1.Clinical and genetic analysis of two patients with CHARGE syndrome due to de novo variants of CHD7 gene.
Yan DONG ; Xiaoyi SHI ; Kaixian DU ; Yali SHI ; Jun WANG ; Tianming JIA ; Ke ZHANG ; Ruijuan XU ; Lijun WANG
Chinese Journal of Medical Genetics 2022;39(4):387-391
OBJECTIVE:
To analyze the clinical characteristics and genetic basis of two children patients with CHARGE syndrome.
METHODS:
The clinical features of the two patients were analyzed, and potential variants were detected by Trio whole exome sequencing (trio-WES) of the probands and their parents.
RESULTS:
Child 1 has manifested cerebellar vermis dysplasia, enlargement of cerebral ventricles, whereas child 2 manifested with infantile spasm and congenital hip dysplasia. Both children were found to harbor de novo heterozygous variants of the CHD7 gene, namely c.4015C>T (exon 17) and c.5050G>A (exon 22). Based on the guidelines of the American College of Medical Genetics and Genomics, the two variants were rated as pathogenic variants, and the related disease was CHARGE syndrome. Furthermore, child 2 was also found to harbor a novel heterozygous c.6161A>C (p.Gln2054Pro) missense variant of COL12A1 gene, which was rated as possibly pathogenic, and the associated disease was Bethlem myopathy type 2, which is partially matched with the patient' s clinical phenotype.
CONCLUSION
The special clinical phenotypes shown by the two children harboring novel CHD7 variants have further expanded the phenotypic spectrum of CHARGE syndrome.
CHARGE Syndrome/genetics*
;
DNA Helicases/genetics*
;
DNA-Binding Proteins/genetics*
;
Genetic Testing
;
Heterozygote
;
Humans
;
Mutation
;
Phenotype
;
Whole Exome Sequencing
2.Clinical phenotype and analysis of CHD7 gene variants in three children patients with CHARGE syndrome.
Chinese Journal of Medical Genetics 2021;38(1):42-46
OBJECTIVE:
To explore the genetic basis for three children patients with CHARGE syndrome.
METHODS:
The three children and their parents were subjected to whole exome sequencing, and candidate variants were verified by Sanger sequencing.
RESULTS:
All patients had ocular anomalies including microphthalmia, microcornea, lens opacity, and coloboma of iris, optic nerve, retina and choroid. And all were found to carry heterozygous variants of the CHD7 gene, which included two frameshifting variant, namely c.1447delG (p.Val483Leufs*12) and c.1021_1048delAATCAGTCCGTACCAAGATACCCCAATG (p.Asn341Leufs*2) in exon 2, which were unreported previously and were pathogenic based on the American College of Medical Genetics and Genomics standards and guidelines (PVS1+PM2+PM6), and a nonsense variant c.7957C>T (p.Arg2653*) in exon 36, which was known to be likely pathogenic (PVS1+PM2+PP4). Sanger sequencing confirmed that the two frameshifting mutations were de novo, and the nonsense mutation was also suspected to be de novo.
CONCLUSION
Pathological variants of the CHD7 gene probably underlay the CHARGE syndrome in the three patients.
CHARGE Syndrome/genetics*
;
Child
;
DNA Helicases/genetics*
;
DNA-Binding Proteins/genetics*
;
Genetic Variation
;
Humans
;
Mutation
;
Phenotype
3.Identification of a Novel CHD7 Mutation in a CHARGE Syndrome Patient in Indonesia
Gara Samara BRAJADENTA ; Agustini UTARI ; Sylvie PATRI ; Frédéric BILAN ; Sultana Muhammad Hussein FARADZ ; Alain KITZIS ; Vincent THOREAU
Annals of Laboratory Medicine 2019;39(5):503-506
No abstract available.
CHARGE Syndrome
;
Humans
;
Indonesia
4.A novel CHD7 mutation in an adolescent presenting with growth and pubertal delay
Maria Christina ANTONIOU ; Thérèse BOUTHORS ; Cheng XU ; Franziska PHAN-HUG ; Eglantine ELOWE-GRUAU ; Sophie STOPPA-VAUCHER ; Almer VAN DER SLOOT ; James ACIERNO ; Daniele CASSATELLA ; Celine RICHARD ; Andrew DWYER ; Nelly PITTELOUD ; Michael HAUSCHILD
Annals of Pediatric Endocrinology & Metabolism 2019;24(1):49-54
Mutations in the CHD7 gene, encoding for the chromodomain helicase DNA-binding protein 7, are found in approximately 60% of individuals with CHARGE syndrome (coloboma, heart defects, choanal atresia, retarded growth and development, genital hypoplasia, ear abnormalities and/or hearing loss). Herein, we present a clinical case of a 14-year-old male presenting for evaluation of poor growth and pubertal delay highlighting the diagnostic challenges of CHARGE syndrome. The patient was born full term and underwent surgery at 5 days of life for bilateral choanal atresia. Developmental milestones were normally achieved. At age 14 his height and weight were
Adolescent
;
CHARGE Syndrome
;
Choanal Atresia
;
Diagnosis
;
Ear
;
Follicle Stimulating Hormone
;
Follow-Up Studies
;
Genetic Testing
;
Gonadotropins
;
Growth and Development
;
Hearing
;
Heart
;
Humans
;
Luteinizing Hormone
;
Male
;
Olfaction Disorders
;
Puberty, Delayed
;
Testis
;
Testosterone
5.Successful intubation using video laryngoscope in a child with CHARGE syndrome: A case report.
