1.Associations of systemic immune-inflammation index and systemic inflammation response index with maternal gestational diabetes mellitus: Evidence from a prospective birth cohort study.
Shuanghua XIE ; Enjie ZHANG ; Shen GAO ; Shaofei SU ; Jianhui LIU ; Yue ZHANG ; Yingyi LUAN ; Kaikun HUANG ; Minhui HU ; Xueran WANG ; Hao XING ; Ruixia LIU ; Wentao YUE ; Chenghong YIN
Chinese Medical Journal 2025;138(6):729-737
BACKGROUND:
The role of inflammation in the development of gestational diabetes mellitus (GDM) has recently become a focus of research. The systemic immune-inflammation index (SII) and systemic inflammation response index (SIRI), novel indices, reflect the body's chronic immune-inflammatory state. This study aimed to investigate the associations between the SII or SIRI and GDM.
METHODS:
A prospective birth cohort study was conducted at Beijing Obstetrics and Gynecology Hospital from February 2018 to December 2020, recruiting participants in their first trimester of pregnancy. Baseline SII and SIRI values were derived from routine clinical blood results, calculated as follows: SII = neutrophil (Neut) count × platelet (PLT) count/lymphocyte (Lymph) count, SIRI = Neut count × monocyte (Mono) count/Lymph count, with participants being grouped by quartiles of their SII or SIRI values. Participants were followed up for GDM with a 75-g, 2-h oral glucose tolerance test (OGTT) at 24-28 weeks of gestation using the glucose thresholds of the International Association of Diabetes and Pregnancy Study Groups (IADPSG). Logistic regression was used to analyze the odds ratios (ORs) (95% confidence intervals [CIs]) for the the associations between SII, SIRI, and the risk of GDM.
RESULTS:
Among the 28,124 women included in the study, the average age was 31.8 ± 3.8 years, and 15.76% (4432/28,124) developed GDM. Higher SII and SIRI quartiles were correlated with increased GDM rates, with rates ranging from 12.26% (862/7031) in the lowest quartile to 20.10% (1413/7031) in the highest quartile for the SII ( Ptrend <0.001) and 11.92-19.31% for the SIRI ( Ptrend <0.001). The ORs (95% CIs) of the second, third, and fourth SII quartiles were 1.09 (0.98-1.21), 1.21 (1.09-1.34), and 1.39 (1.26-1.54), respectively. The SIRI findings paralleled the SII outcomes. For the second through fourth quartiles, the ORs (95% CIs) were 1.24 (1.12-1.38), 1.41 (1.27-1.57), and 1.64 (1.48-1.82), respectively. These associations were maintained in subgroup and sensitivity analyses.
CONCLUSION
The SII and SIRI are potential independent risk factors contributing to the onset of GDM.
Humans
;
Female
;
Pregnancy
;
Diabetes, Gestational/immunology*
;
Prospective Studies
;
Adult
;
Inflammation/immunology*
;
Glucose Tolerance Test
;
Birth Cohort
2.Research progress on point-of-care testing of blood biochemical indexes based on microfluidic technology.
Huaqing ZHANG ; Canjie HU ; Pengjia QI ; Zhanlu YU ; Wei CHEN ; Jijun TONG
Journal of Biomedical Engineering 2025;42(1):205-211
Blood biochemical indicators are an important basis for the diagnosis and treatment by doctors. The performance of related instruments, the qualification of operators, the storage method and time of blood samples and other factors will affect the accuracy of test results. However, it is difficult to meet the clinical needs of rapid detection and early screening of diseases with currently available methods. Point-of-care testing (POCT) is a new diagnostic technology with the characteristics of instant, portability, accuracy and efficiency. Microfluidic chips can provide an ideal experimental reaction platform for POCT. This paper summarizes the existing detection methods for common biochemical indicators such as blood glucose, lactic acid, uric acid, dopamine and cholesterol, and focuses on the application status of POCT based on microfluidic technology in blood biochemistry. It also summarizes the advantages and challenges of existing methods and prospects for development. The purpose of this paper is to provide relevant basis for breaking through the technical barriers of microfluidic and POCT product development in China.
Humans
;
Point-of-Care Testing
;
Lactic Acid/blood*
;
Microfluidic Analytical Techniques/methods*
;
Blood Glucose/analysis*
;
Point-of-Care Systems
;
Blood Chemical Analysis/instrumentation*
;
Uric Acid/blood*
;
Cholesterol/blood*
;
Dopamine/blood*
;
Microfluidics/methods*
3.Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood.
