1.Detection of residual DNA in host cells of Escherichia coli in levodopa by Real-time PCR
Bingyu XU ; YAN LIU ; Xinyao GUO ; Fang YAN ; Guibin SUN
Journal of China Pharmaceutical University 2025;56(2):176-182
Using Real-time PCR technology, a highly specific and sensitive method for detecting DNA residues of Escherichia coli host cells in levodopa was established, validated, and preliminarily applied. Escherichia coli strain MB6 16S ribosomal RNA gene was selected as the target gene to design multiple pairs of primers and the target fragment by specific amplification of PCR was obtained. The target fragment was cloned into the pLENTI-BSD-CON vector and the recombinant plasmid was constructed and named pLENTI-BSD-CON-E.coli-16S. A quantitative PCR detection method (SYBR Green method) with magnetic bead extraction and purification methods was established with the reference standard of the recombinant plasmid. Furthermore, the established method was validated, including linear and range, accuracy, precision, specificity, and quantification limit, and applied to the detection of levodopa raw materials. Meanwhile, the detection method was compared with the Taqman probe method by the commercial kit. The primer sequences of the quantitative PCR detection method (SYBR Green method) were TTCGATGCAACGCGAAGAAC (forward) and GTGTAGCCCTGGTCGTAAGG (reverse). The standard curve of DNA was in the range of 10 fg/μL to 3 ng/μL with good linearity (R2≥ 0.98). The quantitative limit was 10 fg/μL. In addition, the detection recovery rate was in the range of 59.7% to 80.7%, with RSD at less than 15%. Nine batches of levodopa were detected by this method, and the amount of E.coli DNA residue was below the limit. The developed qPCR method can be used for quantitative detection of residual DNA in biological products produced by E.coli as host cells, such as levodopa . The results indicate that the sensitivity of the detection method for recombinant plasmid construction standards is superior than the reagent kit detection method.
2.Randomized controlled trial of the efficacy and safety of peripheral to central pruning of apocrine sweat glands with traditional small incision of axillary fold under direct view versus along small incision of apocrine sweat glands in the treatment of axillary bromhidrosis
Bo SUN ; Xinrong ZHOU ; Bingyu ZHANG ; Chuan LI ; Yuting YUAN
Chinese Journal of Plastic Surgery 2024;40(6):605-611
Objective:To compare clinical efficacy and safety of peripheral to central pruning of apocrine sweat glands versus along small incision of apocrine sweat glands in the treatment of axillary bromhidrosis.Methods:A prospective randomized controlled study method was used to recruit patients with armpit odor admitted to the Department of Aesthetic and Plastic Surgery, Affiliated Hospital of Zunyi Medical University from June to October 2022. The patients were divided into the experimental group (underwent peripheral to central pruning of apocrine sweat glands with small incision of axillary fold under direct view) and the control group (apocrine sweat glands were cut off along the direction of small incisions) by randomization. The occurrence of postoperative complications such as hematoma, infection, skin necrosis, delayed incision healing, scar and skin contracture were observed in both groups, and the incidence rate was calculated. The surgical effect was evaluated 6 months after the operation, and the number of cured, markedly effective, and ineffective sides was counted, and the cure rate and effective rate were calculated; the satisfaction was investigated and divided into two options: satisfactory and dissatisfied, and the satisfaction rate was calculated. Count data were analyzed using the chi-square test. P<0.05 indicated that the difference was statistically significant. Results:A total of 52 patients were recruited. Experimental group, 26 patients (52 side), 6 male, 20 women, aged 18-31 years, mean of 22 years; control group, 26 patients (52 side), 6 male, 20 women, aged 18-47 years, mean of 21 years. The incidence of postoperative complications in the experimental group was 3.85% (2 / 52), which was lower than 19.23% (10/52) of the control group, with statistically significant difference ( χ2=3.98, P=0.046), in which the flap necrosis, local contracture, scarring and delayed incision healing were better than the control group. The postoperative response rate in both groups was 100%(52/52), but the cure rate in the experimental group was higher than the control group [96.15% (50/52) vs. 80.77% (42/52)], with a significant difference ( χ2=6.03, P=0.014). The satisfaction rate of the experimental group was 96.15% (50/52), higher than the 82.69% (43/52) of the control group, and the difference was statistically significant ( χ2=4.92, P=0.026). Conclusion:Compared with the traditional small incision of peripheral to central pruning method and the traditional small incision of apocrine sweat glands method, the cure rate of the former is higher, which can effectively protect the skin flap dermis and subdermal vascular network around the incision, reduce postoperative skin necrosis and scar, and improve patient satisfaction.
