Type 2 diabetes mellitus(T2DM)is an insulin resistance disease.Improving insulin resis-tance and controlling blood glucose are the main means of clinical treatment for T2DM.Empa-gliflozin is a highly selective sodium-dependent glu-cose transporters(SGLT)2 inhibitor,which is inde-pendent of insulin.It can effectively control blood glucose levels,reduce blood pressure and body weight,protect heart and kidney function,reduce the rehospitalization rate and the risk of death in patients with heart failure(HF),and does not in-crease the risk of hypoglycemia.Empagliflozin can be used alone or in combination with other hypo-glycemic drugs to control blood glucose.This arti-cle reviews the mechanism of action,clinical bene-fits,and combination with other drugs of empa-gliflozin,aiming to provide reference for the clinical use of empagliflozin.

Objective:To investigate the clinical characteristics of a family with maturity-onset diabetes of the young type 3(MODY3) and assess its association with the novel HNF1A-c.47T>A variant.Methods:A genetic pedigree of the MODY3 family was constructed, and clinical data were collected. Whole-exome sequencing combined with Sanger sequencing was used, followed for familial co-segregation analysis. Bioinformatics tools, including multiple sequence alignment–based conservation analysis and protein structural prediction, were conducted to validate the association between the novel HNF1A-c.47T>A variant and MODY3.Results:Seven MODY3 patients were diagnosed in this family, all harboring the HNF1A-c.47T>A heterozygous variant. AlphaFold2 protein structure prediction indicated that the HNF1A-c.47T>A variant altered the conformation of the first pair of α-helices within the protein dimerization domain.Conclusion:Based on co-segregation analysis, sequence conservation assessment, protein structure prediction, and classification based on American College of Medical Genetics and Genomics(ACMG) Guidelines, the HNF1A-c.47T>A variant was determined to be pathogenic for MODY3. This study reports this novel pathogenic variant, expanding the mutational spectrum of MODY3. By revealing its disruptive effect on the protein dimerization domain, the findings provide a potential molecular basis for the diagnosis and management of patients carrying similar variants.

Type 2 diabetes mellitus(T2DM)is an insulin resistance disease.Improving insulin resis-tance and controlling blood glucose are the main means of clinical treatment for T2DM.Empa-gliflozin is a highly selective sodium-dependent glu-cose transporters(SGLT)2 inhibitor,which is inde-pendent of insulin.It can effectively control blood glucose levels,reduce blood pressure and body weight,protect heart and kidney function,reduce the rehospitalization rate and the risk of death in patients with heart failure(HF),and does not in-crease the risk of hypoglycemia.Empagliflozin can be used alone or in combination with other hypo-glycemic drugs to control blood glucose.This arti-cle reviews the mechanism of action,clinical bene-fits,and combination with other drugs of empa-gliflozin,aiming to provide reference for the clinical use of empagliflozin.

Objective:To investigate the clinical characteristics of a family with maturity-onset diabetes of the young type 3(MODY3) and assess its association with the novel HNF1A-c.47T>A variant.Methods:A genetic pedigree of the MODY3 family was constructed, and clinical data were collected. Whole-exome sequencing combined with Sanger sequencing was used, followed for familial co-segregation analysis. Bioinformatics tools, including multiple sequence alignment–based conservation analysis and protein structural prediction, were conducted to validate the association between the novel HNF1A-c.47T>A variant and MODY3.Results:Seven MODY3 patients were diagnosed in this family, all harboring the HNF1A-c.47T>A heterozygous variant. AlphaFold2 protein structure prediction indicated that the HNF1A-c.47T>A variant altered the conformation of the first pair of α-helices within the protein dimerization domain.Conclusion:Based on co-segregation analysis, sequence conservation assessment, protein structure prediction, and classification based on American College of Medical Genetics and Genomics(ACMG) Guidelines, the HNF1A-c.47T>A variant was determined to be pathogenic for MODY3. This study reports this novel pathogenic variant, expanding the mutational spectrum of MODY3. By revealing its disruptive effect on the protein dimerization domain, the findings provide a potential molecular basis for the diagnosis and management of patients carrying similar variants.

