1.The Establishment of a Virus-related Lymphoma Risk Warning System and Health Management Model Based on Traditional Chinese Medicine Conditions
Hanjing LI ; Shunan LI ; Zewei ZHUO ; Shunyong WANG ; Qiangqiang ZHENG ; Bingyu HUANG ; Yupeng YANG ; Chenxi QIU ; Ningning CHEN ; He WANG ; Tingbo LIU ; Haiying FU
Journal of Traditional Chinese Medicine 2025;66(4):335-339
Virus-related lymphoma exhibits a dual nature as both a hematologic malignancy and a viral infectious disease, making it more resistant to treatment and associated with poorer prognosis. This paper analyzes the understanding and therapeutic advantages of traditional Chinese medicine (TCM) in virus-related lymphoma. It proposes a TCM-based approach centered around syndrome differentiation, using standardized measurements of the overall TCM condition, multi-omics research of hematologic tumors, and artificial intelligence technologies to identify the "pre-condition" of virus-related lymphoma. A risk warning model will be established to early identify high-risk populations with viral infections that may develop into malignant lymphoma, thereby establishing a risk warning system for virus-related lymphoma. At the same time, a TCM health management approach will be applied to manage and regulate virus-related lymphoma, interrupting its progression and forming a human-centered, comprehensive, continuous health service model. Based on this, a standardized, integrated clinical prevention and treatment decision-making model for virus-related lymphoma, recognized by both Chinese and western medicine, will be established to provide TCM solutions for primary prevention of major malignant tumors.
2.Study on the distribution of traditional Chinese medicine syndromes and syndrome elements in lymphoma and the correlation between syndromes and Western medicine clinical indicators
Hanjing LI ; Shunan LI ; Zewei ZHUO ; Shunyong WANG ; Qiangqiang ZHENG ; Bingyu HUANG ; Yupeng YANG ; Chenxi QIU ; Ningning CHEN ; Yanyan QIU ; He WANG ; Tingbo LIU ; Haiying FU
Journal of Beijing University of Traditional Chinese Medicine 2025;48(1):127-137
Objective:
To investigate the distribution of traditional Chinese medicine (TCM) syndromes and syndrome elements in lymphoma, as well as the correlation between TCM syndromes and Western clinical indicators, in order to analyze associations between TCM syndromes and these indicators.
Methods:
From January 2023 to May 2024, 216 patients with lymphoma who met the inclusion criteria in the Department of Hematology, Third People′s Hospital Affiliated to Fujian University of Traditional Chinese Medicine were enrolled. Four diagnostic methods were applied to perform TCM syndrome differentiation and extract syndrome elements. The correlations between various syndromes and blood test indicators of lactate dehydrogenase (LDH), β2-microglobulin (β2-MG), immunoglobulin G (IgG), immunoglobulin M (IgM), immunoglobulin A (IgA), white blood cell (WBC), hemoglobin (Hb), platelet count (PLT), neutrophil (NEUT), immunohistochemical markers of B-cell lymphoma-6 (BCL6), B-cell lymphoma-2 (BCL2), proto-oncogene MYC, and Ki67 protein expression, Ann Arbor staging, international prognostic index (IPI) score, bone marrow infiltration, concurrent infections during chemotherapy, and post-chemotherapy bone marrow suppression rate were analyzed.