3.Randomized controlled trial of the efficacy and safety of peripheral to central pruning of apocrine sweat glands with traditional small incision of axillary fold under direct view versus along small incision of apocrine sweat glands in the treatment of axillary bromhidrosis
Bo SUN ; Xinrong ZHOU ; Bingyu ZHANG ; Chuan LI ; Yuting YUAN
Chinese Journal of Plastic Surgery 2024;40(6):605-611
Objective:To compare clinical efficacy and safety of peripheral to central pruning of apocrine sweat glands versus along small incision of apocrine sweat glands in the treatment of axillary bromhidrosis.Methods:A prospective randomized controlled study method was used to recruit patients with armpit odor admitted to the Department of Aesthetic and Plastic Surgery, Affiliated Hospital of Zunyi Medical University from June to October 2022. The patients were divided into the experimental group (underwent peripheral to central pruning of apocrine sweat glands with small incision of axillary fold under direct view) and the control group (apocrine sweat glands were cut off along the direction of small incisions) by randomization. The occurrence of postoperative complications such as hematoma, infection, skin necrosis, delayed incision healing, scar and skin contracture were observed in both groups, and the incidence rate was calculated. The surgical effect was evaluated 6 months after the operation, and the number of cured, markedly effective, and ineffective sides was counted, and the cure rate and effective rate were calculated; the satisfaction was investigated and divided into two options: satisfactory and dissatisfied, and the satisfaction rate was calculated. Count data were analyzed using the chi-square test. P<0.05 indicated that the difference was statistically significant. Results:A total of 52 patients were recruited. Experimental group, 26 patients (52 side), 6 male, 20 women, aged 18-31 years, mean of 22 years; control group, 26 patients (52 side), 6 male, 20 women, aged 18-47 years, mean of 21 years. The incidence of postoperative complications in the experimental group was 3.85% (2 / 52), which was lower than 19.23% (10/52) of the control group, with statistically significant difference ( χ2=3.98, P=0.046), in which the flap necrosis, local contracture, scarring and delayed incision healing were better than the control group. The postoperative response rate in both groups was 100%(52/52), but the cure rate in the experimental group was higher than the control group [96.15% (50/52) vs. 80.77% (42/52)], with a significant difference ( χ2=6.03, P=0.014). The satisfaction rate of the experimental group was 96.15% (50/52), higher than the 82.69% (43/52) of the control group, and the difference was statistically significant ( χ2=4.92, P=0.026). Conclusion:Compared with the traditional small incision of peripheral to central pruning method and the traditional small incision of apocrine sweat glands method, the cure rate of the former is higher, which can effectively protect the skin flap dermis and subdermal vascular network around the incision, reduce postoperative skin necrosis and scar, and improve patient satisfaction.
4.Clinical analysis of complete left bundle branch block after transcatheter closure of ventricular septal defect in 25 children
Bingyu MA ; Yifan LI ; Dongpo LIANG ; Ling SUN ; Xu HUANG ; Shaoying ZENG ; Shusheng WEN ; Shushui WANG ; Zhiwei ZHANG ; Yumei XIE
Chinese Journal of Applied Clinical Pediatrics 2024;39(10):743-749
Objective:To summarize the clinical treatment of complete left bundle branch block (CLBBB) after the transcatheter closure of ventricular septal defect (VSD).Methods:A case series study was conducted on the treatments and outcomes of 25 children with CLBBB after transcatheter VSD closure in Guangdong Provincial People′s Hospital from January 2010 to December 2023.Paired sample t test was used to evaluate the effect of occlude removal. Results:Among the 25 patients, 12 were males (48%), and 13 were females (52%).The age at surgery was 3.18 (2.51-3.86) years, the height before surgery was 95.0 (90.0-97.5) cm, and the weight before surgery was 13 (12-15) kg.Fourteen children were early-onset cases (≤ 1 month), while the other 11 were late-onset cases (> 1 month).The mean follow-up time was (6.63±3.93) years.Of the 14 early-onset cases, 6 children underwent occluder removal within 1 month and restored normal heart rhythm or incomplete right bundle branch block; 4 children underwent occluder removal after 1 month, of whom 2 recovered, 1 remained CLBBB, and 1 had complete atrioventricular block (CAVB); the other 4 children received drug treatment, of whom 2 had normal heart rhythm, 1 had left anterior fascicular block, and 1 died of cardiac shock and heart failure.All the 11 late-onset cases were first treated by drugs, of whom 3 recovered, and the other 8 remained CLBBB.One of the 8 cases received occluder removal at 8 months after surgery and recovered, 1 had CAVB, and the other 6 remained CLBBB.Conclusions:For patients with CLBBB after transcatheter closure of VSD, drug therapy is not always effective, and CLBBB is easy to recur.Therefore, occluder removal is recommended to be done immediately after CLBBB is discovered.Patients with persistent CLBBB should be followed up regularly, and pacemaker implantation may be performed if necessary.
