1.Detection of residual DNA in host cells of Escherichia coli in levodopa by Real-time PCR
Bingyu XU ; YAN LIU ; Xinyao GUO ; Fang YAN ; Guibin SUN
Journal of China Pharmaceutical University 2025;56(2):176-182
Using Real-time PCR technology, a highly specific and sensitive method for detecting DNA residues of Escherichia coli host cells in levodopa was established, validated, and preliminarily applied. Escherichia coli strain MB6 16S ribosomal RNA gene was selected as the target gene to design multiple pairs of primers and the target fragment by specific amplification of PCR was obtained. The target fragment was cloned into the pLENTI-BSD-CON vector and the recombinant plasmid was constructed and named pLENTI-BSD-CON-E.coli-16S. A quantitative PCR detection method (SYBR Green method) with magnetic bead extraction and purification methods was established with the reference standard of the recombinant plasmid. Furthermore, the established method was validated, including linear and range, accuracy, precision, specificity, and quantification limit, and applied to the detection of levodopa raw materials. Meanwhile, the detection method was compared with the Taqman probe method by the commercial kit. The primer sequences of the quantitative PCR detection method (SYBR Green method) were TTCGATGCAACGCGAAGAAC (forward) and GTGTAGCCCTGGTCGTAAGG (reverse). The standard curve of DNA was in the range of 10 fg/μL to 3 ng/μL with good linearity (R2≥ 0.98). The quantitative limit was 10 fg/μL. In addition, the detection recovery rate was in the range of 59.7% to 80.7%, with RSD at less than 15%. Nine batches of levodopa were detected by this method, and the amount of E.coli DNA residue was below the limit. The developed qPCR method can be used for quantitative detection of residual DNA in biological products produced by E.coli as host cells, such as levodopa . The results indicate that the sensitivity of the detection method for recombinant plasmid construction standards is superior than the reagent kit detection method.
2.Gut microbiota and Parkinson's disease.
Lin WANG ; Ying CUI ; Bingyu HAN ; Yitong DU ; Kenish Sirajbhai SALEWALA ; Shiya WANG ; Wenlu ZHAO ; Hongxin ZHANG ; Sichen WANG ; Xinran XU ; Jianpeng MA ; Yan ZHU ; Houzhen TUO
Chinese Medical Journal 2025;138(3):289-297
Emerging evidence suggests that dysbiosis of the gut microbiota is associated with the pathogenesis of Parkinson's disease (PD), a prevalent neurodegenerative disorder. The microbiota-gut-brain axis plays a crucial role in the development and progression of PD, and numerous studies have demonstrated the potential therapeutic benefits of modulations in the intestinal microbiota. This review provides insights into the characterization of the gut microbiota in patients with PD and highlights associations with clinical symptoms and underlying mechanisms. The discussion underscores the increased influence of the gut microbiota in the pathogenesis of PD. While the relationship is not fully elucidated, existing research demonstrates a strong correlation between changes in the composition of gut microbiota and disease development, and further investigation is warranted to explain the specific underlying mechanisms.
Humans
;
Parkinson Disease/microbiology*
;
Gastrointestinal Microbiome/physiology*
;
Dysbiosis/microbiology*
3.Prognostic value of difference between hematocrit and albumin in patients with sepsis.
Shaobo WANG ; Bin HUANG ; Yuxin XU ; Bingyu WEI ; Rongfang LONG ; Ying QIU
Chinese Critical Care Medicine 2025;37(7):633-637
OBJECTIVE:
To investigate the value of difference between hematocrit (HCT) and albumin (Alb) in predicting the prognosis of patients with sepsis.