Results:
Five TCM syndromes, ranked by frequency, were syndromes of yin deficiency with phlegm accumulation(41.67%), qi depression with phlegm obstruction(30.56%), cold-phlegm congelation and stagnation(12.96%), phlegm-blood stasis toxin(12.04%), and lingering pathogen due to deficient vital qi(2.77%). Yin deficiency(50.93%) and phlegm(45.37%) were the more prevalent syndrome elements. The TCM syndromes were correlated with β2-MG, PLT, MYC, BCL2/MYC, Ki67 protein expression, and bone marrow infiltration (P<0.05). No statistically significant differences were observed in Ann Arbor staging or IPI score across the syndromes. Compared to the syndrome of cold-phlegm congelation and stagnation, the syndrome of qi depression with phlegm obstruction exhibited higher levels of NEUT, MYC, BCL2/MYC, and Ki67 protein expression, as well as a higher rate of post-chemotherapy bone marrow suppression (P<0.05); the syndrome of phlegm-blood stasis toxin showed higher MYC and BCL2/MYC protein expression and a higher rate of post-chemotherapy bone marrow suppression rate (P<0.05); the syndrome of yin deficiency with phlegm accumulation demonstrated higher MYC and BCL2/MYC protein expression and bone marrow infiltration rates, whereas PLT level was lower (P<0.05); the syndrome of lingering pathogen due to deficient vital qi had higher MYC, BCL2/MYC, and Ki67 protein expression levels, as well as a higher rate of post-chemotherapy bone marrow suppression rate (P<0.05). Compared to the syndrome of qi depression with phlegm obstruction, the syndrome of phlegm-blood stasis toxin exhibited lower Ki67 protein expression (P<0.05); the syndrome of yin deficiency with phlegm accumulation had higher β2-MG level, bone marrow infiltration rate, and rate of concurrent infections during chemotherapy, whereas PLT and NEUT levels and the rate of post-chemotherapy bone marrow suppression rate were lower (P<0.05). Compared to the syndrome of phlegm-blood stasis toxin, the syndrome of yin deficiency with phlegm accumulation had higher β2-MG level, whereas NEUT and the rate of post-chemotherapy bone marrow suppression were lower(P<0.05); the syndrome of lingering pathogen due to deficient vital qi exhibited a higher Ki67 protein expression (P<0.05). Compared to the syndrome of yin deficiency with phlegm accumulation, the syndrome of lingering pathogen due to deficient vital qi also showed a higher Ki67 protein expression(P<0.05).
Conclusion
The syndrome of yin deficiency with phlegm accumulation is relatively common in lymphoma. There is a correlation between TCM syndromes and Western medicine clinical indicators. The presence of heat signs in the syndromes may indicate active disease and poor prognosis, while the presence of strong pathogenic factors and weak vital qi in the syndromes may indicate a severer chemotherapy-related bone marrow suppression.
3.Comprehensive Application of AHP-CRITIC Hybrid Weighting Method, Grey Correlation Analysis and BP-ANN in Optimization of Extraction Process of Qizhi Prescription
Qun LAN ; Yi CHENG ; Zian LI ; Bingyu WU ; Jinyu WANG ; Dewen LIU ; Yan TONG
Chinese Journal of Experimental Traditional Medical Formulae 2025;31(8):176-186
ObjectiveBased on analytic hierarchy process(AHP)-criteria importance through intercriteria correlation(CRITIC) hybrid weighting method, grey relational analysis and backpropagation artificial neural network(BP-ANN), to optimize the water extraction process of Qizhi prescription, so as to provide an experimental basis for optimization of the preparation process of this prescription and the establishment of quality standards. MethodsL9(34) orthogonal test was employed, and the AHP-CRITIC hybrid weighting method was utilized to determine the weight coefficients of the quality fractions of various components, including astragaloside Ⅳ, polygalaxanthone Ⅲ, calycosin-7-O-β-D-glucoside, tenuifolin, and 3,6′-disinapoylsucrose, as well as the dry extract yield. The comprehensive score of each factor level combination in the orthogonal test were calculated as evaluation indicator to select the optimal extraction process parameters. The effects of extraction times, extraction time, and solvent dosage on the aqueous extraction process of the formula were investigated through intuitive analysis, variance analysis, and grey relational analysis. Meanwhile, a BP-ANN model was established to reverse-predict the optimal extraction process parameters of Qizhi prescription, and the optimized process parameters were validated. ResultsThe weight coefficients of the five index components(astragaloside Ⅳ, tenuifolin, calycosin-7-O-β-D-glucoside, polygalaxanthone Ⅲ, and 3,6′-disinapoylsucrose) and dry extract yield were 25.7%, 20.82%, 16.41%, 12.45%, 15.96% and 8.67%, respectively. The optimized extraction process parameters were extracted 3 times with 8, 6, 6 times the amount of water, each time for 1 h. The network prediction results of BP-ANN test samples were consistent with the orthogonal test results, and the mean square error(MSE) of the predicted and measured values of the network was <1%. The water extraction process of Qizhi prescription analyzed and predicted by relevant mathematical models was stable and feasible, which could effectively improve the extraction efficiency of the active ingredients of Astragali Radix and Polygalae Radix, and the average comprehensive score of the validation test was 90.85 with the relative standard deviation(RSD) of 1.55%. ConclusionThis study establishes a water extraction process for compound Qizhi granules, and the optimized extraction process can effectively improve the extraction efficiency of active ingredients, which provides useful references for the optimization of preparation process and the establishment of quality standards for other clinical experience formulas.