OBJECTIVE To investigate the effects of multiple doses of Shugan jieyu capsules on the pharmacokinetics of voriconazole,rivaroxaban and apixaban in rats.METHODS Male SD rats were randomly divided into voriconazole group(30 mg/kg),rivaroxaban group(2 mg/kg),apixaban group(0.5 mg/kg),Shugan jieyu capsules+voriconazole group(145 mg/kg+30 mg/kg),Shugan jieyu capsules+rivaroxaban group(145 mg/kg+2 mg/kg),Shugan jieyu capsules+apixaban group(145 mg/kg+0.5 mg/kg),with 6 rats in each group.After the rats in each group were consecutively administered solvent(0.5%sodium carboxymethyl cellulose solution)or Shugan jieyu capsules by intragastric gavage for 8 days,they were respectively given voriconazole,rivaroxaban and apixaban solution by intragastric gavage on the 8th day.Blood samples were then collected at different time points(in voriconazole group,rivaroxaban group and corresponding drug combination groups,blood was collected before administration and at 0.17,0.34,0.5,0.75,1,1.5,2,3,4,5,6,8,10 and 12 hours post-administration;in apixaban group and corresponding drug combination group,blood was collected before administration and at 0.08,0.17,0.25,0.34,0.5,0.75,1,3,5,7,10 and 12 hours post-administration).Ultra-high performance liquid chromatography-tandem mass spectrometry method was employed to determine the mass concentrations of voriconazole,rivaroxaban and apixaban in rat plasma.The main pharmacokinetic parameters of these drugs were calculated using a non-compartmental model,and the comparisons were made between groups.RESULTS Compared with single drug group,after multiple administrations of Shugan jieyu capsules,AUC0-t,AUC0-∞ and cmax of voriconazole were significantly decreased,while CLz/F was significantly increased,and tmax was also significantly prolonged(P＜0.05).For rivaroxaban and apixaban,their tmax values were both significantly prolonged(P＜0.05).However,there were no statistically significant differences in the other pharmacokinetic parameters between the two groups(P＞0.05).CONCLUSIONS The combination of Shugan jieyu capsules can decrease the exposure,increase the clearance,and delay the peak concentration of oral voriconazole.However,it does not affect the exposure levels of rivaroxaban and apixaban,but it does delay the time to reach peak concentration for both drugs.

Kidney is one of the key target organs involved in autoinflammatory diseases (AIDs). The clinical manifestations of renal impairment associated with AIDs are diverse, including hematuria, proteinuria, nephrotic syndrome, hypertension, renal artery stenosis, renal insufficiency, and others. The pathogenesis is mostly renal amyloidosis and/or renal vasculitis/vasculopathy caused by inflammasome activation. Whether or not the kidney is involved and its degree is closely related to the prognosis of AIDs patients. This article introduces the pathogenesis of AIDs-related renal impairmen and highlights the clinical characteristics of renal damage in some AIDs, aiming to enhance clinicians′ understanding of AIDs-related renal damage, and to implement early diagnosis and treatment to improve patients′ quality of life and prognosis.

Deficiency of adenosine deaminase 2(DADA2) is a rare monogenic autoinflammatory disorder caused by genetic variations in the ADA2 gene. The disease has complex clinical manifestations. The hematological involvement is infrequent in the disease. Therefore, the disease is frequently wrongly diagnosed and missed diagnoses. This article reports a case of a child patient with DADA2 who was admitted to the Peking Union Medical College Hospital. The child had aplastic anemia. After inadequate response to treatment with glucocorticoids, cyclosporine, and various supportive measures, the patient exhibited pancytopenia. Genetic testing showed a novel homozygous mutation in the ADA2 gene (NM_001282225.2:c.712_750dupGACAACGTGCTCTACATGGAGATCAGAGCCAGGCTGCTG), with reduced ADA2 levels in peripheral blood. Based on the testing results and clinical manifestations, the patient was diagnosed DADA2. Genetic testing and monitoring of ADA2 levels proved helpful in the early diagnosis of DADA2. Treatment protocol should base on the disease phenotype and severity, and include glucocorticoids, immunosuppressants, biological agents, and hematopoietic stem cell transplantation.

Humans ; Melanoma/therapy* ; Immunotherapy ; Syndrome ; Skin Neoplasms

Objective:To investigate the core competence of newly recruited nurses in ClassⅢ hospitals in Shanxi Province so as to provide a basis for the training of core competence of newly recruited nurses.Methods:From August 15 to 21, 2019, cluster sampling was used to select 2 913 newly recruited nurses and their real-time teachers from 46 Class Ⅲ general hospitals and 13 specialized hospitals in 11 cities in Shanxi Province. The Core Competency Self-rating Questionnaire of Newly Recruited Nurses and the Core Competency Observer Rating Questionnaire of Newly Recruited Nurses were used to investigate newly recruited nurses and evaluate the real-time teaching teachers of newly recruited nurses respectively.Results:In the end, 2 575 valid self-rating questionnaires and 2 400 valid observer rating questionnaires were recovered. Among 2 575 newly recruited nurses, the total score of self-rating core competence was (154.22±17.15) , and the scores of each dimension from high to low were quality accomplishment, personal traits, management ability, professional ability and professional development. Among 2 400 teachers of newly recruited nurses, the total score of the core competence evaluated by teachers in real-time teaching was (155.60±20.71) , and the scores in each dimension from high to low were quality cultivation, personal traits, professional ability, management ability and professional development. There was a statistically significant difference between the self-rating of the core competency scores of newly recruited nurses and the evaluation of teaching teachers ( P<0.05) . Conclusions:The core competence of newly recruited nurses in Shanxi Province is at the upper -middle level, and the professional development ability needs to be strengthened. There is a difference between the self -rating of the core competence of newly recruited nurses and the evaluation by teaching teachers. Therefore, the selection and training of newly recruited nurse teachers should be emphasized.

