Using Real-time PCR technology, a highly specific and sensitive method for detecting DNA residues of Escherichia coli host cells in levodopa was established, validated, and preliminarily applied. Escherichia coli strain MB6 16S ribosomal RNA gene was selected as the target gene to design multiple pairs of primers and the target fragment by specific amplification of PCR was obtained. The target fragment was cloned into the pLENTI-BSD-CON vector and the recombinant plasmid was constructed and named pLENTI-BSD-CON-E.coli-16S. A quantitative PCR detection method (SYBR Green method) with magnetic bead extraction and purification methods was established with the reference standard of the recombinant plasmid. Furthermore, the established method was validated, including linear and range, accuracy, precision, specificity, and quantification limit, and applied to the detection of levodopa raw materials. Meanwhile, the detection method was compared with the Taqman probe method by the commercial kit. The primer sequences of the quantitative PCR detection method (SYBR Green method) were TTCGATGCAACGCGAAGAAC (forward) and GTGTAGCCCTGGTCGTAAGG (reverse). The standard curve of DNA was in the range of 10 fg/μL to 3 ng/μL with good linearity (R2≥ 0.98). The quantitative limit was 10 fg/μL. In addition, the detection recovery rate was in the range of 59.7% to 80.7%, with RSD at less than 15%. Nine batches of levodopa were detected by this method, and the amount of E.coli DNA residue was below the limit. The developed qPCR method can be used for quantitative detection of residual DNA in biological products produced by E.coli as host cells, such as levodopa . The results indicate that the sensitivity of the detection method for recombinant plasmid construction standards is superior than the reagent kit detection method.

OBJECTIVE: To compare the efficacy and safety of intravenous colistin sulfate combined with nebulized inhalation versus intravenous monotherapy for pulmonary infections caused by carbapenem-resistant organism (CRO). METHODS: A multicenter retrospective cohort study was conducted. Clinical data were collected from patients admitted to the intensive care unit (ICU) of 10 tertiary class-A hospitals in Henan Province between July 2021 and May 2023, who received colistin sulfate for CRO pulmonary infections. Data included baseline characteristics, inflammatory markers [white blood cell count (WBC), neutrophil count (NEU), procalcitonin (PCT), C-reactive protein (CRP)], renal function indicators [serum creatinine (SCr), blood urea nitrogen (BUN)], life support measures, anti-infection regimens, clinical efficacy, microbiological clearance rate, and prognostic outcomes. Patients were divided into two groups: intravenous group (colistin sulfate monotherapy via intravenous infusion) and combination group ((intravenous infusion combined with nebulized inhalation of colistin sulfate). Changes in parameters before and after treatment were analyzed. RESULTS: A total of 137 patients with CRO pulmonary infections were enrolled, including 89 in the intravenous group and 48 in the combination group. Baseline characteristics, life support measures, daily colistin dose, and combination regimens (most commonly colistin sulfate plus carbapenems in both groups) showed no significant differences between two groups. The combination group exhibited higher clinical efficacy [77.1% (37/48) vs. 59.6% (52/89)] and microbiological clearance rate [60.4% (29/48) vs. 39.3% (35/89)], both P < 0.05. Pre-treatment inflammatory and renal parameters showed no significant differences between two groups. Post-treatment, the combination group showed significantly lower WBC and CRP [WBC (×10⁹/L): 8.2±0.5 vs. 10.9±0.6, CRP (mg/L): 14.0 (5.7, 26.6) vs. 52.1 (24.4, 109.6), both P < 0.05], whereas NEU, PCT, SCr, and BUN levels showed no significant between two groups. ICU length of stay was shorter in the combination group [days: 16 (10, 25) vs. 21 (14, 29), P < 0.05], although mechanical ventilation duration and total hospitalization showed no significant differences between two groups. CONCLUSIONS Intravenous colistin sulfate combined with nebulized inhalation improved clinical efficacy and microbiological clearance in CRO pulmonary infections with an acceptable safety profile.