Juan YE ; Feng YE ; Ling HOU ; Wei WU ; Xiao-Ping LUO ; Yan LIANG
Chinese Journal of Contemporary Pediatrics 2025;27(1):94-100
OBJECTIVES:
To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.
METHODS:
A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.
RESULTS:
All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.
CONCLUSIONS
This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Male
;
Female
;
Child
;
Retrospective Studies
;
Glucokinase/genetics*
;
Adolescent
;
Child, Preschool
;
Glucose Tolerance Test
4.Evaluating serum endosialin (CD248) levels as a diagnostic marker in gestational diabetes.
Tevfik Berk BILDACI ; Can ATA ; Ufuk ATLIHAN ; Huseyin Aytug AVSAR ; Selcuk ERKILINC
Journal of the ASEAN Federation of Endocrine Societies 2025;40(2):65-68
OBJECTIVES
Gestational diabetes mellitus (GDM), a pregnancy-induced hyperglycemia, affects approximately 17% of pregnancies globally. Its pathophysiology remains unclear, with inflammation and vascular remodeling playing key roles. CD248, a glycoprotein linked to inflammation and vascular remodeling, has been implicated in various conditions, but its role in GDM is uncertain.
METHODOLOGYA prospective case-control study was conducted with 169 pregnant women aged 18 to 49 at a tertiary hospital. Serum CD248 levels were assessed at 24 to 28 weeks of gestation prior to the oral glucose tolerance test (OGTT). Statistical analyses evaluated the association between CD248 levels, BMI and GDM status.
RESULTSOf the participants, 32 (18.9%) were diagnosed with GDM. CD248 levels were lower in GDM patients (8.15 ± 10.16 ng/mL) than in controls (11.42 ± 15.44 ng/mL), but the difference was not statistically significant (p = 0.084). Although CD248 levels did not correlate with OGTT values, it was positively associated with BMI (pCONCLUSION
Unlike earlier findings associating elevated CD248 levels with early pregnancy GDM risk, this study found no significant relationship during later gestational stages. These results highlight a potentially complex and context-dependent role for CD248 in GDM pathophysiology.
Human ; Diabetes, Gestational ; Inflammation ; Glucose Tolerance Test
5.A systematic review of the accuracy of Insulin and C-peptide secretion ratios during the oral glucose tolerance test to diagnose insulinoma
Fransiskus Mikael Chandra ; Dicky Tahapary
Journal of the ASEAN Federation of Endocrine Societies 2024;39(1):79-83
Background:
Insulinoma is one of the causes of recurrent hypoglycemia, one of the chief complaints for emergency department admission. The gold standard in diagnosing insulinoma is a 72-hour fasting test which is inconvenient and inefficient as it requires hospitalization. Research has found that measurement of insulin and C-peptide during OGTT may help diagnose insulinoma. We aimed to assess the diagnostic value of OGTT in diagnosing insulinoma.
Methodology:
The literature search was conducted on 19 August 2022 using several databases (MEDLINE, Scopus, Embase, and ScienceDirect). All studies that measured OGTT as diagnostic tools in diagnosing insulinoma and 72-hour fasting test as reference standard were included. The quality assessment of the selected studies was based on the Centre of Evidence-Based Medicine University of Oxford and the Quality Assessment of Diagnostic Accuracy-2 tool (QUADAS-2). Analysis of the included studies was performed qualitatively. This study was registered on PROSPERO (CRD42022360205).
Results:
A total of two case-control studies (106 patients) were included, which were at risk of bias and low concern of applicability. Both studies demonstrated that the combination of insulin and C-peptide levels measured during OGTT had high specificity, sensitivity, positive predictive value, and negative predictive value in diagnosing insulinoma compared to the reference standard. A logistic regression model of 8.305 – (0.441 × insulin 2-h/0-h) – (1.679 × C-peptide 1-h/0-h) > 0.351 has the highest diagnostic value in one study (AUC 0.97, Sensitivity 86.5%, Specificity 95.2%, PPV 94.1, NPV 88.9).
Conclusion
The measurement of 0-h and 2-h insulin and C-peptide levels during 2-h OGTT was found in two small case-control studies with a total of 106 patients to have good sensitivity and specificity. However, due to these limitations, future research is still needed to validate the potential use of OGTT for the diagnosis of insulinoma.
Insulinoma
;
Glucose Tolerance Test
6.Effectiveness of smartphone applications in achieving glycemic control among adult diabetic patients: A meta-analysis.