4.Detection of residual DNA in host cells of Escherichia coli in levodopa by Real-time PCR
Bingyu XU ; YAN LIU ; Xinyao GUO ; Fang YAN ; Guibin SUN
Journal of China Pharmaceutical University 2025;56(2):176-182
Using Real-time PCR technology, a highly specific and sensitive method for detecting DNA residues of Escherichia coli host cells in levodopa was established, validated, and preliminarily applied. Escherichia coli strain MB6 16S ribosomal RNA gene was selected as the target gene to design multiple pairs of primers and the target fragment by specific amplification of PCR was obtained. The target fragment was cloned into the pLENTI-BSD-CON vector and the recombinant plasmid was constructed and named pLENTI-BSD-CON-E.coli-16S. A quantitative PCR detection method (SYBR Green method) with magnetic bead extraction and purification methods was established with the reference standard of the recombinant plasmid. Furthermore, the established method was validated, including linear and range, accuracy, precision, specificity, and quantification limit, and applied to the detection of levodopa raw materials. Meanwhile, the detection method was compared with the Taqman probe method by the commercial kit. The primer sequences of the quantitative PCR detection method (SYBR Green method) were TTCGATGCAACGCGAAGAAC (forward) and GTGTAGCCCTGGTCGTAAGG (reverse). The standard curve of DNA was in the range of 10 fg/μL to 3 ng/μL with good linearity (R2≥ 0.98). The quantitative limit was 10 fg/μL. In addition, the detection recovery rate was in the range of 59.7% to 80.7%, with RSD at less than 15%. Nine batches of levodopa were detected by this method, and the amount of E.coli DNA residue was below the limit. The developed qPCR method can be used for quantitative detection of residual DNA in biological products produced by E.coli as host cells, such as levodopa . The results indicate that the sensitivity of the detection method for recombinant plasmid construction standards is superior than the reagent kit detection method.
5.Clinical efficacy and safety of intravenous colistin sulfate monotherapy versus combination with nebulized inhalation for pulmonary infections caused by carbapenem-resistant gram-negative bacilli: a multicenter retrospective cohort study.
Danyang PENG ; Fan ZHANG ; Ying LIU ; Yanqiu GAO ; Lanjuan XU ; Xiaohui LI ; Suping GUO ; Lihui WANG ; Lin GUO ; Yonghai FENG ; Chao QIN ; Huaibin HAN ; Xisheng ZHENG ; Faming HE ; Xiaozhao LI ; Bingyu QIN ; Huanzhang SHAO
Chinese Critical Care Medicine 2025;37(9):829-834
OBJECTIVE:
To compare the efficacy and safety of intravenous colistin sulfate combined with nebulized inhalation versus intravenous monotherapy for pulmonary infections caused by carbapenem-resistant organism (CRO).
METHODS:
A multicenter retrospective cohort study was conducted. Clinical data were collected from patients admitted to the intensive care unit (ICU) of 10 tertiary class-A hospitals in Henan Province between July 2021 and May 2023, who received colistin sulfate for CRO pulmonary infections. Data included baseline characteristics, inflammatory markers [white blood cell count (WBC), neutrophil count (NEU), procalcitonin (PCT), C-reactive protein (CRP)], renal function indicators [serum creatinine (SCr), blood urea nitrogen (BUN)], life support measures, anti-infection regimens, clinical efficacy, microbiological clearance rate, and prognostic outcomes. Patients were divided into two groups: intravenous group (colistin sulfate monotherapy via intravenous infusion) and combination group ((intravenous infusion combined with nebulized inhalation of colistin sulfate). Changes in parameters before and after treatment were analyzed.
RESULTS:
A total of 137 patients with CRO pulmonary infections were enrolled, including 89 in the intravenous group and 48 in the combination group. Baseline characteristics, life support measures, daily colistin dose, and combination regimens (most commonly colistin sulfate plus carbapenems in both groups) showed no significant differences between two groups. The combination group exhibited higher clinical efficacy [77.1% (37/48) vs. 59.6% (52/89)] and microbiological clearance rate [60.4% (29/48) vs. 39.3% (35/89)], both P < 0.05. Pre-treatment inflammatory and renal parameters showed no significant differences between two groups. Post-treatment, the combination group showed significantly lower WBC and CRP [WBC (×109/L): 8.2±0.5 vs. 10.9±0.6, CRP (mg/L): 14.0 (5.7, 26.6) vs. 52.1 (24.4, 109.6), both P < 0.05], whereas NEU, PCT, SCr, and BUN levels showed no significant between two groups. ICU length of stay was shorter in the combination group [days: 16 (10, 25) vs. 21 (14, 29), P < 0.05], although mechanical ventilation duration and total hospitalization showed no significant differences between two groups.