Jeongho KIM ; Jeong In HONG ; Kyoung lin CHAE ; Kyoung Sub YOON ; Sang Yoong PARK ; Seung Cheol LEE ; Jong Hwan LEE ; Chan Jong CHUNG ; So Ron CHOI
Anesthesia and Pain Medicine 2019;14(1):40-43
CHARGE syndrome is a rare genetic disorder with CHD7 gene mutation. CHARGE is an acronym for coloboma (C), heart disease (H), atresia of choanae (A), retardation of growth (R), genitourinary malformation (G), and ear abnormalities (E). Patients with CHARGE syndrome need to undergo many surgeries due to their various congenital anomalies. Since airway abnormalities frequently accompany CHARGE syndrome, general anesthesia remains a challenge. Here we report a case of difficult intubation in a 35-month-old boy with CHARGE syndrome during general anesthesia and the experience of successful intubation using D-blade of C-MAC® video laryngoscope.
Airway Management
;
Anesthesia, General
;
CHARGE Syndrome*
;
Child*
;
Child, Preschool
;
Coloboma
;
Ear
;
Heart Diseases
;
Humans
;
Intubation*
;
Laryngoscopes*
;
Male
;
Nasopharynx
;
Pediatrics
6.Genetic analysis of two children patients affected with CHARGE syndrome.
Guoqiang LI ; Niu LI ; Yufei XU ; Juan LI ; Yu DING ; Yiping SHEN ; Xiumin WANG ; Jian WANG
Chinese Journal of Medical Genetics 2018;35(2):244-247
OBJECTIVETo analyze two Chinese pediatric patients with multiple malformations and growth and development delay.
METHODSBoth patients were subjected to targeted gene sequencing, and the results were analyzed with Ingenuity Variant Analysis software. Suspected pathogenic variations were verified by Sanger sequencing.
RESULTSHigh-throughput sequencing showed that both patients have carried heterozygous variants of the CHD7 gene. Patient 1 carried a nonsense mutation in exon 36 (c.7957C>T, p.Arg2653*), while patient 2 carried a nonsense mutation of exon 2 (c.718C>T, p.Gln240*). Sanger sequencing confirmed the above mutations in both patients, while their parents were of wild-type for the corresponding sites, indicating that the two mutations have happened de novo.
CONCLUSIONTwo patients were diagnosed with CHARGE syndrome by high-throughput sequencing.
CHARGE Syndrome ; genetics ; DNA Helicases ; genetics ; DNA-Binding Proteins ; genetics ; Genetic Testing ; High-Throughput Nucleotide Sequencing ; Humans ; Infant ; Male ; Mutation
7.A Case of Bilateral Choanal Atresia without Stenting.
Dong Gun LEE ; Sang Min KIM ; Chan Eun WE ; Yong Wan KIM
Korean Journal of Otolaryngology - Head and Neck Surgery 2016;59(11):787-791
Bilateral choanal atresia is a rare disorder characterized by bilateral obstruction of the posterior end of the nasal cavity. It can be present in isolation or associated with multiple disorders such as coloboma, heart defect, choanal atresia, retarded growth, genital hypoplasia, ear abnormalities (CHARGE) syndrome. Because congenital bilateral choanal atresia presents as respiratory distress at birth, immediate diagnosis and adequate treatment is required. Traditionally, using stents was a part of the postoperative treatment to provide a low rate of restenosis but recently it is controversial. Currently nasal endoscopic approach is mainly used with or without stenting. We report a case of CHARGE syndrome with bilateral choanal atresia treated by transnasal endoscopic approach without stenting.
CHARGE Syndrome
;
Choanal Atresia*
;
Coloboma
;
Diagnosis
;
Ear
;
Heart
;
Nasal Cavity
;
Parturition
;
Stents*
8.Non-Homologous End Joining Repair Mechanism-Mediated Deletion of CHD7 Gene in a Patient with Typical CHARGE Syndrome.