Eron Allen C. Tan ; Janella Jillian G. Abella ; Marie Ruth A. Echavez
The Filipino Family Physician 2024;62(1):145-154
BACKGROUND
Diabetes Mellitus Type 2 is a significant global health issue with a high prevalence in the Philippines. Managing this condition effectively is crucial, and digital technologies, particularly smartphone (mHealth) applications, have emerged as a potential tool in diabetes self-management.
OBJECTIVEThis study evaluated the effectiveness of smartphone (mHealth) application use in achieving glycemic control among adults with Type 2 Diabetes Mellitus, focusing on HbA1c levels and medication adherence.
METHODThis systematic review and meta-analysis, adhering to PRISMA guidelines, analyzed randomized controlled trials from databases like PubMed and Embase, comparing interventions using mHealth applications with standard care. The primary measures were HbA1c levels and medication adherence.
RESULTSTen studies involving 20,984 participants were included in the meta-analysis. Using mHealth applications led to an average HbA1c reduction of 0.36%, indicating improved glycemic control. There was considerable heterogeneity (I2 = 91%) because of the clinical and methodological diversity of the included studies. Subgroup analysis showed that the younger and older age groups, shorter and longer T2DM duration, and lower and higher HbA1c baseline benefited from its use. Sensitivity analysis still showed high heterogeneity (95%-97%), reflecting clinical diversity. A narrative analysis of two studies highlighted the utility of mHealth applications in tracking diet, physical activity, and vital stats, aiding medication adherence through reminders and data sharing with healthcare providers.
CONCLUSION/RECOMMENDATIONSThis systematic review and meta-analysis showed the effectiveness of mHealth application use in achieving glycemic control among adults with Type 2 Diabetes Mellitus by improving HbA1c levels and medication adherence. Integrating mHealth applications as adjuncts in family and community medicine as part of personalized care for managing type 2 diabetes in the Philippines can help achieve glycemic control and medication adherence. Future studies should focus on longitudinal assessments, exploring cultural and linguistic factors in the Filipino context to optimize diabetes care within this specialized medical framework.
Blood Glucose Self-monitoring ; Mobile Applications ; Diabetes Mellitus
7.Research progress on automated insulin delivery system in the field of diabetes management.
Zhichao YU ; Yufan SUN ; Zhijian HUANG ; Zhanhong LI ; Jianjun LONG ; Zhigang ZHU
Journal of Biomedical Engineering 2024;41(6):1279-1285
Diabetes and its complications pose a serious threat to human life and health. It has become a public health problem of wide concern worldwide. Currently, diabetes is mainly treated with insulin injection in clinic. However, manual insulin injection still has many shortcomings. In recent years, with the deepening of research, it has been found that an automated insulin delivery system (AID), which combines a continuous glucose monitoring device with an insulin pump, can significantly improve the effectiveness of diabetes treatment and reduce the incidence of complications in patients. This paper firstly introduces the composition of the AID system and its working principle, and then details the development history and current status of the related technologies from the aspects of continuous glucose monitoring technology, insulin pumps and the development of closed-loop control algorithms, etc. Finally, this paper looks forward to the application prospect and future development of AID system in the field of diabetes treatment, providing theoretical reference for further research.
Humans
;
Insulin Infusion Systems
;
Insulin/administration & dosage*
;
Blood Glucose Self-Monitoring/instrumentation*
;
Diabetes Mellitus/drug therapy*
;
Algorithms
;
Hypoglycemic Agents/administration & dosage*
;
Blood Glucose/analysis*
;
Pancreas, Artificial
;
Automation
8.Effect of extra corporeal reducing pre-load on pulmonary mechanical power in patients with acute respiratory distress syndrome.
Wenwen ZHANG ; Xin'gang HU ; Lixia YUE ; Jie ZHANG ; Zhida LIU ; Shuai GAO ; Zhigang ZHAO ; Xinliang LIANG
Chinese Critical Care Medicine 2024;36(12):1244-1248
OBJECTIVE:
To explore the effects of veno-venous extra corporeal carbon dioxide removal (V-V ECCO2R) on local mechanical power and gas distribution in the lungs of patients with mild to moderate acute respiratory distress syndrome (ARDS) receiving non-invasive ventilation.
