OBJECTIVE: To analyze the clinical phenotype and genetic basis of four children with CHARGE syndrome. METHODS: A retrospective analysis was conducted on four children diagnosed with CHARGE syndrome at Xiamen Children's Hospital from May 2019 to May 2025. Peripheral venous blood samples were collected from the children and their parents and subjected to trio-whole exome sequencing. Candidate variants were verified by Sanger sequencing. Online tools were used for the conservation analysis and protein structure prediction. This study was approved by the Medical Ethics Committee of the Hospital (Ethics No.: 2024-126). RESULTS: The four children have included two neonates, one infant and one child, with their age at the initial diagnosis ranging from 16 days after birth to 11 years old. Their initial manifestations were not typical of CHARGE syndrome. All children were found to harbor missense variants of the CHD7 gene, including c.3059T>C (p.L1020S), c.3302G>A (p.C1101Y), c.5879C>T (p.S1960F) and c.8093C>T (p.S2698L). Sanger sequencing confirmed that two were de novo variants, and two were inherited from their parents. In child 1, the leucine at position 1020 was highly conserved, and the p.L1020S variant did not alter the spatial structure and hydrogen bond connections of the CHD7 protein, though the shape of the binding cavity and the number and distribution of binding probe clusters have changed. In child 4, an unreported variant in the epilepsy gene SCN9A (c.2152T>C, p.Y718H) was detected, along with bilateral lower limb deformities. Literature review suggested that missense variants of the CHD7 gene were most common (32.1%) among the Chinese population, whilst nonsense variants had the highest lethality rate (41.2%) in neonates. CONCLUSION Variants of the CHD7 gene probably underlay the pathogenesis in the four children. Changes in the binding sites and binding cavity morphology play an important role in CHARGE syndrome. The types of genetic variants in CHARGE patients may vary between different regions and races.
Humans ; CHARGE Syndrome/genetics* ; Male ; Female ; Child ; Infant ; Infant, Newborn ; DNA Helicases/genetics* ; DNA-Binding Proteins/chemistry* ; Mutation, Missense ; Retrospective Studies ; Child, Preschool ; Exome Sequencing ; Phenotype

OBJECTIVE: To analyze the clinical characteristics and genetic basis of two children patients with CHARGE syndrome. METHODS: The clinical features of the two patients were analyzed, and potential variants were detected by Trio whole exome sequencing (trio-WES) of the probands and their parents. RESULTS: Child 1 has manifested cerebellar vermis dysplasia, enlargement of cerebral ventricles, whereas child 2 manifested with infantile spasm and congenital hip dysplasia. Both children were found to harbor de novo heterozygous variants of the CHD7 gene, namely c.4015C>T (exon 17) and c.5050G>A (exon 22). Based on the guidelines of the American College of Medical Genetics and Genomics, the two variants were rated as pathogenic variants, and the related disease was CHARGE syndrome. Furthermore, child 2 was also found to harbor a novel heterozygous c.6161A>C (p.Gln2054Pro) missense variant of COL12A1 gene, which was rated as possibly pathogenic, and the associated disease was Bethlem myopathy type 2, which is partially matched with the patient' s clinical phenotype. CONCLUSION The special clinical phenotypes shown by the two children harboring novel CHD7 variants have further expanded the phenotypic spectrum of CHARGE syndrome.
CHARGE Syndrome/genetics* ; DNA Helicases/genetics* ; DNA-Binding Proteins/genetics* ; Genetic Testing ; Heterozygote ; Humans ; Mutation ; Phenotype ; Whole Exome Sequencing

OBJECTIVE: To explore the genetic basis for three children patients with CHARGE syndrome. METHODS: The three children and their parents were subjected to whole exome sequencing, and candidate variants were verified by Sanger sequencing. RESULTS: All patients had ocular anomalies including microphthalmia, microcornea, lens opacity, and coloboma of iris, optic nerve, retina and choroid. And all were found to carry heterozygous variants of the CHD7 gene, which included two frameshifting variant, namely c.1447delG (p.Val483Leufs*12) and c.1021_1048delAATCAGTCCGTACCAAGATACCCCAATG (p.Asn341Leufs*2) in exon 2, which were unreported previously and were pathogenic based on the American College of Medical Genetics and Genomics standards and guidelines (PVS1+PM2+PM6), and a nonsense variant c.7957C>T (p.Arg2653*) in exon 36, which was known to be likely pathogenic (PVS1+PM2+PP4). Sanger sequencing confirmed that the two frameshifting mutations were de novo, and the nonsense mutation was also suspected to be de novo. CONCLUSION Pathological variants of the CHD7 gene probably underlay the CHARGE syndrome in the three patients.
CHARGE Syndrome/genetics* ; Child ; DNA Helicases/genetics* ; DNA-Binding Proteins/genetics* ; Genetic Variation ; Humans ; Mutation ; Phenotype

OBJECTIVETo analyze two Chinese pediatric patients with multiple malformations and growth and development delay.

METHODSBoth patients were subjected to targeted gene sequencing, and the results were analyzed with Ingenuity Variant Analysis software. Suspected pathogenic variations were verified by Sanger sequencing.

RESULTSHigh-throughput sequencing showed that both patients have carried heterozygous variants of the CHD7 gene. Patient 1 carried a nonsense mutation in exon 36 (c.7957C>T, p.Arg2653*), while patient 2 carried a nonsense mutation of exon 2 (c.718C>T, p.Gln240*). Sanger sequencing confirmed the above mutations in both patients, while their parents were of wild-type for the corresponding sites, indicating that the two mutations have happened de novo.

CONCLUSIONTwo patients were diagnosed with CHARGE syndrome by high-throughput sequencing.

CHARGE Syndrome ; genetics ; DNA Helicases ; genetics ; DNA-Binding Proteins ; genetics ; Genetic Testing ; High-Throughput Nucleotide Sequencing ; Humans ; Infant ; Male ; Mutation

CHARGE syndrome MIM #214800 is an autosomal dominant syndrome involving multiple congenital malformations. Clinical symptoms include coloboma, heart defects, choanal atresia, retardation of growth or development, genital hypoplasia, and ear anomalies or deafness. Mutations in the chromodomain helicase DNA binding protein 7 (CHD7) gene have been found in 65-70% of CHARGE syndrome patients. Here, we describe a 16-month-old boy with typical CHARGE syndrome, who was referred for CHD7 gene analysis. Sequence analysis and multiplex ligation-dependent probe amplification were performed. A heterozygous 38,304-bp deletion encompassing exon 3 with a 4-bp insertion was identified. There were no Alu sequences adjacent to the breakpoints, and no sequence microhomology was observed at the junction. Therefore, this large deletion may have been mediated by non-homologous end joining. The mechanism of the deletion in the current case differs from the previously suggested mechanisms underlying large deletions or complex genomic rearrangements in the CHD7 gene, and this is the first report of CHD7 deletion by this mechanism worldwide.
Alu Elements/genetics ; Base Sequence ; CHARGE Syndrome/diagnosis/*genetics ; DNA/chemistry/metabolism ; *DNA End-Joining Repair ; DNA Helicases/*genetics/metabolism ; DNA-Binding Proteins/*genetics/metabolism ; Exons ; Gene Dosage ; Heterozygote ; Humans ; Infant ; Male ; Multiplex Polymerase Chain Reaction ; Mutation ; Sequence Analysis, DNA ; *Sequence Deletion