Objective:To explore the predictive value of platelet aggregation function for acute kidney injury (AKI) in sepsis patients based on decision curve.Methods:A retrospective study was conducted to collect and analyze the clinical data of 120 sepsis patients admitted to the Affiliated Hospital of Jiangnan University from January 2021 to December 2023. According to the incidence of AKI during hospitalization, they were divided into AKI group (37 cases) and non-AKI group (83 cases). The general data, platelet aggregation function index (platelet aggregation rate) and other laboratory indexes of the two groups were collected and compared. Logistic regression model was used to analyze the relationship between AKI and main indexes of platelet aggregation function in patients with sepsis. The area under the curve (AUC) was obtained by drawing the receiver operating characteristic (ROC) curve, and the predictive value of platelet aggregation function on AKI in patients with sepsis was analyzed. R language software was used to construct a nomogram model of platelet aggregation function combined with other main indicators to predict AKI in patients with sepsis. Based on the decision curve, the predictive efficacy of the model on AKI in patients with sepsis was analyzed.Results:The platelet aggregation rate in the AKI group was lower than that in the non-AKI group: (56.23 ± 7.86)% vs. (68.79 ± 8.54)%, and the thrombin time was longer than that in the non-AKI group: 17.00 (16.50, 18.00) s vs. 16.00 (15.00, 17.00) s. The levels of D-dimer, C-reactive protein and procalcitonin were higher than those in the non-AKI group: (1.55 ± 0.45) mg/L vs. (1.32 ± 0.41) mg/L, (107.53 ± 18.41) mg/L vs. (99.86 ± 17.25) mg/L, (3.10 ± 0.46) μg/L vs. (2.88 ± 0.42) μg/L, and the differences were statistically significant ( P<0.05). The results of constructing a Logistic regression model showed that AKI in sepsis patients may be related to abnormal levels of platelet aggregation rate, thrombin time, C-reactive protein and procalcitonin ( P<0.05). The ROC curve was drawn to obtain the corresponding AUC: the AUC of platelet aggregation rate predicting sepsis complicated with AKI was 0.860 (95% CI 0.789 to 0.931), which had certain predictive value. When the platelet aggregation rate was set to 62.84%, the best predictive value can be obtained, with sensitivity, specificity, and Jorden index of 83.80%, 80.70%, and 0.645, respectively. The nomogram model of platelet aggregation function assisting other major indicators in predicting AKI in sepsis patients had a C-index of 0.904 (95% CI 0.851 to 0.957), indicating good discrimination of the model. Through decision curve analysis of the clinical net benefit of the model, the results showed that the clinical net benefit of the model was higher than that of platelet aggregation rate and other major indicators when applied alone. When the risk threshold was within the range of 0 to 0.81 and 0.97 to 1.00, the model could provide a significant increase in clinical net benefit rate. Conclusions:Platelet aggregation function (platelet aggregation rate) can serve as an early auxiliary predictive indicator for the risk of AKI in sepsis patients, and can assist other major indicators to improve the predictive value of AKI in sepsis patients.

Objective:To summarize the clinical and genetic characteristics of 23 children with pathogenic ACAN gene variants, enhance the understanding of this disorder, and explore possible regulatory mechanisms. Methods:A retrospective case series summary.The clinical characteristics and genetic analysis results of 23 children with ACAN gene variants treated in the Department of Endocrinology, Genetics and Metabolism, Children′s Hospital of Soochow University from January 2016 and September 2024 were analyzed retrospectively.Transcriptome sequencing was performed on peripheral blood samples from 3 of affected children and 3 age-matched healthy children as controls.Differentially expressed genes (DEGs) in the peripheral blood transcriptome profiles were identified.Gene ontology (GO) and Kyoto encyclopedia of genes and genomes (KEGG) pathway enrichment analyses were conducted to explore the potential signaling pathways involved. Results:Among the 23 cases, there were 13 males and 10 females, aged from 2 years and 8 months to 12 years old, with 11 cases presenting advanced bone age.Thirteen cases were treated with growth hormone (GH), including 6 cases who received concomitant gonadotropin-releasing hormone analogue therapy.The treatment duration ranged from 3 to 70 months, resulting in varying degrees of height improvement in all treated patients.Transcriptomic analysis identified 811 DEGs, with 516 up-regulated and 295 down-regulated.GO and KEGG enrichment analyses revealed that the heterozygous ACAN variants were significantly associated with FcγR-mediated phagocytosis, nuclear factor-κB signaling pathway, the intestinal immune network for IgA production, rheumatoid arthritis, and systemic lupus erythematosus signaling pathways. Conclusions:The predominant clinical manifestations of patients with ACAN gene variants are short stature and advanced bone age.Although GH provocation tests may indicate normal GH levels, GH therapy can be effective in improving height.Immune-related factors may play a role in the pathogenesis of this disorder.