CONCLUSIONS
Intravenous colistin sulfate combined with nebulized inhalation improved clinical efficacy and microbiological clearance in CRO pulmonary infections with an acceptable safety profile.
Humans
;
Colistin/therapeutic use*
;
Retrospective Studies
;
Administration, Inhalation
;
Anti-Bacterial Agents/therapeutic use*
;
Carbapenems/pharmacology*
;
Male
;
Female
;
Middle Aged
;
Gram-Negative Bacteria/drug effects*
;
Aged
;
Treatment Outcome
;
Respiratory Tract Infections/drug therapy*
6.New tetrahydroanthraquinones and γ-butenolides from the fungus Auxarthron umbrinum DSM3193.
Ling TIAN ; Bingyu LIU ; Qian WEI ; Chen ZHANG ; Jiamin SHANG ; Xiaoxue LI ; Xiuying YANG ; Jinhua WANG ; Youcai HU
Chinese Journal of Natural Medicines (English Ed.) 2025;23(8):951-960
Nine novel compounds, comprising seven tetrahydroanthraquinones (auxarthrolones A-G, 1-7), a γ-butenolide glycoside (malfilamentoside E, 26), and a γ-butenolide (auxarthrolide A, 27), together with eighteen known compounds (8-25) were isolated from rice-based solid culture of Auxarthron umbrinum (A. umbrinum) DSM3193 using the one strain many compounds (OSMAC) approach. The structural elucidation of these compounds was accomplished through nuclear magnetic resonance (NMR), mass spectrometry (MS), and NMR calculation combined with DP4+ analysis or MAEΔΔδ parameter, while the absolute configurations of new compounds were established through single-crystal X-ray diffraction, electronic circular dichroism (ECD) spectroscopic data analysis and/or chemical derivatization. Austrocortilutein (10) and auxarthrol H (14) demonstrated moderate cytotoxicity against U87 and U251 [half maximal inhibitory concentration (IC50) 3.5-12.1 μmol·L-1]. Additionally, auxarthrolone A (1), auxarthrol H (14), eupolyphagin B (15), and 7-hydroxy-2-(2-hydroxypropyl)-5-methylchromone (17) exhibited torsional effects on fibroblast proliferation challenges induced by oleic acid, thus demonstrating fibroblast proliferation-promoting activity.
4-Butyrolactone/pharmacology*
;
Molecular Structure
;
Anthraquinones/pharmacology*
;
Humans
;
Animals
;
Mice
;
Cell Line, Tumor
;
Magnetic Resonance Spectroscopy
7.Study on the levels and potential mechanisms of degranulated basophils in the blood of patients with sepsis
Yuhan SUN ; Shengyong REN ; Mengmeng ZHAN ; Xin DONG ; Shihao LIU ; Congyi ZHAO ; Junling WANG ; Bingyu QIN
Chinese Journal of Emergency Medicine 2025;34(10):1373-1381
Objective:To compare the degranulation levels of basophils in peripheral blood mononuclear cell (PBMC) and granulocyte populations between healthy subjects and patients with sepsis, and to explore the underlying mechanisms. Additionally, plasma cytokine levels were measured in these volunteers.Methods:Peripheral blood samples were collected from both healthy individuals and sepsis patients. The degranulation level of basophils in sepsis patients and its potential mechanisms were examined. Plasma levels of IL-1β, IL-9, and IL-10 were detected, and Pearson correlation analysis was performed to assess the relationship between degranulated basophils in the granulocyte population and IL-9 levels.Results:Compared with healthy subjects, sepsis patients showed a reduction in basophil percentages within PBMC and granulocyte populations by 94.8% and 37.9%, respectively ( Z = -6.441, P < 0.05; Z = -2.681, P < 0.05). In contrast, both the proportion and number of degranulated basophils in the granulocyte population were increased (both P < 0.05). Plasma levels of IL-1β, IL-9, and IL-10 were significantly elevated in sepsis patients--by 80.6%, 36.7%, and 11.9-fold, respectively ( Z = -4.258, P < 0.05; Z = -3.606, P < 0.05; Z = -4.814, P < 0.05). Moreover, plasma IL-9 levels were highly correlated with both the percentage and count of degranulated basophils in the granulocyte population (both P < 0.05). GO and KEGG enrichment analyses revealed cytological changes and potential mechanisms involving basophils in the PBMC of sepsis patients. Conclusions:The decreased total count of basophils in sepsis patients may elevate the risk of secondary infection. Degranulated basophils in the granulocyte population may contribute to excessive inflammatory responses through IL-9 secretion.