5.A long-term follow-up study of percutaneous stent implantation for residual pulmonary artery stenosis after complicated congenital heart disease
Xu HUANG ; Yifan LI ; Bingyu MA ; Ling SUN ; Junjie LI ; Jijun SHI ; Shushui WANG ; Zhiwei ZHANG ; Yumei XIE
Chinese Journal of Thoracic and Cardiovascular Surgery 2024;40(6):355-361
Objective:To investigate the long-term safety and effectiveness of stent implantation for residual pulmonary artery stenosis after complicated congenital heart disease.Methods:The symptoms, signs, echocardiography, cardiac CT, cardiac catheterization, six-minute walking distance, and BNP of 41 patients diagnosed from January 1996 to January 2020. In this group, 41 patients, 30 males and 11 females, aged 1.3-14.5 years old, mean (6.1±3.6) years old, and weighed 8-43 kg, mean (18.9±9.4)kg, compared the diameter of the target vessel, pressure difference across stenosis, cardiac function before and postoperative follow-up, and evaluated the long-term effect of stent implantation in the treatment of pulmonary artery stenosis.Results:All 41 patients were not lost to follow-up, no death, and there were no serious adverse events such as stent fracture, artery dissection and pulmonary embolism during follow-up. The median follow-up time was 7.1 years (3.1 to 13.8 years). As of January 2023, the echocardiographic results showed that the diameter of the target vessels in 41 patients increased from preoperative (3.9±1.5) mm to (6.0±1.5) mm ( P<0.05), the pressure difference across the stenosis decreased from preoperative (51.4±19.1) mmHg to (33.1±19.7) mmHg (1 mmHg=0.133 kPa, P<0.05); Heart spiral CT showed that the ratio of target vessel diameter to distal vessel diameter increased from preoperative 0.4±0.2 to 0.9±0.3( P<0.05). All patients had no slow growth and development, no recurrent lung infection, 39 patients (95.1%) had gradeⅠcardiac function, and 2 patients (4.9%) had gradeⅡcardiac function.As children in school age, the walking distance of 6 min was 462 to 633 m, mean( 529.9±57.1)m, the respiratory score was 0.5-1, and the lower limb force score was 6-12. There were 5 long-term adverse events, including 4 cases of target vessel restenosis (9.7%), and 1 case (2.4%), two of the patients with restenosis with repeated target vessel stenosis and lateral pulmonary hypertension were surgically intervention: stent removing and pumonary expanding, after 4, 13 years of stent implantation.And the others were still in follow-up, and no further intervention was made. The Cox multivariate survival analysis suggested that right ventricular systolic blood pressure was a risk factor for endpoint events before stent implantation ( P<0.05). Conclusion:The treatment of residual pulmonary artery stenosis after complicated congenital heart disease after percutaneous stent implantation can effectively relieve the right heart pressure overload, improve pulmonary blood flow, stabilize cardiac function, improve the long-term prognosis of patients with complicated congenital heart disease, reduce the chest opening rate of reoperation, and have stable long-term curative effect.