METHODS:
A retrospective study was conducted on the septic patients hospitalized at the First Affiliated Hospital of Guangxi Medical University from January to October in 2024. Clinical data including gender, age, body mass index (BMI), history of hypertension or diabetes, vital signs on admission, and sequential organ failure assessment (SOFA) score, acute physiology and chronic health evaluation II (APACHE II) score, blood lactic acid (Lac), oxygenation index (PaO2/FiO2), hemoglobin (Hb), white blood cell count (WBC), platelet count (PLT), lymphocyte count (LYM), HCT, Alb, difference between HCT and Alb, bilirubin, scrum creatinine (SCr), and fibrinogen (Fib) within 48 hours of admission were collected. The 28-day prognosis of patients was also recorded. Binary multivariate Logistic regression analysis was used to identify risk factors for 28-day death in patients with sepsis. The predictive efficacy of the difference between HCT and Alb on 28-day death was evaluated using the receiver operator characteristic curve (ROC curve).
RESULTS:
Among 180 enrolled septic patients, 140 survived and 40 died on 28 days. Compared with the survival group, the patients in the death group was significantly older (years old: 64±16 vs. 55±15, P < 0.05), and had higher SOFA score, APACHE II score, and SCr [SOFA score: 6 (4, 9) vs. 3 (2, 5), APACHE II score: 13 (10, 18) vs. 8 (6, 11), SCr (μmol/L): 136 (70, 416) vs. 77 (58, 126), all P < 0.05] as well as lower Hb, PLT, HCT, difference between HCT and Alb, and Fib within 48 hours of admission [Hb (g/L): 90±30 vs. 106±79, PLT (×109/L): 158 (57, 240) vs. 215 (110, 315), HCT: 0.258±0.081 vs. 0.333±0.077, difference between HCT and Alb: -6.52±7.40 vs. 1.07±7.63, Fib (g/L): 3.72±1.57 vs. 4.59±1.55, all P < 0.05]. No significant difference in gender, BMI, history of hypertension or diabetes, vital signs on admission, or other laboratory indicators was found between the two groups. Binary multivariate Logistic regression analysis revealed that age [odds ratio (OR) = 1.040, 95% confidence interval (95%CI) was 1.004-1.078, P = 0.030], APACHE II score (OR = 1.218, 95%CI was 1.038-1.430, P = 0.016), Hb (OR = 1.040, 95%CI was 1.014-1.068, P = 0.003), and difference between HCT and Alb (OR = 0.804, 95%CI was 0.727-0.889, P < 0.001) were independent risk factors for 28-day death of septic patients. ROC curve analysis showed that the area under the ROC curve (AUC) of difference between HCT and Alb for predicting 28-day death of septic patients was 0.764 (95%CI was 0.679-0.849, P < 0.001). A cut-off value of difference between HCT and Alb ≤ -5.35 yielded a sensitivity of 80.7% and specificity of 65.0%.
CONCLUSIONS
The difference between HCT and Alb at early admission is a valuable predictor of prognosis in septic patients. A difference ≤ -5.35 indicates an increased death risk of septic patients.
Humans
;
Prognosis
;
Sepsis/blood*
;
Retrospective Studies
;
Hematocrit
;
Serum Albumin/analysis*
;
Male
;
Female
;
Middle Aged
;
Aged
;
APACHE
4.Clinical efficacy and safety of intravenous colistin sulfate monotherapy versus combination with nebulized inhalation for pulmonary infections caused by carbapenem-resistant gram-negative bacilli: a multicenter retrospective cohort study.
Danyang PENG ; Fan ZHANG ; Ying LIU ; Yanqiu GAO ; Lanjuan XU ; Xiaohui LI ; Suping GUO ; Lihui WANG ; Lin GUO ; Yonghai FENG ; Chao QIN ; Huaibin HAN ; Xisheng ZHENG ; Faming HE ; Xiaozhao LI ; Bingyu QIN ; Huanzhang SHAO
Chinese Critical Care Medicine 2025;37(9):829-834
OBJECTIVE:
To compare the efficacy and safety of intravenous colistin sulfate combined with nebulized inhalation versus intravenous monotherapy for pulmonary infections caused by carbapenem-resistant organism (CRO).