8.Sulodexide inhibits neointimal hyperplasia of arteriovenous fistulas in rats through inactivation of YAP
Yaxin LI ; Bingyu LI ; Xin LIN ; Xuan LIU ; Chenglin DAI ; Yu ZHAO ; Qining FU ; Yun WANG
Journal of Army Medical University 2024;46(12):1403-1409
Objective To explore the role of sulodexide(SDX)in neointimal hyperplasia of arteriovenous fistulas(AVFs)in chronic kidney disease(CKD)rats and its possible mechanism.Methods A total of 18 male rats(weighing 300±50 g)were randomly and equally divided into AVF group,CKD+AVF group(CKD induction followed by AVF surgery and then gavaged with normal saline for 2 months),and CKD+AVF+SDX group[treated as in the CKD+AVF group but with 8 mg/(kg·d)SDX gavage].HE staining was used to observe the degree of neointimal hyperplasia.The expression of Hippo pathway related molecules,Yes-associated protein(YAP),pYAP and connective tissue growth factor(CTGF,YAP downstream target protein,one of mesenchymal marker)was detected by immunofluorescence assay.After human umbilical vein cell fusion EAHy926 cells were treated with 0,2.5,5,10,20 or 40 μg/mL SDX for 24 h,and with 2.5 μg/mL SDXfor24,48 or 72 h,respectively,CCK-8 assay was used to measure cell survival rate.Moreover,the serum sample from CKD rat was used to treat EAHy926 cells,and then the cells were treated with SDX or YAP inhibitor verteporfin.The expression levels of YAP,pYAP,CTGF and endothelial cell marker CD31 were detected by Western blotting.Results HE staining and immunofluorescence assay showed that CKD rats had serious neointimal hyperplasia in AVFs(P<0.05),and slightly lower expression of pYAP and enhanced expression of CTGF(P<0.05)when compared with the rats of the AVF group.While,SDX treatment alleviated the neointimal hyperplasia of AVFs,enhanced the expression of pYAP and reduced the expression of CTGF(P<0.05).CCK-8 assay showed that cell survival rate was decreased significantly in a dose-and time-dependent manner after SDX treatment(P<0.05).Western blotting revealed that SDX increased the expression of pYAP and CD31 while inhibited the expression of CTGF in EAHy926 cells(P<0.05),which was consistent with the effect of verteporfin treatment.Conclusion SDX can block YAP activation caused by CKD and attenuate neointimal hyperplasia in AVFs.
9.Chinese expert consensus on blood support mode and blood transfusion strategies for emergency treatment of severe trauma patients (version 2024)
Yao LU ; Yang LI ; Leiying ZHANG ; Hao TANG ; Huidan JING ; Yaoli WANG ; Xiangzhi JIA ; Li BA ; Maohong BIAN ; Dan CAI ; Hui CAI ; Xiaohong CAI ; Zhanshan ZHA ; Bingyu CHEN ; Daqing CHEN ; Feng CHEN ; Guoan CHEN ; Haiming CHEN ; Jing CHEN ; Min CHEN ; Qing CHEN ; Shu CHEN ; Xi CHEN ; Jinfeng CHENG ; Xiaoling CHU ; Hongwang CUI ; Xin CUI ; Zhen DA ; Ying DAI ; Surong DENG ; Weiqun DONG ; Weimin FAN ; Ke FENG ; Danhui FU ; Yongshui FU ; Qi FU ; Xuemei FU ; Jia GAN ; Xinyu GAN ; Wei GAO ; Huaizheng GONG ; Rong GUI ; Geng GUO ; Ning HAN ; Yiwen HAO ; Wubing HE ; Qiang HONG ; Ruiqin HOU ; Wei HOU ; Jie HU ; Peiyang HU ; Xi HU ; Xiaoyu HU ; Guangbin HUANG ; Jie HUANG ; Xiangyan HUANG ; Yuanshuai HUANG ; Shouyong HUN ; Xuebing JIANG ; Ping JIN ; Dong LAI ; Aiping LE ; Hongmei LI ; Bijuan LI ; Cuiying LI ; Daihong LI ; Haihong LI ; He LI ; Hui LI ; Jianping LI ; Ning LI ; Xiying LI ; Xiangmin LI ; Xiaofei LI ; Xiaojuan LI ; Zhiqiang LI ; Zhongjun LI ; Zunyan LI ; Huaqin LIANG ; Xiaohua LIANG ; Dongfa LIAO ; Qun LIAO ; Yan LIAO ; Jiajin LIN ; Chunxia LIU ; Fenghua LIU ; Peixian