Humans ; Colistin/therapeutic use* ; Retrospective Studies ; Administration, Inhalation ; Anti-Bacterial Agents/therapeutic use* ; Carbapenems/pharmacology* ; Male ; Female ; Middle Aged ; Gram-Negative Bacteria/drug effects* ; Aged ; Treatment Outcome ; Respiratory Tract Infections/drug therapy*

Patients with severe trauma require an extremely timely treatment and transfusion plays an irreplaceable role in the emergency treatment of such patients. An increasing number of evidence-based medicinal evidences and clinical practices suggest that patients with severe traumatic bleeding benefit from early transfusion of low-titer group O whole blood or hemostatic resuscitation with red blood cells, plasma and platelet of a balanced ratio. However, the current domestic mode of blood supply cannot fully meet the requirements of timely and effective blood transfusion for emergency treatment of patients with severe trauma in clinical practice. In order to solve the key problems in blood supply and blood transfusion strategies for emergency treatment of severe trauma, Branch of Clinical Transfusion Medicine of Chinese Medical Association, Group for Trauma Emergency Care and Multiple Injuries of Trauma Branch of Chinese Medical Association, Young Scholar Group of Disaster Medicine Branch of Chinese Medical Association organized domestic experts of blood transfusion medicine and trauma treatment to jointly formulate Chinese expert consensus on blood support mode and blood transfusion strategies for emergency treatment of severe trauma patients ( version 2024). Based on the evidence-based medical evidence and Delphi method of expert consultation and voting, 10 recommendations were put forward from two aspects of blood support mode and transfusion strategies, aiming to provide a reference for transfusion resuscitation in the emergency treatment of severe trauma and further improve the success rate of treatment of patients with severe trauma.

Objective:To investigate the effects of continuous renal replacement therapy (CRRT) on plasma concentration, clinical efficacy and safety of colistin sulfate.Methods:Clinical data of patients received with colistin sulfate were retrospectively analyzed from our group's previous clinical registration study, which was a prospective, multicenter observation study on the efficacy and pharmacokinetic characteristics of colistin sulfate in patients with severe infection in intensive care unit (ICU). According to whether patients received blood purification treatment, they were divided into CRRT group and non-CRRT group. Baseline data (gender, age, whether complicated with diabetes, chronic nervous system disease, etc), general data (infection of pathogens and sites, steady-state trough concentration, steady-state peak concentration, clinical efficacy, 28-day all-cause mortality, etc) and adverse event (renal injury, nervous system, skin pigmentation, etc) were collected from the two groups.Results:A total of 90 patients were enrolled, including 22 patients in the CRRT group and 68 patients in the non-CRRT group. ① There was no significant difference in gender, age, basic diseases, liver function, infection of pathogens and sites, colistin sulfate dose between the two groups. Compared with the non-CRRT group, the acute physiology and chronic health evaluation Ⅱ (APACHE Ⅱ) and sequential organ failure assessment (SOFA) were higher in the CRRT group [APACHE Ⅱ: 21.77±8.26 vs. 18.01±6.34, P < 0.05; SOFA: 8.5 (7.8, 11.0) vs. 6.0 (4.0, 9.0), P < 0.01], serum creatinine level was higher [μmol/L: 162.0 (119.5, 210.5) vs. 72.0 (52.0, 117.0), P < 0.01]. ② Plasma concentration: there was no significant difference in steady-state trough concentration between CRRT group and non-CRRT group (mg/L: 0.58±0.30 vs. 0.64±0.25, P = 0.328), nor was there significant difference in steady-state peak concentration (mg/L: 1.02±0.37 vs. 1.18±0.45, P = 0.133). ③ Clinical efficacy: there was no significant difference in clinical response rate between CRRT group and non-CRRT group [68.2% (15/22) vs. 80.9% (55/68), P = 0.213]. ④ Safety: acute kidney injury occurred in 2 patients (2.9%) in the non-CRRT group. No obvious neurological symptoms and skin pigmentation were found in the two groups. Conclusions:CRRT had little effect on the elimination of colistin sulfate. Routine blood concentration monitoring (TDM) is warranted in patients received with CRRT.