METHODS:
A multicenter retrospective cohort study was conducted. Clinical data were collected from patients admitted to the intensive care unit (ICU) of 10 tertiary class-A hospitals in Henan Province between July 2021 and May 2023, who received colistin sulfate for CRO pulmonary infections. Data included baseline characteristics, inflammatory markers [white blood cell count (WBC), neutrophil count (NEU), procalcitonin (PCT), C-reactive protein (CRP)], renal function indicators [serum creatinine (SCr), blood urea nitrogen (BUN)], life support measures, anti-infection regimens, clinical efficacy, microbiological clearance rate, and prognostic outcomes. Patients were divided into two groups: intravenous group (colistin sulfate monotherapy via intravenous infusion) and combination group ((intravenous infusion combined with nebulized inhalation of colistin sulfate). Changes in parameters before and after treatment were analyzed.
RESULTS:
A total of 137 patients with CRO pulmonary infections were enrolled, including 89 in the intravenous group and 48 in the combination group. Baseline characteristics, life support measures, daily colistin dose, and combination regimens (most commonly colistin sulfate plus carbapenems in both groups) showed no significant differences between two groups. The combination group exhibited higher clinical efficacy [77.1% (37/48) vs. 59.6% (52/89)] and microbiological clearance rate [60.4% (29/48) vs. 39.3% (35/89)], both P < 0.05. Pre-treatment inflammatory and renal parameters showed no significant differences between two groups. Post-treatment, the combination group showed significantly lower WBC and CRP [WBC (×109/L): 8.2±0.5 vs. 10.9±0.6, CRP (mg/L): 14.0 (5.7, 26.6) vs. 52.1 (24.4, 109.6), both P < 0.05], whereas NEU, PCT, SCr, and BUN levels showed no significant between two groups. ICU length of stay was shorter in the combination group [days: 16 (10, 25) vs. 21 (14, 29), P < 0.05], although mechanical ventilation duration and total hospitalization showed no significant differences between two groups.
CONCLUSIONS
Intravenous colistin sulfate combined with nebulized inhalation improved clinical efficacy and microbiological clearance in CRO pulmonary infections with an acceptable safety profile.
Humans
;
Colistin/therapeutic use*
;
Retrospective Studies
;
Administration, Inhalation
;
Anti-Bacterial Agents/therapeutic use*
;
Carbapenems/pharmacology*
;
Male
;
Female
;
Middle Aged
;
Gram-Negative Bacteria/drug effects*
;
Aged
;
Treatment Outcome
;
Respiratory Tract Infections/drug therapy*
5.Evaluation of red blood cell transfusion in patients with upper gastrointestinal bleeding using machine learning models
Yaoqiang DU ; Biqin ZHANG ; Yilin XU ; Bingyu CHEN ; Weiguo HU
Chinese Journal of Blood Transfusion 2025;38(11):1488-1494
Objective: To comprehensively evaluate and analyze the transfusion outcomes of patients with acute upper gastrointestinal bleeding (UGIB). Methods: The transfusion management system and hospital information system (HIS) were used to retrospectively collect clinical data of 230 patients with UGIB admitted to Zhejiang Provincial People's Hospital and its branches from June 2018 to June 2021. 101 cases were screened and categorized into transfusion group (n=56) and non-transfusion group (n=45) based on transfusion outcomes. The cohort comprised 68 males and 33 females. A univariate model based on the AIMS65 score, a logistic multiple regression model, and multivariate transfusion models using machine learning methods (including Random Forest, Support Vector Machine, and Artificial Neural Network) were established. The sensitivity, specificity, accuracy, and receiver operating characteristic (ROC) curves of each model were compared. Results: For the univariate model based on the AIMS65 scoring, the optimal threshold was 1.5. This model demonstrated a sensitivity of 0.446, a specificity of 0.822, an AUC of 0.67, an accuracy (ACC) of 0.614, a Kappa value of 0.256, and an F1-score of 0.655. For logistics regression model (optimal critical probability: 0.459), the sensitivity was 0.929, specificity was 0.889, AUC was 0.96, ACC was 0.911, Kappa was 0.819, and F1-score was 0.899. For the Random Forest model (optimal critical probability: 0.458), the sensitivity was 0.964, specificity was 0.956, AUC was 0.99, ACC was 0.960, Kappa was 0.920, and F1-score was 0.956. For the Support Vector Machine model (optimal critical probability: 0.474), the sensitivity was 0.875, specificity was 0.933, AUC was 0.94, ACC was 0.901, Kappa was 0.801, and F1-score was 0.894. For the Artificial Neural Network model (optimal critical probability: 0.797), the sensitivity was 0.804, specificity was 0.956, AUC was 0.96, ACC was 0.871, Kappa was 0.745, and F1-score was 0.869. Ten-fold cross validation also confirmed the reliability of the results. Conclusion: Based on integrated various clinical test indicators of patients, we could establish logistic regression model and multiple machine learning models. These models hold significant value for predicting the need for blood transfusion in patients, indicating a promising application prospect for machine learning algorithms in transfusion prediction.