6.Chinese expert consensus on blood support mode and blood transfusion strategies for emergency treatment of severe trauma patients (version 2024)
Yao LU ; Yang LI ; Leiying ZHANG ; Hao TANG ; Huidan JING ; Yaoli WANG ; Xiangzhi JIA ; Li BA ; Maohong BIAN ; Dan CAI ; Hui CAI ; Xiaohong CAI ; Zhanshan ZHA ; Bingyu CHEN ; Daqing CHEN ; Feng CHEN ; Guoan CHEN ; Haiming CHEN ; Jing CHEN ; Min CHEN ; Qing CHEN ; Shu CHEN ; Xi CHEN ; Jinfeng CHENG ; Xiaoling CHU ; Hongwang CUI ; Xin CUI ; Zhen DA ; Ying DAI ; Surong DENG ; Weiqun DONG ; Weimin FAN ; Ke FENG ; Danhui FU ; Yongshui FU ; Qi FU ; Xuemei FU ; Jia GAN ; Xinyu GAN ; Wei GAO ; Huaizheng GONG ; Rong GUI ; Geng GUO ; Ning HAN ; Yiwen HAO ; Wubing HE ; Qiang HONG ; Ruiqin HOU ; Wei HOU ; Jie HU ; Peiyang HU ; Xi HU ; Xiaoyu HU ; Guangbin HUANG ; Jie HUANG ; Xiangyan HUANG ; Yuanshuai HUANG ; Shouyong HUN ; Xuebing JIANG ; Ping JIN ; Dong LAI ; Aiping LE ; Hongmei LI ; Bijuan LI ; Cuiying LI ; Daihong LI ; Haihong LI ; He LI ; Hui LI ; Jianping LI ; Ning LI ; Xiying LI ; Xiangmin LI ; Xiaofei LI ; Xiaojuan LI ; Zhiqiang LI ; Zhongjun LI ; Zunyan LI ; Huaqin LIANG ; Xiaohua LIANG ; Dongfa LIAO ; Qun LIAO ; Yan LIAO ; Jiajin LIN ; Chunxia LIU ; Fenghua LIU ; Peixian LIU ; Tiemei LIU ; Xiaoxin LIU ; Zhiwei LIU ; Zhongdi LIU ; Hua LU ; Jianfeng LUAN ; Jianjun LUO ; Qun LUO ; Dingfeng LYU ; Qi LYU ; Xianping LYU ; Aijun MA ; Liqiang MA ; Shuxuan MA ; Xainjun MA ; Xiaogang MA ; Xiaoli MA ; Guoqing MAO ; Shijie MU ; Shaolin NIE ; Shujuan OUYANG ; Xilin OUYANG ; Chunqiu PAN ; Jian PAN ; Xiaohua PAN ; Lei PENG ; Tao PENG ; Baohua QIAN ; Shu QIAO ; Li QIN ; Ying REN ; Zhaoqi REN ; Ruiming RONG ; Changshan SU ; Mingwei SUN ; Wenwu SUN ; Zhenwei SUN ; Haiping TANG ; Xiaofeng TANG ; Changjiu TANG ; Cuihua TAO ; Zhibin TIAN ; Juan WANG ; Baoyan WANG ; Chunyan WANG ; Gefei WANG ; Haiyan WANG ; Hongjie WANG ; Peng WANG ; Pengli WANG ; Qiushi WANG ; Xiaoning WANG ; Xinhua WANG ; Xuefeng WANG ; Yong WANG ; Yongjun WANG ; Yuanjie WANG ; Zhihua WANG ; Shaojun WEI ; Yaming WEI ; Jianbo WEN ; Jun WEN ; Jiang WU ; Jufeng WU ; Aijun XIA ; Fei XIA ; Rong XIA ; Jue XIE ; Yanchao XING ; Yan XIONG ; Feng XU ; Yongzhu XU ; Yongan XU ; Yonghe YAN ; Beizhan YAN ; Jiang YANG ; Jiangcun YANG ; Jun YANG ; Xinwen YANG ; Yongyi YANG ; Chunyan YAO ; Mingliang YE ; Changlin YIN ; Ming YIN ; Wen YIN ; Lianling YU ; Shuhong YU ; Zebo YU ; Yigang YU ; Anyong YU ; Hong YUAN ; Yi YUAN ; Chan ZHANG ; Jinjun ZHANG ; Jun ZHANG ; Kai ZHANG ; Leibing ZHANG ; Quan ZHANG ; Rongjiang ZHANG ; Sanming ZHANG ; Shengji ZHANG ; Shuo ZHANG ; Wei ZHANG ; Weidong ZHANG ; Xi ZHANG ; Xingwen ZHANG ; Guixi ZHANG ; Xiaojun ZHANG ; Guoqing ZHAO ; Jianpeng ZHAO ; Shuming ZHAO ; Beibei ZHENG ; Shangen ZHENG ; Huayou ZHOU ; Jicheng ZHOU ; Lihong ZHOU ; Mou ZHOU ; Xiaoyu ZHOU ; Xuelian ZHOU ; Yuan ZHOU ; Zheng ZHOU ; Zuhuang ZHOU ; Haiyan ZHU ; Peiyuan ZHU ; Changju ZHU ; Lili ZHU ; Zhengguo WANG ; Jianxin JIANG ; Deqing WANG ; Jiongcai LAN ; Quanli WANG ; Yang YU ; Lianyang ZHANG ; Aiqing WEN
Chinese Journal of Trauma 2024;40(10):865-881
Patients with severe trauma require an extremely timely treatment and transfusion plays an irreplaceable role in the emergency treatment of such patients. An increasing number of evidence-based medicinal evidences and clinical practices suggest that patients with severe traumatic bleeding benefit from early transfusion of low-titer group O whole blood or hemostatic resuscitation with red blood cells, plasma and platelet of a balanced ratio. However, the current domestic mode of blood supply cannot fully meet the requirements of timely and