Objective:To investigate the expression and effect of microRNA-205 (miR-205) in hypertrophic scar.Methods:The experimental research method were applied. From October 2019 to January 2020, hypertrophic scar tissue from 6 patients with hypertrophic scar [1 male and 5 females, aged (36±7) years], and remaining normal skin tissue from 6 trauma patients [2 males and 4 females, aged (38±9) years] after flap transplantation operation were collected. The above-mentioned 12 patients were admitted to the General Hospital of Northern Theater Command and met the inclusion criteria. Real time fluorescent quantitative polymerase chain reaction was used to detect the mRNA expressions of miR-205 and thrombospondin-1 (TSP-1). The hypertrophic scar tissue was taken to culture the 3rd to 5th passage of fibroblasts (Fbs) for the follow-up experiments. Fbs of hypertrophic scar was divided into TSP-1+miR-205 control group, TSP-1+miR-205 mimic group, TSP-1 mutant+miR-205 control group, TSP-1 mutant +miR-205 mimic group, which were transfected with the corresponding sequences. At 48 h after transfection, the expressions of luciferase and renal luciferase were detected by luciferase reporter gene detection kit, and the luciferase/renal luciferase ratio was calculated to indicate the activity of TSP-1. Two batches of hypertrophic scar Fbs were collected and divided into miR-205 control group, miR-205 mimic group, and miR-205 inhibitor group and miR-205 control group, miR-205 mimic group, and miR-205 mimic+TSP-1 group, respectively, which were transfected with the corresponding sequences. At 0 (immediately), 12, 24, 36, and 48 h after transfection, the cell viability was detected by microplate reader. Two batches of hypertrophic scar Fbs were collected, grouped, and treated as the cell viability detecting experiment. At 24 h after transfection, Hoechst 33258 staining was performed to observe the nuclear shrinkage, so as to reflect the apoptosis of Fbs. The number of samples in cell experiment was 3. Data were statistically analyzed with analysis of variance for factorial design, one-way analysis of variance, and t test.Results:The mRNA expression of miR-205 in hypertrophic scar tissue was 0.54±0.05, which was significantly lower than 1.26±0.07 in normal skin tissue (t=8.213, P<0.01). The expression of TSP-1 mRNA in hypertrophic scar tissue was 1.46±0.07, which was significantly higher than 0.68±0.11 in normal skin tissue (t=6.031, P<0.01). At 48 h after transfection, the luciferase/renal luciferase ratio reflecting the TSP-1 activity of cells in TSP-1+miR-205 mimic group was 0.532±0.028, which was significantly lower than 0.998±0.012 in TSP-1+miR-205 control group (t=26.500, P<0.01), and the luciferase/renal luciferase ratio of cells in TSP-1 mutant+miR-205 mimic group was 0.963±0.012, which was close to 0.976±0.010 in TSP-1 mutant+miR-205 control group (t=0.816, P>0.05). At 12, 24, 36, and 48 h after transfection, the cell viability in miR-205 mimic group was significantly lower than that in miR-205 control group (t=6.169, 12.670, 27.130, 12.670, P<0.05 or P<0.01). At 0, 12, 24, 36, and 48 h after transfection, the cell viability in miR-205 inhibitor group was significantly higher than that in miR-205 control group (t=6.169, 7.221, 7.787, 7.835, 13.030, P<0.05 or P<0.01). At 12, 24, 36, and 48 h after transfection, the cell viability in miR-205 mimic group was significantly lower than that in miR-205 control group and miR-205 mimic+TSP-1 group (t=8.118, 26.970, 39.550, 42.490, 14.570, 12.240, 36.830, 45.220, P<0.05 or P<0.01). At 24 h after transfection, compared with miR-205 control group, the cell apoptosis in miR-205 mimic group was increased, and the cell apoptosis in miR-205 inhibitor group was decreased. At 24 h after transfection, compared with miR-205 mimic group, the cell apoptosis in miR-205 control group miR-205 mimic+TSP-1 group were decreased.Conclusions:miR-205 can inhibit the proliferation and promote the apoptosis of Fbs in hypertrophic scar by inhibiting the expression of TSP-1, which has the potential to be the therapeutic target for hypertrophic scar.