Using Real-time PCR technology, a highly specific and sensitive method for detecting DNA residues of Escherichia coli host cells in levodopa was established, validated, and preliminarily applied. Escherichia coli strain MB6 16S ribosomal RNA gene was selected as the target gene to design multiple pairs of primers and the target fragment by specific amplification of PCR was obtained. The target fragment was cloned into the pLENTI-BSD-CON vector and the recombinant plasmid was constructed and named pLENTI-BSD-CON-E.coli-16S. A quantitative PCR detection method (SYBR Green method) with magnetic bead extraction and purification methods was established with the reference standard of the recombinant plasmid. Furthermore, the established method was validated, including linear and range, accuracy, precision, specificity, and quantification limit, and applied to the detection of levodopa raw materials. Meanwhile, the detection method was compared with the Taqman probe method by the commercial kit. The primer sequences of the quantitative PCR detection method (SYBR Green method) were TTCGATGCAACGCGAAGAAC (forward) and GTGTAGCCCTGGTCGTAAGG (reverse). The standard curve of DNA was in the range of 10 fg/μL to 3 ng/μL with good linearity (R2≥ 0.98). The quantitative limit was 10 fg/μL. In addition, the detection recovery rate was in the range of 59.7% to 80.7%, with RSD at less than 15%. Nine batches of levodopa were detected by this method, and the amount of E.coli DNA residue was below the limit. The developed qPCR method can be used for quantitative detection of residual DNA in biological products produced by E.coli as host cells, such as levodopa . The results indicate that the sensitivity of the detection method for recombinant plasmid construction standards is superior than the reagent kit detection method.

Objective:To compare the degranulation levels of basophils in peripheral blood mononuclear cell (PBMC) and granulocyte populations between healthy subjects and patients with sepsis, and to explore the underlying mechanisms. Additionally, plasma cytokine levels were measured in these volunteers.Methods:Peripheral blood samples were collected from both healthy individuals and sepsis patients. The degranulation level of basophils in sepsis patients and its potential mechanisms were examined. Plasma levels of IL-1β, IL-9, and IL-10 were detected, and Pearson correlation analysis was performed to assess the relationship between degranulated basophils in the granulocyte population and IL-9 levels.Results:Compared with healthy subjects, sepsis patients showed a reduction in basophil percentages within PBMC and granulocyte populations by 94.8% and 37.9%, respectively ( Z = -6.441, P < 0.05; Z = -2.681, P < 0.05). In contrast, both the proportion and number of degranulated basophils in the granulocyte population were increased (both P < 0.05). Plasma levels of IL-1β, IL-9, and IL-10 were significantly elevated in sepsis patients--by 80.6%, 36.7%, and 11.9-fold, respectively ( Z = -4.258, P < 0.05; Z = -3.606, P < 0.05; Z = -4.814, P < 0.05). Moreover, plasma IL-9 levels were highly correlated with both the percentage and count of degranulated basophils in the granulocyte population (both P < 0.05). GO and KEGG enrichment analyses revealed cytological changes and potential mechanisms involving basophils in the PBMC of sepsis patients. Conclusions:The decreased total count of basophils in sepsis patients may elevate the risk of secondary infection. Degranulated basophils in the granulocyte population may contribute to excessive inflammatory responses through IL-9 secretion.