effective blood transfusion for emergency treatment of patients with severe trauma in clinical practice. In order to solve the key problems in blood supply and blood transfusion strategies for emergency treatment of severe trauma, Branch of Clinical Transfusion Medicine of Chinese Medical Association, Group for Trauma Emergency Care and Multiple Injuries of Trauma Branch of Chinese Medical Association, Young Scholar Group of Disaster Medicine Branch of Chinese Medical Association organized domestic experts of blood transfusion medicine and trauma treatment to jointly formulate Chinese expert consensus on blood support mode and blood transfusion strategies for emergency treatment of severe trauma patients ( version 2024). Based on the evidence-based medical evidence and Delphi method of expert consultation and voting, 10 recommendations were put forward from two aspects of blood support mode and transfusion strategies, aiming to provide a reference for transfusion resuscitation in the emergency treatment of severe trauma and further improve the success rate of treatment of patients with severe trauma.
7.Traditional Chinese medicines and their active ingredients sensitize cancer cells to TRAIL-induced apoptosis.
Bingyu SUN ; Yongqiang LIU ; Danhua HE ; Jinke LI ; Jiawei WANG ; Wulin WEN ; Ming HONG
Journal of Zhejiang University. Science. B 2021;22(3):190-203
The rapidly developing resistance of cancers to chemotherapy agents and the severe cytotoxicity of such agents to normal cells are major stumbling blocks in current cancer treatments. Most current chemotherapy agents have significant cytotoxicity, which leads to devastating adverse effects and results in a substandard quality of life, including increased daily morbidity and premature mortality. The death receptor of tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) can sidestep p53-dependent pathways to induce tumor cell apoptosis without damaging most normal cells. However, various cancer cells can develop resistance to TRAIL-induced apoptosis via different pathways. Therefore, it is critical to find an efficient TRAIL sensitizer to reverse the resistance of tumor cells to TRAIL, and to reinforce TRAIL's ability to induce tumor cell apoptosis. In recent years, traditional Chinese medicines and their active ingredients have shown great potential to trigger apoptotic cell death in TRAIL-resistant cancer cell lines. This review aims to collate information about Chinese medicines that can effectively reverse the resistance of tumor cells to TRAIL and enhance TRAIL's ability to induce apoptosis. We explore the therapeutic potential of TRAIL and provide new ideas for the development of TRAIL therapy and the generation of new anti-cancer drugs for human cancer treatment. This study involved an extensive review of studies obtained from literature searches of electronic databases such as Google Scholar and PubMed. "TRAIL sensitize" and "Chinese medicine" were the search keywords. We then isolated newly published studies on the mechanisms of TRAIL-induced apoptosis. The name of each plant was validated using certified databases such as The Plant List. This study indicates that TRAIL can be combined with different Chinese medicine components through intrinsic or extrinsic pathways to promote cancer cell apoptosis. It also demonstrates that the active ingredients of traditional Chinese medicines enhance the sensitivity of cancer cells to TRAIL-mediated apoptosis. This provides useful information regarding traditional Chinese medicine treatment, the development of TRAIL-based therapies, and the treatment of cancer.