Objective To investigate the feasibility of using optimized protocol of iodine contrast agent with fixed injection time in triple-rule-out CT examination of acute chest pain patients. Methods A prospective study was conducted. The patients who underwent triple-rule-out CT examination of acute chest pain at the Second Hospital of Shanxi Medical University from September 2017 to June 2018 were enrolled. According to the patient's body mass index (BMI), they were divided into BMI ≤ 23 kg/m2 group and BMI > 23 kg/m2 group. The patients in each group were subdivided into two subgroups according to the random number table, and they were given two iodine contrast injection protocols with fixed injection time (14 s). Protocol 1 was performed with 55 mL of total iodinated contrast media: iodinated contrast media was first injected at 5.0 mL/s for 8 s, followed by the same contrast media injection at 2.5 mL/s for 6 s, finally followed by injection of 40 mL of saline at a rate of 2.5 mL/s. Protocol 2 with 60 mL of total iodinated contrast media: iodinated contrast media was first injected at 5.0 mL/s for 10 s, followed by the same contrast media injection at 2.5 mL/s for 4 s, finally followed by injection of 40 mL of saline at a rate of 2.5 mL/s. The primary and objective evaluation was conducted on the image quality of the patients' blood vessels in different segments. The primary score, CT value and contrast-to-noise ratio (CNR) of the pulmonary artery, coronary artery, aorta and total effective radiation dose for the examination were recorded. Results A total of 92 patients were enrolled in the analysis. There were 44 patients in BMI≤ 23 kg/m2 group, in which 22 patients received in protocol 1 and protocol 2, 48 patients in BMI > 23 kg/m2 group, in which 24 patients in protocol 1 and protocol 2, respectively. There was no significant difference in the effective radiation dose between the two subgroups receiving different injection protocols in different BMI groups (mSv: 6.7±1.1 vs. 6.5±0.8 between protocol 1 and protocol 2 in BMI ≤ 23 kg/m2 group; 7.8±1.0 vs. 8.0±1.1 between protocol 1 and protocol 2 in BMI > 23 kg/m2 group, both P > 0.05). In BMI ≤ 23 kg/m2 group, the CT value, CNR and primary scores of pulmonary artery images in patients receiving protocol 2 were significantly higher than those receiving protocol 1 [CT value (HU): 584±110 vs. 472±86 for main pulmonary artery, 561±93 vs. 467±78 for left pulmonary artery, 555±91 vs. 472±83 for right pulmonary artery; CNR: 24.2±7.5 vs. 18.7±4.6 for main pulmonary artery, 23.2±6.8 vs. 18.6±4.8 for left pulmonary artery, 22.9±6.7 vs. 18.8±4.7 for right pulmonary artery; primary score:4.0 (4.0, 4.0) vs. 3.5 (3.0, 4.0), all P < 0.05]; and there was no statistically significant difference in the primary or objective evaluation of coronary artery or aortic image quality between the two protocols. In BMI > 23 kg/m2 group, the CT value, CNR and primary scores of coronary artery and aortic images in patients receiving protocol 2 were significantly higher than those receiving protocol 1 [CT value (HU): 369±63 vs. 315±61 for proximal right coronary artery (RCA), 388±63 vs. 323±63 for proximal left coronary artery (LCA), 328±83 vs. 272±51 for ascending aorta, 348±82 vs. 272±49 for aortic arch; CNR: 15.0±4.6 vs. 12.3±4.7 for proximal RCA, 15.7±3.8 vs. 12.8±5.2 for proximal LCA, 13.2±5.3 vs. 10.4±4.1 for ascending aorta, 14.1±5.3 vs. 10.4±3.9 for aortic arch; primary score: 4.0 (3.0, 4.0) vs. 3.0 (3.0, 4.0) for coronary, 4.0 (3.0, 4.0) vs. 3.0 (2.0, 4.0) for aorta; all P < 0.05]; and there was no statistically significant difference in the primary or objective evaluation of pulmonary artery image quality between the two protocols. Conclusions The effective radiation dose of triple-rule-out CT examination of acute chest pain is relatively low. The low-dose iodine contrast agent application program with fixed injection time can meet the needs of clinical diagnosis of triple-rule-out CT examination of acute chest pain patients. For patients with BMI ≤ 23 kg/m2, both protocols 1 and 2 can obtain excellent image quality; in order to avoid the influence of superior vena cava artifacts, protocol 1 is recommended. For patients with BMI > 23 kg/m2, application protocol 2 can obtain stable, excellent image quality that is more suitable for clinical applications.