6.Chinese expert consensus on blood support mode and blood transfusion strategies for emergency treatment of severe trauma patients (version 2024)
Yao LU ; Yang LI ; Leiying ZHANG ; Hao TANG ; Huidan JING ; Yaoli WANG ; Xiangzhi JIA ; Li BA ; Maohong BIAN ; Dan CAI ; Hui CAI ; Xiaohong CAI ; Zhanshan ZHA ; Bingyu CHEN ; Daqing CHEN ; Feng CHEN ; Guoan CHEN ; Haiming CHEN ; Jing CHEN ; Min CHEN ; Qing CHEN ; Shu CHEN ; Xi CHEN ; Jinfeng CHENG ; Xiaoling CHU ; Hongwang CUI ; Xin CUI ; Zhen DA ; Ying DAI ; Surong DENG ; Weiqun DONG ; Weimin FAN ; Ke FENG ; Danhui FU ; Yongshui FU ; Qi FU ; Xuemei FU ; Jia GAN ; Xinyu GAN ; Wei GAO ; Huaizheng GONG ; Rong GUI ; Geng GUO ; Ning HAN ; Yiwen HAO ; Wubing HE ; Qiang HONG ; Ruiqin HOU ; Wei HOU ; Jie HU ; Peiyang HU ; Xi HU ; Xiaoyu HU ; Guangbin HUANG ; Jie HUANG ; Xiangyan HUANG ; Yuanshuai HUANG ; Shouyong HUN ; Xuebing JIANG ; Ping JIN ; Dong LAI ; Aiping LE ; Hongmei LI ; Bijuan LI ; Cuiying LI ; Daihong LI ; Haihong LI ; He LI ; Hui LI ; Jianping LI ; Ning LI ; Xiying LI ; Xiangmin LI ; Xiaofei LI ; Xiaojuan LI ; Zhiqiang LI ; Zhongjun LI ; Zunyan LI ; Huaqin LIANG ; Xiaohua LIANG ; Dongfa LIAO ; Qun LIAO ; Yan LIAO ; Jiajin LIN ; Chunxia LIU ; Fenghua LIU ; Peixian LIU ; Tiemei LIU ; Xiaoxin LIU ; Zhiwei LIU ; Zhongdi LIU ; Hua LU ; Jianfeng LUAN ; Jianjun LUO ; Qun LUO ; Dingfeng LYU ; Qi LYU ; Xianping LYU ; Aijun MA ; Liqiang MA ; Shuxuan MA ; Xainjun MA ; Xiaogang MA ; Xiaoli MA ; Guoqing MAO ; Shijie MU ; Shaolin NIE ; Shujuan OUYANG ; Xilin OUYANG ; Chunqiu PAN ; Jian PAN ; Xiaohua PAN ; Lei PENG ; Tao PENG ; Baohua QIAN ; Shu QIAO ; Li QIN ; Ying REN ; Zhaoqi REN ; Ruiming RONG ; Changshan SU ; Mingwei SUN ; Wenwu SUN ; Zhenwei SUN ; Haiping TANG ; Xiaofeng TANG ; Changjiu TANG ; Cuihua TAO ; Zhibin TIAN ; Juan WANG ; Baoyan WANG ; Chunyan WANG ; Gefei WANG ; Haiyan WANG ; Hongjie WANG ; Peng WANG ; Pengli WANG ; Qiushi WANG ; Xiaoning WANG ; Xinhua WANG ; Xuefeng WANG ; Yong WANG ; Yongjun WANG ; Yuanjie WANG ; Zhihua WANG ; Shaojun WEI ; Yaming WEI ; Jianbo WEN ; Jun WEN ; Jiang WU ; Jufeng WU ; Aijun XIA ; Fei XIA ; Rong XIA ; Jue XIE ; Yanchao XING ; Yan XIONG ; Feng XU ; Yongzhu XU ; Yongan XU ; Yonghe YAN ; Beizhan YAN ; Jiang YANG ; Jiangcun YANG ; Jun YANG ; Xinwen YANG ; Yongyi YANG ; Chunyan YAO ; Mingliang YE ; Changlin YIN ; Ming YIN ; Wen YIN ; Lianling YU ; Shuhong YU ; Zebo YU ; Yigang YU ; Anyong YU ; Hong YUAN ; Yi YUAN ; Chan ZHANG ; Jinjun ZHANG ; Jun ZHANG ; Kai ZHANG ; Leibing ZHANG ; Quan ZHANG ; Rongjiang ZHANG ; Sanming ZHANG ; Shengji ZHANG ; Shuo ZHANG ; Wei ZHANG ; Weidong ZHANG ; Xi ZHANG ; Xingwen ZHANG ; Guixi ZHANG ; Xiaojun ZHANG ; Guoqing ZHAO ; Jianpeng ZHAO ; Shuming ZHAO ; Beibei ZHENG ; Shangen ZHENG ; Huayou ZHOU ; Jicheng ZHOU ; Lihong ZHOU ; Mou ZHOU ; Xiaoyu ZHOU ; Xuelian ZHOU ; Yuan ZHOU ; Zheng ZHOU ; Zuhuang ZHOU ; Haiyan ZHU ; Peiyuan ZHU ; Changju ZHU ; Lili ZHU ; Zhengguo WANG ; Jianxin JIANG ; Deqing WANG ; Jiongcai LAN ; Quanli WANG ; Yang YU ; Lianyang ZHANG ; Aiqing WEN
Chinese Journal of Trauma 2024;40(10):865-881
Patients with severe trauma require an extremely timely treatment and transfusion plays an irreplaceable role in the emergency treatment of such patients. An increasing number of evidence-based medicinal evidences and clinical practices suggest that patients with severe traumatic bleeding benefit from early transfusion of low-titer group O whole blood or hemostatic resuscitation with red blood cells, plasma and platelet of a balanced ratio. However, the current domestic mode of blood supply cannot fully meet the requirements of timely and effective blood transfusion for emergency treatment of patients with severe trauma in clinical practice. In order to solve the key problems in blood supply and blood transfusion strategies for emergency treatment of severe trauma, Branch of Clinical Transfusion Medicine of Chinese Medical Association, Group for Trauma Emergency Care and Multiple Injuries of Trauma Branch of Chinese Medical Association, Young Scholar Group of Disaster Medicine Branch of Chinese Medical Association organized domestic experts of blood transfusion medicine and trauma treatment to jointly formulate Chinese expert consensus on blood support mode and blood transfusion strategies for emergency treatment of severe trauma patients ( version 2024). Based on the evidence-based medical evidence and Delphi method of expert consultation and voting, 10 recommendations were put forward from two aspects of blood support mode and transfusion strategies, aiming to provide a reference for transfusion resuscitation in the emergency treatment of severe trauma and further improve the success rate of treatment of patients with severe trauma.