LIU ; Tiemei LIU ; Xiaoxin LIU ; Zhiwei LIU ; Zhongdi LIU ; Hua LU ; Jianfeng LUAN ; Jianjun LUO ; Qun LUO ; Dingfeng LYU ; Qi LYU ; Xianping LYU ; Aijun MA ; Liqiang MA ; Shuxuan MA ; Xainjun MA ; Xiaogang MA ; Xiaoli MA ; Guoqing MAO ; Shijie MU ; Shaolin NIE ; Shujuan OUYANG ; Xilin OUYANG ; Chunqiu PAN ; Jian PAN ; Xiaohua PAN ; Lei PENG ; Tao PENG ; Baohua QIAN ; Shu QIAO ; Li QIN ; Ying REN ; Zhaoqi REN ; Ruiming RONG ; Changshan SU ; Mingwei SUN ; Wenwu SUN ; Zhenwei SUN ; Haiping TANG ; Xiaofeng TANG ; Changjiu TANG ; Cuihua TAO ; Zhibin TIAN ; Juan WANG ; Baoyan WANG ; Chunyan WANG ; Gefei WANG ; Haiyan WANG ; Hongjie WANG ; Peng WANG ; Pengli WANG ; Qiushi WANG ; Xiaoning WANG ; Xinhua WANG ; Xuefeng WANG ; Yong WANG ; Yongjun WANG ; Yuanjie WANG ; Zhihua WANG ; Shaojun WEI ; Yaming WEI ; Jianbo WEN ; Jun WEN ; Jiang WU ; Jufeng WU ; Aijun XIA ; Fei XIA ; Rong XIA ; Jue XIE ; Yanchao XING ; Yan XIONG ; Feng XU ; Yongzhu XU ; Yongan XU ; Yonghe YAN ; Beizhan YAN ; Jiang YANG ; Jiangcun YANG ; Jun YANG ; Xinwen YANG ; Yongyi YANG ; Chunyan YAO ; Mingliang YE ; Changlin YIN ; Ming YIN ; Wen YIN ; Lianling YU ; Shuhong YU ; Zebo YU ; Yigang YU ; Anyong YU ; Hong YUAN ; Yi YUAN ; Chan ZHANG ; Jinjun ZHANG ; Jun ZHANG ; Kai ZHANG ; Leibing ZHANG ; Quan ZHANG ; Rongjiang ZHANG ; Sanming ZHANG ; Shengji ZHANG ; Shuo ZHANG ; Wei ZHANG ; Weidong ZHANG ; Xi ZHANG ; Xingwen ZHANG ; Guixi ZHANG ; Xiaojun ZHANG ; Guoqing ZHAO ; Jianpeng ZHAO ; Shuming ZHAO ; Beibei ZHENG ; Shangen ZHENG ; Huayou ZHOU ; Jicheng ZHOU ; Lihong ZHOU ; Mou ZHOU ; Xiaoyu ZHOU ; Xuelian ZHOU ; Yuan ZHOU ; Zheng ZHOU ; Zuhuang ZHOU ; Haiyan ZHU ; Peiyuan ZHU ; Changju ZHU ; Lili ZHU ; Zhengguo WANG ; Jianxin JIANG ; Deqing WANG ; Jiongcai LAN ; Quanli WANG ; Yang YU ; Lianyang ZHANG ; Aiqing WEN
Chinese Journal of Trauma 2024;40(10):865-881
Patients with severe trauma require an extremely timely treatment and transfusion plays an irreplaceable role in the emergency treatment of such patients. An increasing number of evidence-based medicinal evidences and clinical practices suggest that patients with severe traumatic bleeding benefit from early transfusion of low-titer group O whole blood or hemostatic resuscitation with red blood cells, plasma and platelet of a balanced ratio. However, the current domestic mode of blood supply cannot fully meet the requirements of timely and effective blood transfusion for emergency treatment of patients with severe trauma in clinical practice. In order to solve the key problems in blood supply and blood transfusion strategies for emergency treatment of severe trauma, Branch of Clinical Transfusion Medicine of Chinese Medical Association, Group for Trauma Emergency Care and Multiple Injuries of Trauma Branch of Chinese Medical Association, Young Scholar Group of Disaster Medicine Branch of Chinese Medical Association organized domestic experts of blood transfusion medicine and trauma treatment to jointly formulate Chinese expert consensus on blood support mode and blood transfusion strategies for emergency treatment of severe trauma patients ( version 2024). Based on the evidence-based medical evidence and Delphi method of expert consultation and voting, 10 recommendations were put forward from two aspects of blood support mode and transfusion strategies, aiming to provide a reference for transfusion resuscitation in the emergency treatment of severe trauma and further improve the success rate of treatment of patients with severe trauma.