8. A clinical study on 99Tc-MDP for thyroid-associated ophthalmopathy
Bingyu WANG ; Jianping SUN ; Guohua HAO ; Bo PENG ; Jingyao LIU ; Wei DUAN
Chinese Journal of Endemiology 2019;38(11):922-926
Objective:
To investigate the efficacy and safety of 99Technetium-methylenediphosphonate injection (99Tc-MDP) in the treatment of thyroid associated ophthalmopathy (TAO).
Methods:
The trail was conducted in Affiliated Zhongshan Hospital of Dalian University. Patients were recruited from October 2016 to October 2018. Fifty patients with active moderate to severe TAO were randomly assigned to receive 99Tc-MDP (
9.The role of microRNA-140 in the development of osteoarthritis and its important target genes
Bingyu SUN ; Fuyuan LI ; Ning ZOU ; Dianjun SUN
Chinese Journal of Endemiology 2018;37(5):426-430
Osteoarthritis is a kind of joint disease with cartilage injury as the main pathological changes.There is no effective treatment for them.With the discovery,research and application of microRNA (miR),it also provides new hope for the treatment of osteoarthropathy.At present,the role of miR in the pathogenesis of cartilage injury has been fully recognized.In this paper,we reviewed the role of miR-140 in the development of osteoarthritis and its important target genes in recent years.
10.High flow nasal cannula oxygen therapy versus non-invasive ventilation for chronic obstructive pulmonary diseases with acute-moderate hypercapnic respiratory failure: an observational cohort study
Dingyu TAN ; Bingyu LING ; Jiayan SUN ; Ping GENG ; Jun XU ; Huadong ZHU ; Xuezhong YU
Chinese Journal of Emergency Medicine 2018;27(4):361-366
Objective To compare the efficacy of high flow nasal cannula oxygen therapy (HFNC) and non-invasive ventilation (NIV) in the treatment of chronic obstructive pulmonary disease (COPD) with acute-moderate type Ⅱ respiratory failure,and to explore the feasibility of HFNC in the treatment of COPD with respiratory failure.Methods Patients diagnosed with COPD with acute moderate type Ⅱ respiratory failure (Arterial blood gas pH 7.25-7.35,PaCO2> 50 mmHg) admitted to the ICUs from April 2017 to December 2017 were retrospectively analyzed.All patients who were treated with HFNC within the first 4 hours after the admission to the ICUs,and continued for more than 2 hours and for at least 4 hours within the first 24 hours were included in the HFNC group.Those treated with NIV in the same conditions were included in the NIV group.The end point was the failure rates of treatment (changing to respiratory support method in another group or invasive ventilation) and 28-day mortality.Results Eighty-two patients (39 in the HFNC group and 43 in the NIV group) were enrolled.The HFNC group had a treatment failure rate of 28.2%,which was lower than that of the NIV group (39.5%).However,Kaplan-Meier curve analysis showed no significant difference between the two groups (Log Rank test 1.228,P=0.268).The 28-day mortality rate in HFNC group was 15.4%,which was no different from 14% in NIV group (Log Rank test 0.049,P=0.824).The number of airway care interventions within the first 24 hours was significantly lower in the HFNC group than in the NIV group [5 (3~8) vs.11 (7~15)],whereas the duration of respiratory support within the first 24 hours was significantly longer in the HFNC group than in the NIV group [16 (9~22) hours vs.8 (4~11) hours] (all P<0.05).The incidence of nasal facial lesions in the NIV group was 20.9%,significantly higher than that of HFNC group (5.1%,P <0.05).Conclusion For COPD with acute moderate type Ⅱ respiratory failure,HFNC has similar therapeutic effects as NIV.HFNC has better therapeutic tolerance and is a new potential respiratory support method for clinical treatment of COPD with respiratory failure.

Result Analysis
Print
Save
E-mail