7.Clinical analysis of complete left bundle branch block after transcatheter closure of ventricular septal defect in 25 children
Bingyu MA ; Yifan LI ; Dongpo LIANG ; Ling SUN ; Xu HUANG ; Shaoying ZENG ; Shusheng WEN ; Shushui WANG ; Zhiwei ZHANG ; Yumei XIE
Chinese Journal of Applied Clinical Pediatrics 2024;39(10):743-749
Objective:To summarize the clinical treatment of complete left bundle branch block (CLBBB) after the transcatheter closure of ventricular septal defect (VSD).Methods:A case series study was conducted on the treatments and outcomes of 25 children with CLBBB after transcatheter VSD closure in Guangdong Provincial People′s Hospital from January 2010 to December 2023.Paired sample t test was used to evaluate the effect of occlude removal. Results:Among the 25 patients, 12 were males (48%), and 13 were females (52%).The age at surgery was 3.18 (2.51-3.86) years, the height before surgery was 95.0 (90.0-97.5) cm, and the weight before surgery was 13 (12-15) kg.Fourteen children were early-onset cases (≤ 1 month), while the other 11 were late-onset cases (> 1 month).The mean follow-up time was (6.63±3.93) years.Of the 14 early-onset cases, 6 children underwent occluder removal within 1 month and restored normal heart rhythm or incomplete right bundle branch block; 4 children underwent occluder removal after 1 month, of whom 2 recovered, 1 remained CLBBB, and 1 had complete atrioventricular block (CAVB); the other 4 children received drug treatment, of whom 2 had normal heart rhythm, 1 had left anterior fascicular block, and 1 died of cardiac shock and heart failure.All the 11 late-onset cases were first treated by drugs, of whom 3 recovered, and the other 8 remained CLBBB.One of the 8 cases received occluder removal at 8 months after surgery and recovered, 1 had CAVB, and the other 6 remained CLBBB.Conclusions:For patients with CLBBB after transcatheter closure of VSD, drug therapy is not always effective, and CLBBB is easy to recur.Therefore, occluder removal is recommended to be done immediately after CLBBB is discovered.Patients with persistent CLBBB should be followed up regularly, and pacemaker implantation may be performed if necessary.
8.Serum Claudin-5 levels facilitate the early prediction of severe acute pancreatitis: a prospective observational study
Xinlei CHEN ; Huihui WANG ; Ping GENG ; Bingyu LING ; Aiwen MA ; Min XU ; Dingyu TAN
Chinese Critical Care Medicine 2024;36(9):930-936
Objective:To investigate the value of early tight junction protein Claudin-5 levels in predicting the severity of acute pancreatitis (AP).Methods:A prospective observational study was conducted, including patients diagnosed with AP and admitted to the Northern Jiangsu People's Hospital from December 1, 2021 to November 30, 2022. Eligible healthy volunteers were randomly selected to serve as healthy controls during the same period. Patients were classified into mild acute pancreatitis (MAP) group, moderate-severe acute pancreatitis (MSAP) group, and severe acute pancreatitis (SAP) group based on the 2012 Atlanta classification criteria. Patients with SAP were then divided into three subgroups of 1, 3, and 7 days based on the duration of hospitalization. Baseline data, such as gender, age, underlying disease, and probable etiology, was collected from all enrolled individuals. The enzyme-linked immunosorbent assay (ELISA) was employed to