10.Analysis of Brain Absorption Components and Their Distribution of Tianyuan Zhitong Prescription Based on UPLC-Q-TOF-MS and DESI-MSI
Yi CHENG ; Qun LAN ; Bingyu WU ; Jinyu WANG ; Dewen LIU ; Yan TONG
Chinese Journal of Experimental Traditional Medical Formulae 2024;30(12):166-172
ObjectiveTo investigate the brain absorption components of Tianyuan Zhitong prescription and their distribution based on ultra-high performance liquid chromatography-quadrupole-time-of-flight mass spectrometry(UPLC-Q-TOF-MS), desorption electrospray ionization mass spectrometry imaging(DESI-MSI) and hyperspectral imaging techniques. MethodTen BALB/c mice were randomly divided into blank group(n=3) and administration group(n=7), the administration group was gavaged with 0.3 mL of Tianyuan Zhitong prescription liquid at a concentration of about 5 g·mL-1 of the raw material, and the blank group was gavaged with an equal volume of normal saline, and the whole brain of the mice were taken for the preparation of tissue homogenates and frozen sections, respectively. The tissue homogenates were qualitatively analyzed by UPLC-Q-TOF-MS for the brain absorption components in positive and negative ion modes, frozen sections were used for imaging to observe the distribution of these components in the brain. Cytoviva dark-field enhancement microscope was used to perform hyperspectral imaging scanning on the brain sections of mice from each group, and the scattered light data of at least 1 000 pixels in the visible-near-infrared(400-1 000 nm) band in the microscopic field of view were collected and average spectrum were created, which were used to compare the components in the brain tissues of mice from the blank and administration groups. ResultA total of 27 brain absorption components of Tianyuan Zhitong prescription were identified by UPLC-Q-TOF-MS, including 10 organic acids, 5 glycosides, 4 alkaloids, 1 phenol, 4 flavonoids, 2 phthalides and 1 other compound, which were mainly derived from Gastrodiae Rhizoma, Chuanxiong Rhizoma, vinegar-processed Corydalis Rhizoma, Ziziphi Spinosae Semen and processed Morindae Officinalis Radix. A total of 14 components were identified by mass spectrometry imaging, of which ferulic acid, tetrahydropalmatine and N-methyl dehydroberberine were mainly distributed in the cerebral cortex, vitamin B5, vemonoic acid and ricinoleic acid were mainly distributed in the hypothalamus, elemicin, octadecenic acid and octadecanoic acid were mainly distributed in the cortex and hypothalamus, while senkyunolide B, ligustilide, linoleic acid, 9,12-octadecadienoyl ethyl ester and spinosin were distributed in most regions of the brain tissues. Hyperspectral imaging showed that in the visible-near-infrared band range, the average spectrum of the brain tissues of mice in the administration group was significantly red-shifted, indicating that there were differences in the physical properties or contents of the chemical components in the brain between mice in the blank group and those in the administration group, and further verified the results of mass spectrometry imaging. ConclusionThrough the combination of UPLC-Q-TOF-MS and imaging techniques, the pharmacodynamic components of Tianyuan Zhitong prescription in the treatment of headache and the regional characteristics in brain tissue are clarified, which can provide reference for the selection of the index components of the research on the quality standard of this prescription and the research on the mechanism of the pharmacological effect.


Result Analysis
Print
Save
E-mail