Objective:To explore the predictive value of platelet aggregation function for acute kidney injury (AKI) in sepsis patients based on decision curve.Methods:A retrospective study was conducted to collect and analyze the clinical data of 120 sepsis patients admitted to the Affiliated Hospital of Jiangnan University from January 2021 to December 2023. According to the incidence of AKI during hospitalization, they were divided into AKI group (37 cases) and non-AKI group (83 cases). The general data, platelet aggregation function index (platelet aggregation rate) and other laboratory indexes of the two groups were collected and compared. Logistic regression model was used to analyze the relationship between AKI and main indexes of platelet aggregation function in patients with sepsis. The area under the curve (AUC) was obtained by drawing the receiver operating characteristic (ROC) curve, and the predictive value of platelet aggregation function on AKI in patients with sepsis was analyzed. R language software was used to construct a nomogram model of platelet aggregation function combined with other main indicators to predict AKI in patients with sepsis. Based on the decision curve, the predictive efficacy of the model on AKI in patients with sepsis was analyzed.Results:The platelet aggregation rate in the AKI group was lower than that in the non-AKI group: (56.23 ± 7.86)% vs. (68.79 ± 8.54)%, and the thrombin time was longer than that in the non-AKI group: 17.00 (16.50, 18.00) s vs. 16.00 (15.00, 17.00) s. The levels of D-dimer, C-reactive protein and procalcitonin were higher than those in the non-AKI group: (1.55 ± 0.45) mg/L vs. (1.32 ± 0.41) mg/L, (107.53 ± 18.41) mg/L vs. (99.86 ± 17.25) mg/L, (3.10 ± 0.46) μg/L vs. (2.88 ± 0.42) μg/L, and the differences were statistically significant ( P<0.05). The results of constructing a Logistic regression model showed that AKI in sepsis patients may be related to abnormal levels of platelet aggregation rate, thrombin time, C-reactive protein and procalcitonin ( P<0.05). The ROC curve was drawn to obtain the corresponding AUC: the AUC of platelet aggregation rate predicting sepsis complicated with AKI was 0.860 (95% CI 0.789 to 0.931), which had certain predictive value. When the platelet aggregation rate was set to 62.84%, the best predictive value can be obtained, with sensitivity, specificity, and Jorden index of 83.80%, 80.70%, and 0.645, respectively. The nomogram model of platelet aggregation function assisting other major indicators in predicting AKI in sepsis patients had a C-index of 0.904 (95% CI 0.851 to 0.957), indicating good discrimination of the model. Through decision curve analysis of the clinical net benefit of the model, the results showed that the clinical net benefit of the model was higher than that of platelet aggregation rate and other major indicators when applied alone. When the risk threshold was within the range of 0 to 0.81 and 0.97 to 1.00, the model could provide a significant increase in clinical net benefit rate. Conclusions:Platelet aggregation function (platelet aggregation rate) can serve as an early auxiliary predictive indicator for the risk of AKI in sepsis patients, and can assist other major indicators to improve the predictive value of AKI in sepsis patients.

Objective:To summarize the clinical and genetic characteristics of 23 children with pathogenic ACAN gene variants, enhance the understanding of this disorder, and explore possible regulatory mechanisms. Methods:A retrospective case series summary.The clinical characteristics and genetic analysis results of 23 children with ACAN gene variants treated in the Department of Endocrinology, Genetics and Metabolism, Children′s Hospital of Soochow University from January 2016 and September 2024 were analyzed retrospectively.Transcriptome sequencing was performed on peripheral blood samples from 3 of affected children and 3 age-matched healthy children as controls.Differentially expressed genes (DEGs) in the peripheral blood transcriptome profiles were identified.Gene ontology (GO) and Kyoto encyclopedia of genes and genomes (KEGG) pathway enrichment analyses were conducted to explore the potential signaling pathways involved. Results:Among the 23 cases, there were 13 males and 10 females, aged from 2 years and 8 months to 12 years old, with 11 cases presenting advanced bone age.Thirteen cases were treated with growth hormone (GH), including 6 cases who received concomitant gonadotropin-releasing hormone analogue therapy.The treatment duration ranged from 3 to 70 months, resulting in varying degrees of height improvement in all treated patients.Transcriptomic analysis identified 811 DEGs, with 516 up-regulated and 295 down-regulated.GO and KEGG enrichment analyses revealed that the heterozygous ACAN variants were significantly associated with FcγR-mediated phagocytosis, nuclear factor-κB signaling pathway, the intestinal immune network for IgA production, rheumatoid arthritis, and systemic lupus erythematosus signaling pathways. Conclusions:The predominant clinical manifestations of patients with ACAN gene variants are short stature and advanced bone age.Although GH provocation tests may indicate normal GH levels, GH therapy can be effective in improving height.Immune-related factors may play a role in the pathogenesis of this disorder.

