OBJECTIVE To investigate the effects of multiple doses of Shugan jieyu capsules on the pharmacokinetics of voriconazole， rivaroxaban and apixaban in rats. METHODS Male SD rats were randomly divided into voriconazole group （30 mg/kg）， rivaroxaban group （2 mg/kg）， apixaban group （0.5 mg/kg）， Shugan jieyu capsules+voriconazole group （145 mg/kg+30 mg/kg）， Shugan jieyu capsules+rivaroxaban group （145 mg/kg+2 mg/kg）， Shugan jieyu capsules+apixaban group （145 mg/kg+0.5 mg/kg）， with 6 rats in each group. After the rats in each group were consecutively administered solvent （0.5% sodium carboxymethyl cellulose solution） or Shugan jieyu capsules by intragastric gavage for 8 days， they were respectively given voriconazole， rivaroxaban and apixaban solution by intragastric gavage on the 8th day. Blood samples were then collected at different time points （in voriconazole group， rivaroxaban group and corresponding drug combination groups， blood was collected before administration and at 0.17， 0.34， 0.5， 0.75， 1， 1.5， 2， 3， 4， 5， 6， 8， 10 and 12 hours post-administration； in apixaban group and corresponding drug combination group， blood was collected before administration and at 0.08， 0.17， 0.25， 0.34， 0.5， 0.75， 1， 3， 5， 7， 10 and 12 hours post-administration）. Ultra-high performance liquid chromatography-tandem mass spectrometry method was employed to determine the mass concentrations of voriconazole， rivaroxaban and apixaban in rat plasma. The main pharmacokinetic parameters of these drugs were calculated using a non-compartmental model， and the comparisons were made between groups. RESULTS Compared with single drug group， after multiple administrations of Shugan jieyu capsules， AUC0－t， AUC0－∞ and cmax of voriconazole were significantly decreased， while CLz/F was significantly increased， and tmax was also significantly prolonged （P＜0.05）. For rivaroxaban and apixaban， their tmax values were both significantly prolonged （P＜0.05）. However， there were no statistically significant differences in the other pharmacokinetic parameters between the two groups （P＞0.05）. CONCLUSIONS The combination of Shugan jieyu capsules can decrease the exposure， increase the clearance， and delay the peak concentration of oral voriconazole. However， it does not affect the exposure levels of rivaroxaban and apixaban， but it does delay the time to reach peak concentration for both drugs.

Kidney is one of the key target organs involved in autoinflammatory diseases (AIDs). The clinical manifestations of renal impairment associated with AIDs are diverse, including hematuria, proteinuria, nephrotic syndrome, hypertension, renal artery stenosis, renal insufficiency, and others. The pathogenesis is mostly renal amyloidosis and/or renal vasculitis/vasculopathy caused by inflammasome activation. Whether or not the kidney is involved and its degree is closely related to the prognosis of AIDs patients. This article introduces the pathogenesis of AIDs-related renal impairmen and highlights the clinical characteristics of renal damage in some AIDs, aiming to enhance clinicians′ understanding of AIDs-related renal damage, and to implement early diagnosis and treatment to improve patients′ quality of life and prognosis.

Deficiency of adenosine deaminase 2(DADA2) is a rare monogenic autoinflammatory disorder caused by genetic variations in the ADA2 gene. The disease has complex clinical manifestations. The hematological involvement is infrequent in the disease. Therefore, the disease is frequently wrongly diagnosed and missed diagnoses. This article reports a case of a child patient with DADA2 who was admitted to the Peking Union Medical College Hospital. The child had aplastic anemia. After inadequate response to treatment with glucocorticoids, cyclosporine, and various supportive measures, the patient exhibited pancytopenia. Genetic testing showed a novel homozygous mutation in the ADA2 gene (NM_001282225.2:c.712_750dupGACAACGTGCTCTACATGGAGATCAGAGCCAGGCTGCTG), with reduced ADA2 levels in peripheral blood. Based on the testing results and clinical manifestations, the patient was diagnosed DADA2. Genetic testing and monitoring of ADA2 levels proved helpful in the early diagnosis of DADA2. Treatment protocol should base on the disease phenotype and severity, and include glucocorticoids, immunosuppressants, biological agents, and hematopoietic stem cell transplantation.