Objective:To investigate the expression and effect of microRNA-205 (miR-205) in human hypertrophic scar.Methods:The experimental research method was applied. From October 2019 to January 2020, hypertrophic scar tissue from 6 patients with hypertrophic scar (1 male and 5 females, aged (36±7) years) and remaining normal skin tissue from 6 trauma patients (2 males and 4 females, aged (38±9) years) after flap transplantation operation were collected. The above-mentioned 12 patients were admitted to the General Hospital of Northern Theater Command and met the inclusion criteria. Real-time fluorescent quantitative reverse transcription polymerase chain reaction was used to detect the mRNA expressions of miR-205 and thrombospondin-1 (TSP-1). The hypertrophic scar tissue was taken to culture the 3rd to 5th passage of fibroblasts (Fbs) for the follow-up experiments. Two batches of hypertrophic scar Fbs were divided into TSP-1+ miR-205 control group, TSP-1+ miR-205 mimic group, and TSP-1 mutant+ miR-205 control group, TSP-1 mutant+ miR-205 mimic group, which were transfected with the corresponding sequences. At 48 h after transfection, the expressions of luciferase and renal luciferase were detected by luciferase reporter gene detection kit, and the luciferase/renal luciferase ratio was calculated to indicate the activity of TSP-1. Two batches of hypertrophic scar Fbs were collected and divided into miR-205 control group, miR-205 mimic group, and miR-205 inhibitor group and miR-205 control group, miR-205 mimic group, and miR-205 mimic+ TSP-1 group, respectively, which were transfected with the corresponding sequences. At 0 (immediately), 12, 24, 36, and 48 h after transfection, the cell viability was detected by microplate reader. Two batches of hypertrophic scar Fbs were grouped and treated as described in the cell viability detecting experiment. At 24 h after transfection, Hoechst 33258 staining was performed to observe the nuclear shrinkage, so as to reflect the apoptosis of Fbs. The number of samples in cell experiment was three. Data were statistically analyzed with analysis of variance for factorial design, one-way analysis of variance, t test, and chi-square test. Results:The mRNA expression of miR-205 in hypertrophic scar tissue was 0.54±0.05, which was significantly lower than 1.26±0.07 in normal skin tissue ( t=8.213, P<0.01). The expression of TSP-1 mRNA in hypertrophic scar tissue was 1.46±0.07, which was significantly higher than 0.68±0.11 in normal skin tissue ( t=6.031, P<0.01). At 48 h after transfection, the luciferase/renal luciferase ratio reflecting the TSP-1 activity of cells in TSP-1+ miR-205 mimic group was 0.532±0.028, which was significantly lower than 0.998±0.012 in TSP-1+ miR-205 control group ( t=26.500, P<0.01), and the luciferase/renal luciferase ratio of cells in TSP-1 mutant+ miR-205 mimic group was 0.963±0.012, which was close to 0.976±0.010 in TSP-1 mutant+ miR-205 control group ( t=0.816, P>0.05). At 12, 24, 36, and 48 h after transfection, the cell viability in miR-205 mimic group was significantly lower than that in miR-205 control group ( t=6.169, 12.670, 27.130, 12.670, P<0.05 or P<0.01). At 0, 12, 24, 36, and 48 h after transfection, the cell viability in miR-205 inhibitor group was significantly higher than that in miR-205 control group ( t=6.169, 7.221, 7.787, 7.835, 13.030, P<0.05 or P<0.01). At 12, 24, 36, and 48 h after transfection, the cell viability in miR-205 mimic group was significantly lower than that in miR-205 control group and miR-205 mimic+ TSP-1 group ( t=8.118, 26.970, 39.550, 42.490, 14.570, 12.240, 36.830, 45.220, P<0.05 or P<0.01). At 24 h after transfection, compared with miR-205 control group, the cell apoptosis in miR-205 mimic group was increased, and the cell apoptosis in miR-205 inhibitor group was decreased. At 24 h after transfection, compared with miR-205 mimic group, the cell apoptosis in miR-205 control group and miR-205 mimic+ TSP-1 group were decreased. Conclusions:miR-205 can inhibit the proliferation and promote the apoptosis of Fbs in human hypertrophic scar by inhibiting the expression of TSP-1, which has the potential to be a therapeutic target for hypertrophic scar.

