treatment of DME with intravitreal injection of conbercept.