Humans ; Melanoma/therapy* ; Immunotherapy ; Syndrome ; Skin Neoplasms

Objective:To investigate the core competence of newly recruited nurses in ClassⅢ hospitals in Shanxi Province so as to provide a basis for the training of core competence of newly recruited nurses.Methods:From August 15 to 21, 2019, cluster sampling was used to select 2 913 newly recruited nurses and their real-time teachers from 46 Class Ⅲ general hospitals and 13 specialized hospitals in 11 cities in Shanxi Province. The Core Competency Self-rating Questionnaire of Newly Recruited Nurses and the Core Competency Observer Rating Questionnaire of Newly Recruited Nurses were used to investigate newly recruited nurses and evaluate the real-time teaching teachers of newly recruited nurses respectively.Results:In the end, 2 575 valid self-rating questionnaires and 2 400 valid observer rating questionnaires were recovered. Among 2 575 newly recruited nurses, the total score of self-rating core competence was (154.22±17.15) , and the scores of each dimension from high to low were quality accomplishment, personal traits, management ability, professional ability and professional development. Among 2 400 teachers of newly recruited nurses, the total score of the core competence evaluated by teachers in real-time teaching was (155.60±20.71) , and the scores in each dimension from high to low were quality cultivation, personal traits, professional ability, management ability and professional development. There was a statistically significant difference between the self-rating of the core competency scores of newly recruited nurses and the evaluation of teaching teachers ( P<0.05) . Conclusions:The core competence of newly recruited nurses in Shanxi Province is at the upper -middle level, and the professional development ability needs to be strengthened. There is a difference between the self -rating of the core competence of newly recruited nurses and the evaluation by teaching teachers. Therefore, the selection and training of newly recruited nurse teachers should be emphasized.