Objective:To summarize the clinical treatment of complete left bundle branch block (CLBBB) after the transcatheter closure of ventricular septal defect (VSD).Methods:A case series study was conducted on the treatments and outcomes of 25 children with CLBBB after transcatheter VSD closure in Guangdong Provincial People′s Hospital from January 2010 to December 2023.Paired sample t test was used to evaluate the effect of occlude removal. Results:Among the 25 patients, 12 were males (48%), and 13 were females (52%).The age at surgery was 3.18 (2.51-3.86) years, the height before surgery was 95.0 (90.0-97.5) cm, and the weight before surgery was 13 (12-15) kg.Fourteen children were early-onset cases (≤ 1 month), while the other 11 were late-onset cases (> 1 month).The mean follow-up time was (6.63±3.93) years.Of the 14 early-onset cases, 6 children underwent occluder removal within 1 month and restored normal heart rhythm or incomplete right bundle branch block; 4 children underwent occluder removal after 1 month, of whom 2 recovered, 1 remained CLBBB, and 1 had complete atrioventricular block (CAVB); the other 4 children received drug treatment, of whom 2 had normal heart rhythm, 1 had left anterior fascicular block, and 1 died of cardiac shock and heart failure.All the 11 late-onset cases were first treated by drugs, of whom 3 recovered, and the other 8 remained CLBBB.One of the 8 cases received occluder removal at 8 months after surgery and recovered, 1 had CAVB, and the other 6 remained CLBBB.Conclusions:For patients with CLBBB after transcatheter closure of VSD, drug therapy is not always effective, and CLBBB is easy to recur.Therefore, occluder removal is recommended to be done immediately after CLBBB is discovered.Patients with persistent CLBBB should be followed up regularly, and pacemaker implantation may be performed if necessary.

Objective:To compare clinical efficacy and safety of peripheral to central pruning of apocrine sweat glands versus along small incision of apocrine sweat glands in the treatment of axillary bromhidrosis.Methods:A prospective randomized controlled study method was used to recruit patients with armpit odor admitted to the Department of Aesthetic and Plastic Surgery, Affiliated Hospital of Zunyi Medical University from June to October 2022. The patients were divided into the experimental group (underwent peripheral to central pruning of apocrine sweat glands with small incision of axillary fold under direct view) and the control group (apocrine sweat glands were cut off along the direction of small incisions) by randomization. The occurrence of postoperative complications such as hematoma, infection, skin necrosis, delayed incision healing, scar and skin contracture were observed in both groups, and the incidence rate was calculated. The surgical effect was evaluated 6 months after the operation, and the number of cured, markedly effective, and ineffective sides was counted, and the cure rate and effective rate were calculated; the satisfaction was investigated and divided into two options: satisfactory and dissatisfied, and the satisfaction rate was calculated. Count data were analyzed using the chi-square test. P<0.05 indicated that the difference was statistically significant. Results:A total of 52 patients were recruited. Experimental group, 26 patients (52 side), 6 male, 20 women, aged 18-31 years, mean of 22 years; control group, 26 patients (52 side), 6 male, 20 women, aged 18-47 years, mean of 21 years. The incidence of postoperative complications in the experimental group was 3.85% (2 / 52), which was lower than 19.23% (10/52) of the control group, with statistically significant difference ( χ2=3.98, P=0.046), in which the flap necrosis, local contracture, scarring and delayed incision healing were better than the control group. The postoperative response rate in both groups was 100%(52/52), but the cure rate in the experimental group was higher than the control group [96.15% (50/52) vs. 80.77% (42/52)], with a significant difference ( χ2=6.03, P=0.014). The satisfaction rate of the experimental group was 96.15% (50/52), higher than the 82.69% (43/52) of the control group, and the difference was statistically significant ( χ2=4.92, P=0.026). Conclusion:Compared with the traditional small incision of peripheral to central pruning method and the traditional small incision of apocrine sweat glands method, the cure rate of the former is higher, which can effectively protect the skin flap dermis and subdermal vascular network around the incision, reduce postoperative skin necrosis and scar, and improve patient satisfaction.