METHODS:
Retrospective research methods were conducted. Sixty patients with mild to moderate ARDS complicated with renal insufficiency who were transferred to the respiratory intensive care unit (RICU) through the 96195 platform critical care transport green channel from January 2018 to January 2020 at the collaborative hospitals of Henan Provincial People's Hospital were enrolled. According to different treatment methods, they were divided into a conventional treatment group and an ECCO2R group, with 30 patients in each group. Both groups received standard treatments including primary disease treatment, airway management, and non-invasive ventilation. The conventional treatment group received bedside continuous renal replacement therapy (CRRT), and the ECCO2R group received V-V ECCO2R treatment. General information of patient such as gender, age, cause of disease, and acute physiology and chronic health evaluation II (APACHE II) were recorded; arterial blood gas analysis was performed before treatment and at 12 hours and 24 hours during treatment, recording arterial partial pressure of oxygen (PaO2), arterial partial pressure of carbon dioxide (PaCO2), and oxygenation index (PaO2/FiO2). Respiratory mechanics parameters [tidal volume, respiratory rate, maximal inspiratory pressure (MIP), and maximal expiratory pressure (MEP)] were recorded, and the rapid shallow breathing index (RSBI) was calculated; electrical impedance tomography (EIT) was used to measure regional of interest (ROI) values in different lung areas at 12 hours and 24 hours of treatment, and the pulmonary mechanical energy was calculated.
RESULTS:
The arterial blood gas analysis indicators, respiratory mechanics parameters, and pulmonary mechanical energy of patients in the conventional treatment group and ECCO2R group improved significantly after 24 hours of treatment compared to 12 hours of treatment (all P < 0.05). The levels of PaCO2, RSBI, total mechanical power, and non-dependent zone mechanical power in the ECCO2R group were significantly lower than those in the conventional treatment group at both 12 hours and 24 hours during the treatment [PaCO2 (mmHg, 1 mmHg ≈ 0.133 kPa): 44.03±2.96 vs. 49.96±2.50 at 12 hours, 41.65±3.21 vs. 48.53±2.33 at 24 hours; RSBI (times×min-1×L-1): 88.67±4.05 vs. 92.35±4.03 at 12 hours, 77.66±4.64 vs. 90.98±4.21 at 24 hours; total mechanical power (mJ): 10.40±1.15 vs. 12.93±1.68 at 12 hours, 11.13±1.18 vs. 14.05±1.69 at 24 hours; non-dependent zone mechanical power (mJ): 7.15±0.84 vs. 7.98±0.75 at 12 hours, 7.77±0.93 vs. 9.13±1.10 at 24 hours], and MEP and MIP in the ECCO2R group were significantly higher than those in the conventional treatment group at both 12 hours and 24 hours during the treatment [MEP (cmH2O, 1 cmH2O ≈ 0.098 kPa): 89.88±5.04 vs. 86.09±5.57 at 12 hours, 96.57±2.59 vs. 88.66±2.98 at 24 hours; MIP (cmH2O): 47.64±2.82 vs. 41.93±2.44 at 12 hours, 60.11±6.53 vs. 43.63±2.80 at 24 hours], the differences were statistically significant (all P < 0.05).
CONCLUSIONS
V-V ECCO2R combined with non-invasive ventilation can effectively reduce the regional tidal volume, mechanical power, and respiratory rate in the non-gravitational dependent zones of patients with mild to moderate ARDS, and improve respiratory distress and oxygenation status.
Humans
;
Respiratory Distress Syndrome/physiopathology*
;
Retrospective Studies
;
Carbon Dioxide
;
Blood Gas Analysis
;
Lung/physiopathology*
;
Intensive Care Units
;
Male
;
Female
;
Noninvasive Ventilation/methods*
;
Continuous Renal Replacement Therapy/methods*
;
APACHE
;
Middle Aged
9.Effect of fraction of inspired oxygen baseline level on the mask ventilation time before intubation in emergency patients by monitoring of expiratory oxygen concentration.
Yili DAI ; Huadong ZHU ; Jun XU ; Xuezhong YU
Chinese Critical Care Medicine 2023;35(4):358-361
OBJECTIVE:
To investigate the effect of different fraction of inspired oxygen (FiO2) baseline levels before endotracheal intubation on the time of expiratory oxygen concentration (EtO2) reaching the standard in emergency patients with the EtO2 as the monitoring index.
METHODS:
A retrospective observational study was conducted. The clinical data of patients receiving endotracheal intubation in the emergency department of Peking Union Medical College Hospital from January 1 to November 1 in 2021 were enrolled. In order to avoid interference with the final result due to inadequate ventilation caused by non-standard operation or air leakage, the process of the continuous mechanical ventilation after FiO2 was adjusted to pure oxygen in patients who had been intubated was selected to simulate the process of mask ventilation under pure oxygen before intubation. Combined with the electronic medical record and the ventilator record, the changes of the time required to reach 0.90 of EtO2 (that was, the time required to reach the standard of EtO2) and the respiratory cycle required to reach the standard after adjusting FiO2 to pure oxygen under different baseline levels of FiO2 were analyzed.