Objective To investigate the feasibility of using optimized protocol of iodine contrast agent with fixed injection time in triple-rule-out CT examination of acute chest pain patients. Methods A prospective study was conducted. The patients who underwent triple-rule-out CT examination of acute chest pain at the Second Hospital of Shanxi Medical University from September 2017 to June 2018 were enrolled. According to the patient's body mass index (BMI), they were divided into BMI ≤ 23 kg/m2 group and BMI > 23 kg/m2 group. The patients in each group were subdivided into two subgroups according to the random number table, and they were given two iodine contrast injection protocols with fixed injection time (14 s). Protocol 1 was performed with 55 mL of total iodinated contrast media: iodinated contrast media was first injected at 5.0 mL/s for 8 s, followed by the same contrast media injection at 2.5 mL/s for 6 s, finally followed by injection of 40 mL of saline at a rate of 2.5 mL/s. Protocol 2 with 60 mL of total iodinated contrast media: iodinated contrast media was first injected at 5.0 mL/s for 10 s, followed by the same contrast media injection at 2.5 mL/s for 4 s, finally followed by injection of 40 mL of saline at a rate of 2.5 mL/s. The primary and objective evaluation was conducted on the image quality of the patients' blood vessels in different segments. The primary score, CT value and contrast-to-noise ratio (CNR) of the pulmonary artery, coronary artery, aorta and total effective radiation dose for the examination were recorded. Results A total of 92 patients were enrolled in the analysis. There were 44 patients in BMI≤ 23 kg/m2 group, in which 22 patients received in protocol 1 and protocol 2, 48 patients in BMI > 23 kg/m2 group, in which 24 patients in protocol 1 and protocol 2, respectively. There was no significant difference in the effective radiation dose between the two subgroups receiving different injection protocols in different BMI groups (mSv: 6.7±1.1 vs. 6.5±0.8 between protocol 1 and protocol 2 in BMI ≤ 23 kg/m2 group; 7.8±1.0 vs. 8.0±1.1 between protocol 1 and protocol 2 in BMI > 23 kg/m2 group, both P > 0.05). In BMI ≤ 23 kg/m2 group, the CT value, CNR and primary scores of pulmonary artery images in patients receiving protocol 2 were significantly higher than those receiving protocol 1 [CT value (HU): 584±110 vs. 472±86 for main pulmonary artery, 561±93 vs. 467±78 for left pulmonary artery, 555±91 vs. 472±83 for right pulmonary artery; CNR: 24.2±7.5 vs. 18.7±4.6 for main pulmonary artery, 23.2±6.8 vs. 18.6±4.8 for left pulmonary artery, 22.9±6.7 vs. 18.8±4.7 for right pulmonary artery; primary score:4.0 (4.0, 4.0) vs. 3.5 (3.0, 4.0), all P < 0.05]; and there was no statistically significant difference in the primary or objective evaluation of coronary artery or aortic image quality between the two protocols. In BMI > 23 kg/m2 group, the CT value, CNR and primary scores of coronary artery and aortic images in patients receiving protocol 2 were significantly higher than those receiving protocol 1 [CT value (HU): 369±63 vs. 315±61 for proximal right coronary artery (RCA), 388±63 vs. 323±63 for proximal left coronary artery (LCA), 328±83 vs. 272±51 for ascending aorta, 348±82 vs. 272±49 for aortic arch; CNR: 15.0±4.6 vs. 12.3±4.7 for proximal RCA, 15.7±3.8 vs. 12.8±5.2 for proximal LCA, 13.2±5.3 vs. 10.4±4.1 for ascending aorta, 14.1±5.3 vs. 10.4±3.9 for aortic arch; primary score: 4.0 (3.0, 4.0) vs. 3.0 (3.0, 4.0) for coronary, 4.0 (3.0, 4.0) vs. 3.0 (2.0, 4.0) for aorta; all P < 0.05]; and there was no statistically significant difference in the primary or objective evaluation of pulmonary artery image quality between the two protocols. Conclusions The effective radiation dose of triple-rule-out CT examination of acute chest pain is relatively low. The low-dose iodine contrast agent application program with fixed injection time can meet the needs of clinical diagnosis of triple-rule-out CT examination of acute chest pain patients. For patients with BMI ≤ 23 kg/m2, both protocols 1 and 2 can obtain excellent image quality; in order to avoid the influence of superior vena cava artifacts, protocol 1 is recommended. For patients with BMI > 23 kg/m2, application protocol 2 can obtain stable, excellent image quality that is more suitable for clinical applications.

In a one-step fermentation system of vitamin C production with Gluconobacter oxydans and Ketogulonicigenium vulgare, a functional module of α-lipoic acid biosynthesis was constructed in G. oxydans. The engineered G. oxydans was co-cultured with K. vulgare to enhance the growth and 2-keto-L-gulonic acid (2-KGA) production of K. vulgare. This one-step fermentation system alleviated the growth inhibition during the mono-culture of K. vulgare and strengthened the interaction between the two bacteria. Moreover, the yield of vitamin C precursor (2-KGA) increased to 73.34 g/L (the control group was 59.09 g/L), and the conversion of D-sorbitol to 2-KGA increased to 86.0%. This study provides a new idea for further optimizing the one-step fermentation system of vitamin C production.
Ascorbic Acid ; Fermentation ; Gluconobacter oxydans ; Rhodobacteraceae ; Thioctic Acid ; biosynthesis