detect serum Claudin-5 levels in each cohort of enrollees. Data on additional serologic indicators, including hematocrit (HCT), albumin (Alb), serum Ca 2+, C-reactive protein (CRP), and procalcitonin (PCT) levels, were obtained via the in-hospital test query system in each group of patients with AP. The modified Marshall score (mMarshall), modified CT severity index (mCTSI) score, bedside severity index of severity in acute pancreatitis (BISAP) score, and acute physiology and chronic health evaluation Ⅱ(APACHEⅡ) were recorded for each group of patients with AP. Differences in the above indicators between groups were analyzed and compared. Spearman's correlation method was employed to examine the relationship between Claudin-5 levels and each influential factor. The receiver operator characteristic curve (ROC curve) was plotted to analyze the predictive value of each influencing factor on SAP. Ridge regression was used to screen for independent risk factors for SAP. Results:A total of 109 patients with AP were enrolled, comprising 66 in the MAP group, 15 in the MSAP group, and 28 in the SAP group. Additionally, 27 healthy volunteers were enrolled as the healthy control group. No statistically significant differences were observed in gender and age among the enrolled groups, and no statistically significant differences were identified among the three groups of patients with AP in terms of underlying disease and etiologic composition. As the disease progressed, serum Claudin-5 levels exhibited a notable increase across all AP patient groups, and they were all significantly higher than those in the healthy control group [ng/L: 888.58 (574.52, 1 141.59), 3 749.02 (2 784.93, 5 789.92), 4 667.81 (3 935.21, 7 315.66) vs. 291.13 (250.19, 314.75), all P < 0.05]. Subgroup analyses showed that as the disease duration prolonged, patients in the SAP group exhibited a notable decline in Claudin-5 levels at 3 days post-admission, compared with those at 1 day post-admission [ng/L: 2 052.59 (1 089.43, 4 006.47) vs. 4 667.81 (3 935.21, 7 315.66), P < 0.05]. Spearman correlation analysis showed that serum Claudin-5 levels in patients with AP were significantly positively correlated with CRP, PCT, HCT, and mMarshall, mCTSI, and BISAP scores ( r values were 0.570, 0.525, 0.323, 0.774, 0.670, 0.652, all P < 0.001), and significantly negatively correlated with Alb ( r = -0.394, P < 0.001). A significant trend was observed in patients with AP, with an increase of HCT levels and a decrease of Alb levels as the disease progressed (both P < 0.05). An improvement of aforementioned phenomena was observed in patients with SAP following treatment, indirectly indicating that serum Claudin-5 level was a positive indicator of vascular leakage. ROC curve analysis showed that serum Claudin-5 levels in patients with AP exhibited the highest accuracy for early prediction of SAP, with the area under the ROC curve (AUC) of 0.948. When serum Claudin-5 levels ≥2 997 ng/L, the sensitivity for early screening for SAP was 100% and the specificity was 88.89%. Multifactorial ridge regression analysis showed that serum Claudin-5 level, PCT and APACHEⅡscore could be used as independent risk factors for early prediction of SAP (all P < 0.05). Conclusion:Serum Claudin-5 levels facilitate early prediction of SAP and are strongly associated with inflammatory response and vascular leakage.