Objective:To investigate the effects and mechanism of eleutheroside E on the growth of human hypertrophic scar fibroblasts (Fbs).Methods:The experimental research method was used. The hypertrophic scar tissue was collected from 6 patients with hypertrophic scar (1 male and 5 females, aged 20 to 51 (37±8) years) admitted to General Hospital of Northern Theater Command, from October 2018 to March 2019. The third to seventh passages of human hypertrophic scar Fbs were cultured for later experiments. Cells were divided into normal saline group, 100 μmol/L eleutheroside E group, 200 μmol/L eleutheroside E group, and 400 μmol/L eleutheroside E group, and normal saline, eleutheroside E at the final molarity of 100, 200, and 400 μmol/L were added to cells in the corresponding groups. Cells were collected and divided into small interfering RNA (siRNA)-negative control alone group, siRNA-thrombospondin 1 (THBS1) alone group, siRNA-negative control +400 μmol/L eleutheroside E group, and siRNA-THBS1 +400 μmol/L eleutheroside E group. Cells in siRNA-negative control alone group and siRNA-negative control +400 μmol/L eleutheroside E group were transfected with siRNA-negative control, cells in siRNA-THBS1 alone group and siRNA-THBS1 +400 μmol/L eleutheroside E group were transfected with siRNA-THBS1. At 24 h after transfection, cells in siRNA-negative control alone group and siRNA-THBS1 alone group were added with normal saline, and cells in siRNA-negative control +400 μmol/L eleutheroside E group and siRNA-THBS1 +400 μmol/L eleutheroside E group were added with eleutheroside E at the final molarity of 400 μmol/L. At 0 (immediately), 12, 24, 36, and 48 h after treatment, the cell proliferation activity (expressed as absorbance value) was detected by thiazolyl blue assay. Cells were divided into normal saline group, 200 μmol/L eleutheroside E group, 400 μmol/L eleutheroside E group, siRNA-negative control alone group, siRNA-THBS1 alone group, siRNA-negative control +400 μmol/L eleutheroside E group, and siRNA-THBS1 +400 μmol/L eleutheroside E group. The corresponding treatments in each group were the same as before. At 24 h after treatment, the apoptosis was observed by Hoechst 33258 staining. Cells were collected and divided into normal saline group, 100 μmol/L eleutheroside E group, 200 μmol/L eleutheroside E group, 400 μmol/L eleutheroside E group, siRNA-negative control alone group, siRNA-THBS1 alone group, siRNA-negative control +400 μmol/L eleutheroside E group, and siRNA-THBS1 +400 μmol/L eleutheroside E group. The corresponding treatments in each group were the same as before. At 24 h after treatment, the THBS1 protein level of cells was detected by Western blotting. The number of sample in each group was all 3 at each time point. Data were statistically analyzed with analysis of variance for factorial design, one-way analysis of variance, independent sample t test, and Bonferroni correction. Results:At 0 h after treatment, the absorbance values of cells in normal saline group, 100 μmol/L eleutheroside E group, 200 μmol/L eleutheroside E group, and 400 μmol/L eleutheroside E group were similar ( P>0.05). At 12, 24, 36, and 48 h after treatment, the absorbance values of cells in 100 μmol/L eleutheroside E group, 200 μmol/L eleutheroside E group, and 400 μmol/L eleutheroside E group were significantly lower than those of normal saline group ( t=7.64, 28.94, 13.69, 5.87, 6.96, 22.83, 14.75, 11.52, 21.09, 20.15, 29.52, 23.12, P<0.05 or P<0.01). At 0 h after treatment, the absorbance values of cells in siRNA-negative