Objective To analyze the influencing factors on clinical response to conbercept for diabetic maeular edema (DME).Methods A total of 51 patients (51 eyes) with DME who underwent intravitreal injection of conbercept were included in this retrospective study.The general information (age,sex,body mass index,smoking history,drinking history),blood glucose indicators (duration of diabetes,fasting blood glucose,HbA 1 c),blood pressure indicators (history of hypertension,systolic blood pressure,diastolic blood pressure),lipid indicators [total cholesterol (TC),high-density lipoprotein (HDL),apolipoprotein A (APOA)],biochemical indicators [neutrophil concentration,hemoglobin (HB),serum creatinine (Scr)] were collected.The best corrected visual acuity (BCVA) and macular central macular thickness (CMT) before and after treatment were comparatively analyzed.CMT reduced not less than 20％ and BCVA increased by 2 lines as effective standards.Univariate analysis and multivariate logistic regression analysis were used to determine the factors affecting the efficacy ofintravitreal injection ofconbercept in patients with DME.Results Univariate analysis showed that diastolic blood pressure,HDL,serum neutrophil concentration,baseline CMT and baseline BCVA were associated with edema regression (P＜ 0.05);HbA 1 c was associated with vision improvement (P＜ 0.05).Multivariate logistic regression analysis showed that there was a history of smoking (OR=0.122,95％ CI 0.017-0.887),low diastolic blood pressure (OR=0.850,95％CI 0.748-0.966),low HDL (OR=0.007,95％CI 0.000 1-0.440),thin baseline CMT (OR=0.986,95％CI 0.977-0.995) were independent risk factors for failure outcome of edema regression (P＜0.05);long duration of diabetes (OR=1.191,95％CI 1.011-1.404),high APOA (OR=l.007,95％ CI 1.000-1.013) were independent risk factors for failure outcome of vision improvement.Age,fasting blood glucose,systolic blood pressure,TC,HB,Scr and other indicators had no effect on the efficacy of edema regression and vision improvement after treatment (P＞ 0.05).Conclusions Smoking history,long duration of diabetes,low diastolic blood pressure,low HDL level,high APOA level and thin baseline CMT are independent risk factors for the treatment of DME with intravitreal injection of conbercept.

Objective To understand the status of vocational maturity of undergraduate nursing students and to discuss the influencing factors. Methods From November 2016 to February 2017, a total of 470 undergraduate in junior grade from School of Nursing of Zhengzhou University were selected as the research objects by convenient sampling method. They were investigated with a general information questionnaire, Career Maturity Inventory (CMI), College Student Adaptability Inventory (CSAI), and the Measuring Scale of Career Self-efficacy. A total of 367 valid questionnaires were collected. Pearson correlation analysis was used to analyze the correlation between career maturity and adaptability, career maturity and self-efficacy of nursing students. Multiple stepwise regression was used to analyze the influencing factors of career maturity of nursing students. Results The total score of occupation maturity of undergraduate nursing students was (107.67±10.35), which was at a middle level. The total score of adaptability and career self-efficacy were positively correlated with the total score of career maturity (r=0.580, 0.140; P< 0.01). Career choice adaptability, overcoming obstacles effectiveness, difficulty perception, self-care adaptability, confidence level and outcome expectation were the influencing factors of career maturity of undergraduate nursing students (P<0.05). Conclusions In nursing education, we should attach importance to students' vocational education, enhance their adaptability and career self-efficacy, so as to improve their career maturity.

Objective To explore the effect of various information means in the training of newly recruited nurses and to provide a practical basis for comprehensive and thorough development of the training. Methods Nurses who are enrolled in 2015 were chosen as the test group. Its applications can be in the form of Mobile APP,office software,online software and We Chat public platform. Afterwards,the effect of various information means can be judged by comparing the test results with the nurses who are enrolled in 2013 (the control group). The nurses in the test group were surveyed in the form of questionnaires to evaluate the training effect. Results The scores of theory ex amination and nasal feeding in the test group were higher than those of control group(P<0.01). The 93.8 percent of the nurses in test group believe that training is beneficial to the understanding and consolidation of knowledge as well as to improve the ability of self-learning. Also the training effect is prominent. Conclusion The various information means in the training of newly recruited nurses can improve training efficiency and enhance training effectiveness.