Objective:To compare clinical efficacy and safety of peripheral to central pruning of apocrine sweat glands versus along small incision of apocrine sweat glands in the treatment of axillary bromhidrosis.Methods:A prospective randomized controlled study method was used to recruit patients with armpit odor admitted to the Department of Aesthetic and Plastic Surgery, Affiliated Hospital of Zunyi Medical University from June to October 2022. The patients were divided into the experimental group (underwent peripheral to central pruning of apocrine sweat glands with small incision of axillary fold under direct view) and the control group (apocrine sweat glands were cut off along the direction of small incisions) by randomization. The occurrence of postoperative complications such as hematoma, infection, skin necrosis, delayed incision healing, scar and skin contracture were observed in both groups, and the incidence rate was calculated. The surgical effect was evaluated 6 months after the operation, and the number of cured, markedly effective, and ineffective sides was counted, and the cure rate and effective rate were calculated; the satisfaction was investigated and divided into two options: satisfactory and dissatisfied, and the satisfaction rate was calculated. Count data were analyzed using the chi-square test. P<0.05 indicated that the difference was statistically significant. Results:A total of 52 patients were recruited. Experimental group, 26 patients (52 side), 6 male, 20 women, aged 18-31 years, mean of 22 years; control group, 26 patients (52 side), 6 male, 20 women, aged 18-47 years, mean of 21 years. The incidence of postoperative complications in the experimental group was 3.85% (2 / 52), which was lower than 19.23% (10/52) of the control group, with statistically significant difference ( χ2=3.98, P=0.046), in which the flap necrosis, local contracture, scarring and delayed incision healing were better than the control group. The postoperative response rate in both groups was 100%(52/52), but the cure rate in the experimental group was higher than the control group [96.15% (50/52) vs. 80.77% (42/52)], with a significant difference ( χ2=6.03, P=0.014). The satisfaction rate of the experimental group was 96.15% (50/52), higher than the 82.69% (43/52) of the control group, and the difference was statistically significant ( χ2=4.92, P=0.026). Conclusion:Compared with the traditional small incision of peripheral to central pruning method and the traditional small incision of apocrine sweat glands method, the cure rate of the former is higher, which can effectively protect the skin flap dermis and subdermal vascular network around the incision, reduce postoperative skin necrosis and scar, and improve patient satisfaction.

Objective:To investigate the long-term safety and effectiveness of stent implantation for residual pulmonary artery stenosis after complicated congenital heart disease.Methods:The symptoms, signs, echocardiography, cardiac CT, cardiac catheterization, six-minute walking distance, and BNP of 41 patients diagnosed from January 1996 to January 2020. In this group, 41 patients, 30 males and 11 females, aged 1.3-14.5 years old, mean (6.1±3.6) years old, and weighed 8-43 kg, mean (18.9±9.4)kg, compared the diameter of the target vessel, pressure difference across stenosis, cardiac function before and postoperative follow-up, and evaluated the long-term effect of stent implantation in the treatment of pulmonary artery stenosis.Results:All 41 patients were not lost to follow-up, no death, and there were no serious adverse events such as stent fracture, artery dissection and pulmonary embolism during follow-up. The median follow-up time was 7.1 years (3.1 to 13.8 years). As of January 2023, the echocardiographic results showed that the diameter of the target vessels in 41 patients increased from preoperative (3.9±1.5) mm to (6.0±1.5) mm ( P<0.05), the pressure difference across the stenosis decreased from preoperative (51.4±19.1) mmHg to (33.1±19.7) mmHg (1 mmHg=0.133 kPa, P<0.05); Heart spiral CT showed that the ratio of target vessel diameter to distal vessel diameter increased from preoperative 0.4±0.2 to 0.9±0.3( P<0.05). All patients had no slow growth and development, no recurrent lung infection, 39 patients (95.1%) had gradeⅠcardiac function, and 2 patients (4.9%) had gradeⅡcardiac function.As children in school age, the walking distance of 6 min was 462 to 633 m, mean( 529.9±57.1)m, the respiratory score was 0.5-1, and the lower limb force score was 6-12. There were 5 long-term adverse events, including 4 cases of target vessel restenosis (9.7%), and 1 case (2.4%), two of the patients with restenosis with repeated target vessel stenosis and lateral pulmonary hypertension were surgically intervention: stent removing and pumonary expanding, after 4, 13 years of stent implantation.And the others were still in follow-up, and no further intervention was made. The Cox multivariate survival analysis suggested that right ventricular systolic blood pressure was a risk factor for endpoint events before stent implantation ( P<0.05). Conclusion:The treatment of residual pulmonary artery stenosis after complicated congenital heart disease after percutaneous stent implantation can effectively relieve the right heart pressure overload, improve pulmonary blood flow, stabilize cardiac function, improve the long-term prognosis of patients with complicated congenital heart disease, reduce the chest opening rate of reoperation, and have stable long-term curative effect.