control alone group, siRNA-THBS1 alone group, siRNA-negative control +400 μmol/L eleutheroside E group, and siRNA-THBS1 +400 μmol/L eleutheroside E group were similar ( P>0.05). At 12, 24, 36, and 48 h after treatment, the absorbance values of cells in siRNA-THBS1 alone group and siRNA-negative control +400 μmol/L eleutheroside E group were significantly lower than those in siRNA-negative control alone group ( t=7.14, 44.87, 20.67, 40.98, 9.26, 11.08, 15.33, 20.56, P<0.05 or P<0.01); the absorbance values of cells in siRNA-THBS1 alone group, siRNA-negative control +400 μmol/L eleutheroside E group, and siRNA-THBS1 +400 μmol/L eleutheroside E group were similar ( P>0.05). Compared with that in normal saline group, the numbers of apoptotic cells in 200 μmol/L eleutheroside E group and 400 μmol/L eleutheroside E group were increased at 24 h after treatment. At 24 h after treatment, compared with that in siRNA-negative control alone group, the numbers of apoptotic cells in siRNA-THBS1 alone group and siRNA-negative control +400 μmol/L eleutheroside E group were increased, while the numbers of apoptotic cells in siRNA-THBS1 alone group, siRNA-negative control +400 μmol/L eleutheroside E group, and siRNA-THBS1 +400 μmol/L eleutheroside E group were similar. At 24 h after treatment, the protein levels of THBS1 of cells in 100 μmol/L eleutheroside E group, 200 μmol/L eleutheroside E group, and 400 μmol/L eleutheroside E group (0.87±0.12, 0.38±0.07, 0.20±0.09) were significantly lower than 1.83±0.17 in normal saline group ( t=16.61, 16.17, 17.29, P<0.01). At 24 h after treatment, the protein levels of THBS1 of cells in siRNA-THBS1 alone group and siRNA-negative control +400 μmol/L eleutheroside E group (0.61±0.07, 0.58±0.07) were significantly lower than 1.86±0.07 in siRNA-negative control alone group ( t=71.06, 83.80, P<0.01), and the protein levels of THBS1 of cells siRNA-THBS1 alone group, siRNA-negative control +400 μmol/L eleutheroside E group, and siRNA-THBS1 +400 μmol/L eleutheroside E group (0.63±0.11) were similar ( P>0.05). Conclusions:Eleutheroside E can inhibit the growth of human hypertrophic scar Fbs by down-regulating the expression of THBS1.

Objective:To investigate the expression and effect of microRNA-627 (miR-627) in human hypertrophic scar.Methods:The experimental research method was used. From October 2019 to January 2020, hypertrophic scar tissue from 6 patients with hypertrophic scar (2 males and 4 females, aged (34±11) years) and the remaining normal skin tissue from 6 trauma patients (3 males and 3 females, aged (35±13) years) after flap transplantation were collected. The above-mentioned 12 patients were admitted to the General Hospital of Northern Theater Command and met the inclusion criteria. The mRNA expression of miR-627 was detected by real-time fluorescent quantitative reverse transcription polymerase chain reaction. The 3rd to 5th passages of fibroblasts (Fbs) were isolated from hypertrophic scar tissue and cultured for subsequent experiments after identification. Fbs from hypertrophic scar were divided into miR-627 negative control group, miR-627 mimic group, and miR-627 inhibitor group. The corresponding sequences were transfected respectively. At 0 (immediately), 12, 24, 36, and 48 h after transfection, the cell viability was detected by thiazolyl blue method; at 24 h after transfection, the apoptosis was detected by flow cytometry; at 24 h after transfection, the protein expression levels of insulin-like growth factor Ⅰ (IGF-Ⅰ), type Ⅰ collagen, and α smooth muscle