Seung Jun LEE ; Jong Hee CHAE ; Jung Ae LEE ; Sung Im CHO ; Soo Hyun SEO ; Hyunwoong PARK ; Moon Woo SEONG ; Sung Sup PARK
Annals of Laboratory Medicine 2015;35(1):141-145
CHARGE syndrome MIM #214800 is an autosomal dominant syndrome involving multiple congenital malformations. Clinical symptoms include coloboma, heart defects, choanal atresia, retardation of growth or development, genital hypoplasia, and ear anomalies or deafness. Mutations in the chromodomain helicase DNA binding protein 7 (CHD7) gene have been found in 65-70% of CHARGE syndrome patients. Here, we describe a 16-month-old boy with typical CHARGE syndrome, who was referred for CHD7 gene analysis. Sequence analysis and multiplex ligation-dependent probe amplification were performed. A heterozygous 38,304-bp deletion encompassing exon 3 with a 4-bp insertion was identified. There were no Alu sequences adjacent to the breakpoints, and no sequence microhomology was observed at the junction. Therefore, this large deletion may have been mediated by non-homologous end joining. The mechanism of the deletion in the current case differs from the previously suggested mechanisms underlying large deletions or complex genomic rearrangements in the CHD7 gene, and this is the first report of CHD7 deletion by this mechanism worldwide.
Alu Elements/genetics
;
Base Sequence
;
CHARGE Syndrome/diagnosis/*genetics
;
DNA/chemistry/metabolism
;
*DNA End-Joining Repair
;
DNA Helicases/*genetics/metabolism
;
DNA-Binding Proteins/*genetics/metabolism
;
Exons
;
Gene Dosage
;
Heterozygote
;
Humans
;
Infant
;
Male
;
Multiplex Polymerase Chain Reaction
;
Mutation
;
Sequence Analysis, DNA
;
*Sequence Deletion
9.A case of CHARGE syndrome featuring immunodeficiency and hypocalcemia.
Yu Yun SON ; Byeonghyeon LEE ; Chae Ri SUH ; Hyo Kyoung NAM ; Jung Hwa LEE ; Young Sook HONG ; Joo Won LEE
Journal of Genetic Medicine 2015;12(1):57-60
CHARGE syndrome (coloboma, heart defects, atresia choanae, retarded growth and development, genital hypoplasia, and ear abnormalities) is characterized by multiple malformations and is diagnosed using distinct consensus criteria. Mutations in the gene encoding chromodomain helicase DNA-binding protein 7 (CHD7) are the major cause of CHARGE syndrome. Clinical features of CHARGE syndrome considerably overlap those of 22q11.2 deletion syndrome. Of these features, immunodeficiency and hypocalcemia are frequently reported in patients with 22q11.2 deletion syndrome but are rarely reported in patients with CHARGE syndrome. In this report, we have described the case of a patient with typical phenotypes of 22q11.2 deletion syndrome but without the proven chromosome microdeletion. Mutation analysis of CHD7 identified a pathogenic mutation (c.2238+1G>A) in this patient. To our knowledge, this is the first case of CHARGE syndrome with immunodeficiency and hypocalcemia in Korea. Our observations suggest that mutation analysis of CHD7 should be performed for patients showing the typical phenotypes of 22q11.2 deletion syndrome but lacking the proven chromosome microdeletion.
CHARGE Syndrome*
;
Consensus
;
DiGeorge Syndrome
;
Ear
;
Growth and Development
;
Heart
;
Humans
;
Hypocalcemia*
;
Korea
;
Nasopharynx
;
Phenotype
10.Identification of a novel mutation in the CHD7 gene in a patient with CHARGE syndrome.
Yeonkyung KIM ; Ho Seok LEE ; Jung Seok YU ; Kangmo AHN ; Chang Seok KI ; Jihyun KIM
Korean Journal of Pediatrics 2014;57(1):46-49
CHARGE syndrome has been estimated to occur in 1:10,000 births worldwide and shows various clinical manifestations. It is a genetic disorder characterized by a specific and a recognizable pattern of anomalies. The major clinical features are ocular coloboma, heart malformations, atresia of the choanae, growth retardation, genital hypoplasia, and ear abnormalities. The chromodomain helicase DNA-binding protein 7 (CHD7) gene, located on chromosome 8q12.1, causes CHARGE syndrome. The CHD7 protein is an adenosine triphosphate (ATP)-dependent chromatin remodeling protein. A total of 67% of patients clinically diagnosed with CHARGE syndrome have CHD7 mutations. Five hundred twenty-eight pathogenic and unique CHD7 alterations have been identified so far. We describe a patient with a CHARGE syndrome diagnosis who carried a novel de novo mutation, a c.3896T>C (p. leu1299Pro) missense mutation, in the CHD7 gene. This finding will provide more information for genetic counseling and expand our understanding of the pathogenesis and development of CHARGE syndrome.
Adenosine Triphosphate
;
CHARGE Syndrome*
;
Chromatin Assembly and Disassembly
;
Coloboma
;
Diagnosis
;
Ear
;
Genetic Counseling
;
Heart
;
Humans
;
Mutation, Missense
;
Nasopharynx
;
Parturition

Result Analysis
Print
Save
E-mail