RESULTS:
113 EtO2 assay records were collected from 42 patients. Among them, 2 patients had only one EtO2 record due to the FiO2 baseline level of 0.80, while the rest had two or more records of EtO2 reaching time and respiratory cycle corresponding to different FiO2 baseline level. Among the 42 patients, most of them were male (59.5%), elderly [median age was 62 (40, 70) years old] patients with respiratory diseases (40.5%). There were significant differences in lung function among different patients, but the majority of patients with normal function [oxygenation index (PaO2/FiO2) > 300 mmHg (1 mmHg ≈ 0.133 kPa), 38.0%]. In the setting of ventilator parameters, combined with the slightly lower arterial partial pressure of carbon dioxide of patients [33 (28, 37) mmHg], mild hyperventilation phenomenon was considered to be widespread. With the increased in FiO2 baseline level, the time of EtO2 reaching standard and the number of respiratory cycles showed a gradually decreasing trend. When the FiO2 baseline level was 0.35, the time of EtO2 reaching the standard was the longest [79 (52, 87) s], and the corresponding median respiratory cycle was 22 (16, 26) cycles. When the FiO2 baseline level was increased from 0.35 to 0.80, the median time of EtO2 reaching the standard was shortened from 79 (52, 78) s to 30 (21, 44) s, and the median respiratory cycle was also reduced from 22 (16, 26) cycles to 10 (8, 13) cycles, with statistically significant differences (both P < 0.05).
CONCLUSIONS
The higher the FiO2 baseline level of the mask ventilation in front of the endotracheal intubation in emergency patients, the shorter the time for EtO2 reaching the standard, and the shorter the mask ventilation time.
Aged
;
Humans
;
Male
;
Middle Aged
;
Female
;
Intubation, Intratracheal
;
Respiration
;
Ventilators, Mechanical
;
Arteries
;
Blood Gas Analysis
10.Mediating effect of self-efficacy on self-management ability and self-management behavior in patients with type 2 diabetes mellitus.
Xiao Yue ZHANG ; Yu Xin LIN ; Ying JIANG ; Lan Chao ZHANG ; Mang Yan DONG ; Hai Yi CHI ; Hao Yu DONG ; Li Jun MA ; Zhi Jing LI ; Chun CHANG
Journal of Peking University(Health Sciences) 2023;55(3):450-455
OBJECTIVE:
To investigate the mechanism of self-efficacy between self-management ability and self-management behavior and its differences among patients with different disease courses through mediation tests.
METHODS:
In the study, 489 patients with type 2 diabetes who attended the endocrinology departments of four hospitals in Shanxi Province and Inner Mongolia Autonomous Region from July to September 2022 were enrolled as the study population. They were investigated by General Information Questionnaire, Diabetes Self-Management Scale, Chinese version of Diabetes Empowerment Simplified Scale, and Diabetes Self-Efficacy Scale. Mediation analyses were performed using the linear regression model, Sobel test, and Bootstrap test in the software Stata version 15.0 and divided the patients into different disease course groups for subgroup analysis according to whether the disease course was > 5 years.
RESULTS:
In this study, the score of self-management behavior in the patients with type 2 diabetes was 6.16±1.41, the score of self-management ability was 3.99±0.74, and the score of self-efficacy was 7.05±1.90. The results of the study showed that self-efficacy was positively correlated with self-management ability (r=0.33) as well as self-management behavior (r=0.47) in the patients with type 2 diabetes (P < 0.01). The mediating effect of self-efficacy accounted for 38.28% of the total effect of self-management ability on self-management behaviors and was higher in the behaviors of blood glucose monitoring (43.45%) and diet control (52.63%). The mediating effect of self-efficacy accounted for approximately 40.99% of the total effect for the patients with disease course ≤ 5 years, while for the patients with disease course > 5 years, the mediating effect accounted for 39.20% of the total effect.
CONCLUSION
Self-efficacy enhanced the effect of self-management ability on the behavior of the patients with type 2 diabetes, and this positive effect was more significant for the patients with shorter disease course. Targeted health education should be carried out to enhance patients' self-efficacy and self-management ability according to their disease characteristics, to stimulate their inner action, to promote the development of their self-management behaviors, and to form a more stable and long-term mechanism for disease management.
Humans
;
Diabetes Mellitus, Type 2/therapy*
;
Self Efficacy
;
Self-Management
;
Blood Glucose Self-Monitoring
;
Blood Glucose
;
Self Care


Result Analysis
Print
Save
E-mail