actin (α-SMA) were detected by Western blotting. Two batches of Fbs from hypertrophic scar were used, one batch was divided into IGF-Ⅰ wild type+miR-627 negative control group and IGF-Ⅰ wild type+miR-627 mimic group, and the other batch was divided into IGF-Ⅰ mutant+miR-627 negative control group and IGF-Ⅰ mutant+miR-627 mimic group. The corresponding sequences were transfected respectively. At 48 h after transfection, the expressions of luciferase and renal luciferase were detected by luciferase reporter gene detection kit, and the ratio of the two was calculated to reflect the activity of IGF-Ⅰ. Fbs from hypertrophic scar were divided into miR-627 negative control group, miR-627 mimic alone group, and miR-627 mimic+IGF-Ⅰ group, and were transfected with the corresponding sequences respectively. At 24 h after transfection, the protein expression levels of IGF-Ⅰ, type Ⅰ collagen, and α-SMA were detected by Western blotting. The number of samples in cell experiment was 3. Data were statistically analyzed with analysis of variance for factorial design, one-way analysis of variance, independent sample t test, and chi-square test. Results:The expression of miR-627 mRNA in hypertrophic scar tissue was 0.47±0.06, which was significantly lower than 1.12±0.23 in normal skin tissue ( t=15.090, P<0.01). At 12, 24, 36, and 48 hours after transfection, the cell viability of miR-627 mimic group was significantly lower than that of miR-627 negative control group ( t=9.918, 34.370, 13.580, 61.550, P<0.05 or P<0.01); the cell viability of miR-627 inhibitor group was significantly higher than that of miR-627 negative control group ( t=4.722, 8.616, 13.330, 14.000, P<0.05 or P<0.01). At 24 h after transfection, compared with the apoptosis rate (8.42±0.47)% in miR-627 negative control group, (10.89±0.35)% in miR-627 mimic group was significantly higher ( t=7.301, P<0.01), and (5.00±0.22)% in miR-627 inhibitor group was significantly lower ( t=11.510, P<0.01). At 24 h after transfection, compared with the cell protein expressions of IGF-Ⅰ, type Ⅰ collagen, and α-SMA in miR-627 negative control group, those in miR-627 mimic group were significantly lower ( t=25.470, 5.282, 7.415, P<0.01), and those in miR-627 inhibitor group were significantly higher ( t=15.930, 8.857, 9.763, P<0.01). At 48 h after transfection, the luciferase/renal luciferase ratio of IGF-Ⅰ of cells in IGF-Ⅰ wild type+miR-627 mimic group was 0.463±0.061, which was significantly lower than 0.999±0.011 in IGF-Ⅰ wild type+miR-627 negative control group ( t=16.852, P<0.01); the luciferase/renal luciferase ratio of IGF-Ⅰ of cells in IGF-Ⅰ mutant+miR-627 mimic group was 0.934±0.021, which was similar to 0.930±0.023 in IGF-Ⅰ mutant+miR-627 negative control group ( t=1.959, P>0.05). At 24 h after transfection, the protein expressions of IGF-Ⅰ, type Ⅰ collagen, and α-SMA of cells in miR-627 mimic alone group were 1.623±0.070, 1.363±0.042, and 1.617±0.025, which were significantly lower than 2.723±0.045, 2.147±0.067, and 2.533±0.055 in miR-627 negative control group ( t=22.831, 7.280, 26.220, P<0.01); the protein expressions of IGF-Ⅰ, type Ⅰ collagen, and α-SMA of cells in mimic+IGF-Ⅰ group were 2.477±0.102, 1.760±0.046, and 2.387±0.049, which were significantly higher than those of miR-627 mimic alone group ( t=3.830, 8.286, 3.436, P<0.05 or P<0.01). Conclusions:miR-627 expression in human hypertrophic scars is down-regulated; miR-627 can inhibit the proliferation and promote the apoptosis of Fbs in human hypertrophic scar by targeted inhibition of IGF-Ⅰ expression.