9.A long-term follow-up study of percutaneous stent implantation for residual pulmonary artery stenosis after complicated congenital heart disease
Xu HUANG ; Yifan LI ; Bingyu MA ; Ling SUN ; Junjie LI ; Jijun SHI ; Shushui WANG ; Zhiwei ZHANG ; Yumei XIE
Chinese Journal of Thoracic and Cardiovascular Surgery 2024;40(6):355-361
Objective:To investigate the long-term safety and effectiveness of stent implantation for residual pulmonary artery stenosis after complicated congenital heart disease.Methods:The symptoms, signs, echocardiography, cardiac CT, cardiac catheterization, six-minute walking distance, and BNP of 41 patients diagnosed from January 1996 to January 2020. In this group, 41 patients, 30 males and 11 females, aged 1.3-14.5 years old, mean (6.1±3.6) years old, and weighed 8-43 kg, mean (18.9±9.4)kg, compared the diameter of the target vessel, pressure difference across stenosis, cardiac function before and postoperative follow-up, and evaluated the long-term effect of stent implantation in the treatment of pulmonary artery stenosis.Results:All 41 patients were not lost to follow-up, no death, and there were no serious adverse events such as stent fracture, artery dissection and pulmonary embolism during follow-up. The median follow-up time was 7.1 years (3.1 to 13.8 years). As of January 2023, the echocardiographic results showed that the diameter of the target vessels in 41 patients increased from preoperative (3.9±1.5) mm to (6.0±1.5) mm ( P<0.05), the pressure difference across the stenosis decreased from preoperative (51.4±19.1) mmHg to (33.1±19.7) mmHg (1 mmHg=0.133 kPa, P<0.05); Heart spiral CT showed that the ratio of target vessel diameter to distal vessel diameter increased from preoperative 0.4±0.2 to 0.9±0.3( P<0.05). All patients had no slow growth and development, no recurrent lung infection, 39 patients (95.1%) had gradeⅠcardiac function, and 2 patients (4.9%) had gradeⅡcardiac function.As children in school age, the walking distance of 6 min was 462 to 633 m, mean( 529.9±57.1)m, the respiratory score was 0.5-1, and the lower limb force score was 6-12. There were 5 long-term adverse events, including 4 cases of target vessel restenosis (9.7%), and 1 case (2.4%), two of the patients with restenosis with repeated target vessel stenosis and lateral pulmonary hypertension were surgically intervention: stent removing and pumonary expanding, after 4, 13 years of stent implantation.And the others were still in follow-up, and no further intervention was made. The Cox multivariate survival analysis suggested that right ventricular systolic blood pressure was a risk factor for endpoint events before stent implantation ( P<0.05). Conclusion:The treatment of residual pulmonary artery stenosis after complicated congenital heart disease after percutaneous stent implantation can effectively relieve the right heart pressure overload, improve pulmonary blood flow, stabilize cardiac function, improve the long-term prognosis of patients with complicated congenital heart disease, reduce the chest opening rate of reoperation, and have stable long-term curative effect.
10.HIV infection risk of men who have sex with men with different sex roles
XU Bingyu ; Aliya Adilinuer ; HE Qian ; LI Yuefei ; NI Mingjian
Journal of Preventive Medicine 2023;35(12):1018-1023
Objective:
To identify the risk of HIV infection among men who have sex with men (MSM) with different sex roles, so as to provide insights into the prevention and control strategies for HIV infection among MSM.
Methods:
Peer-driven sampling method was employed to recruit MSM in a city in Xinjiang Uygur Autonomous Region in 2022, a questionnaire survey was conducted to collect demographic information and sexual behaviors, and laboratory tests were conducted to detect HIV and syphilis antibodies. The characteristics of sexual behaviors among MSM with different sex roles and prevalence of HIV infection were analyzed, and factors affecting HIV infection among MSM were identified using a multivariable logistic regression model.
Results:
A total of 666 MSM were investigated, with a mean age of (28.70±8.09) years and 577 local residents (86.64%). There were 166 insertive MSM (24.92%), 179 receptive MSM (26.88%) and 321 both receptive and insertive MSM (48.20%). The HIV infection rate was 8.26%, with 3.61% in insertive MSM, 13.41% in receptive MSM, and 7.79% in both receptive and insertive MSM. Significant differences were seen in age, recruitment route, sexual orientation, age of first homosexual sex, condom use with temporary partners and HIV infection rate among different sex roles (all P<0.05). Multivariable logistic regression analysis showed that insertive MSM had a lower risk of HIV infection than both receptive and insertive MSM (OR=0.513, 95%CI: 0.272-0.969), while there was no significant difference in the risk of HIV infection between receptive MSM and both receptive and insertive MSM (OR=2.088, 95%CI: 0.081-5.380).
Conclusions
The risk of HIV infection among receptive and both receptive and insertive MSM are higher than that among insertive MSM. Classified measures should be taken to reduce the transmission of HIV in this population.


Result Analysis
Print
Save
E-mail