Objective:To investigate the expression of microRNA-296 (miR-296) in rabbit hypertrophic scars and its role in human fibroblasts (HFbs).Methods:The experimental method was used. Twelve healthy adult New Zealand long-eared rabbits regardless gender were randomly divided into normal control group and scar group, with 6 rabbits in each group. The rabbit ear hypertrophic scar model was created in scar group according to the literature, and the rabbits in normal control group did not receive any treatment. On 60 days after setting up the models in scar group, hematoxylin-eosin staining was performed to observe the growth and arrangement of fibroblasts (Fbs) in the ear scars and skin tissue of rabbits in the two groups. The mRNA expressions of miR-296 and transforming growth factor-β 1 (TGF-β 1) in ear scars and skin tissue of rabbits in the two groups were detected by real-time fluorescent quantitative reverse transcription polymerase chain reaction, and the correlation of mRNA between miR-296 and TGF-β 1 was performed with Pearson regression analysis. Two batches of HFbs were used and transfected respectively with corresponding sequences, with the 1st batch being divided into TGF-β 1 wild type+miR-296 negative control group and TGF-β 1 wild type+miR-296 mimic group and the 2nd batch being divided into TGF-β 1 mutant type+miR-296 negative control group and TGF-β 1 mutant type+miR-296 mimic group. At 48 h after transfection, luciferase reporter gene detection kit was used to detect the luciferase and renal luciferase expression of TGF-β 1 in the cells of each group, with their ratio being used to reflect the gene expression level. Two batches of HFbs were used, and each batch of cells were divided into miR-296 negative control group and miR-296 mimic group, being transfected with the corresponding sequences. At 0 (immediately), 12, 24, 36, and 48 h after transfecting the first batch of cells, the cell proliferation was detected by thiazolyl blue method. At 24 h after transfecting the second batch of cells, the expression of TGF-β 1 and collagen type Ⅰ was detected by Western blotting. The number of samples in cell experiments was 3. Data were statistically analyzed with analysis of variance for factorial design, independent sample t test. Results:On 60 days after setting up the models in scar group, the Fbs of rabbit ear scar tissue in scar group proliferated and arranged disorderly, while the growth and arrangement of Fbs in rabbit ear skin tissue in normal control group were normal. The mRNA expression of miR-296 of rabbit scar tissue in scar group (0.65±0.11) was significantly lower than 1.19±0.12 of rabbit ear skin tissue in normal control group ( t=5.175, P<0.01). The mRNA expression of TGF-β 1 of rabbit ear scar tissue in scar group (1.47±0.06) was significantly higher than 1.10±0.03 of rabbit ear skin tissue in normal control group ( t=12.410, P<0.01). Pearson regression analysis showed that there was a negative correlation between the mRNA expression of miR-296 and TGF-β 1 in the ear scars and skin tissue of 12 rabbits ( F=7.278, P<0.05). At 48 h after transfection, the gene expression of TGF-β 1 of cells in TGF-β 1 wild type+miR-296 mimic group was significantly lower than that in TGF-β 1 wild type+miR-296 negative control group ( t=35.190, P<0.01), while the gene expression of TGF-β 1 of cells in the two TGF-β 1 mutant type groups were close ( P>0.05). The HFbs proliferation ability in miR-296 mimic group was significantly lower than that in miR-296 negative control group at 12, 24, 36, and 48 h after transfection( t=3.275, 11.980, 10.460, 17.260, P<0.05 or P<0.01). At 24 h after transfection, the protein expressions of TGF-β 1 and type Ⅰ collagen of cells in miR-296 negative control group were significantly higher than those in miR-296 mimic group ( t=3.758, 29.390, P<0.05 or P<0.01). Conclusions:The miR-296 expression in rabbit hypertrophic scars is down-regulated; miR-296 can inhibit the proliferation of HFbs and the expression of type Ⅰ collagen by down regulating the expression of TGF-β 1.

Objective: To study the effect of miR-194-3p on the migration of keloid fibroblasts. Methods: Differentially expressed miRNA were screened by gene chip in 8 human keloid and normal tissues. The down regulated miR-194-3p was selected for study and its binding to RUNX2 was predicted by MiRDB, and verified by fluorescent reporter gene in human keloid fibroblasts (HKFs) and passage 3 keloid cells, respectively. The effect of miR-194-3p on the migration of fibroblasts was detected by transwell assay. Western blot and real-time PCR were used to analyze the effect of miR-194-3p on RUNX2 and MMP2 expression in HKFs. The results were analyzed by SPSS 19.0 software and compared by non-paired t test. P<0.05 was considered statistically significant. Results: There were abnormal expressions of miR-721, miR-21-3p, miR-382-3p, miR-194-3p, miR-3107-5p and miR-144-5p in keloid. miRDB software analysis showed that miR-194-3p and RUNX2 had targeted binding sites. Reporter gene experiments showed that miR-194-3p inhibited the activity of RUNX2 by about 50% compared with the control group (t=2.7764, P=0.0005). MiR-194-3p could significantly inhibit the expression of RUNX2 and MMP2, and inhibited the migration of keloid fibroblasts (t=2.7764, P<0.05). Conclusion MiR-194-3p may inhibit the migration of fibroblasts by inhibiting the activity of RUNX2 in keloid.