1.Expert consensus on surgical treatment and rehabilitation for competitive sports athletes returning to sports after anterior cruciate ligament injury (version 2025)
Kai HUANG ; Lunhao BAI ; Qing BI ; Hong CHEN ; Jiwu CHEN ; Xuesong DAI ; Wenyong FEI ; Weili FU ; Zhizeng GAO ; Lin GUO ; Yinghui HUA ; Jingmin HUANG ; Suizhu HUANG ; Xuan HUANG ; Jian LI ; Qiang LI ; Shuzhen LI ; Yanlin LI ; Yunxia LI ; Zhong LI ; Ning LIU ; Yuqiang LIU ; Wei LU ; Hongbin LYU ; Haile PAN ; Xiaoyun PAN ; Chao QI ; Weiliang SHEN ; Luning SUN ; Jin TANG ; Zimin WANG ; Bide WANG ; Ru WANG ; Shaobai WANG ; Licheng WEI ; Weidong XU ; Yongsheng XU ; Jizhou YANG ; Liang YANG ; Rui YANG ; Hongbo YOU ; Tengbo YU ; Jiakuo YU ; Bing YUE ; Hua ZHANG ; Hui ZHANG ; Qingsong ZHANG ; Xintao ZHANG ; Jiajun ZHAO ; Lilian ZHAO ; Qichun ZHAO ; Song ZHAO ; Jiapeng ZHENG ; Jiang ZHENG ; Zhi ZHENG ; Jingbin ZHOU ; Jinzhong ZHAO
Chinese Journal of Trauma 2025;41(4):325-338
With the rapid development of competitive sports, the incidence of anterior cruciate ligament (ACL) injury is on the rise. Such injuries may shorten athletes′ career and lead to other long-term adverse consequences. Although athletes generally recover well after ACL reconstruction, many still struggle to return to their pre-injury performance levels. Advances in the understanding of ACL anatomy and injury mechanisms, along with the evolution of surgical techniques and rehabilitation methods, have provided more individualized and tailored options for athletes following ACL injuries. However, there is currently no consensus in China regarding surgical and rehabilitation strategies for competitive athletes aiming to return to sports after ACL injuries. To this end, the Sports Medicine Committee of the Chinese Research Hospital Association and the Editorial Board of the Chinese Journal of Trauma jointly formulated the Expert consensus on surgical treatment and rehabilitation for competitive sports athletes returning to sports after anterior cruciate ligament injury ( version 2025), and presented 14 recommendations covering surgical indications, preoperative rehabilitation, surgical timing, surgical strategies and postoperative rehabilitation strategies, aiming to improve the surgical treatment and rehabilitation system for ACL injuries in competitive athletes and facilitate their return to high-level sports performance after injury.
2.Expert consensus on surgical treatment and rehabilitation for competitive sports athletes returning to sports after anterior cruciate ligament injury (version 2025)
Kai HUANG ; Lunhao BAI ; Qing BI ; Hong CHEN ; Jiwu CHEN ; Xuesong DAI ; Wenyong FEI ; Weili FU ; Zhizeng GAO ; Lin GUO ; Yinghui HUA ; Jingmin HUANG ; Suizhu HUANG ; Xuan HUANG ; Jian LI ; Qiang LI ; Shuzhen LI ; Yanlin LI ; Yunxia LI ; Zhong LI ; Ning LIU ; Yuqiang LIU ; Wei LU ; Hongbin LYU ; Haile PAN ; Xiaoyun PAN ; Chao QI ; Weiliang SHEN ; Luning SUN ; Jin TANG ; Zimin WANG ; Bide WANG ; Ru WANG ; Shaobai WANG ; Licheng WEI ; Weidong XU ; Yongsheng XU ; Jizhou YANG ; Liang YANG ; Rui YANG ; Hongbo YOU ; Tengbo YU ; Jiakuo YU ; Bing YUE ; Hua ZHANG ; Hui ZHANG ; Qingsong ZHANG ; Xintao ZHANG ; Jiajun ZHAO ; Lilian ZHAO ; Qichun ZHAO ; Song ZHAO ; Jiapeng ZHENG ; Jiang ZHENG ; Zhi ZHENG ; Jingbin ZHOU ; Jinzhong ZHAO
Chinese Journal of Trauma 2025;41(4):325-338
With the rapid development of competitive sports, the incidence of anterior cruciate ligament (ACL) injury is on the rise. Such injuries may shorten athletes′ career and lead to other long-term adverse consequences. Although athletes generally recover well after ACL reconstruction, many still struggle to return to their pre-injury performance levels. Advances in the understanding of ACL anatomy and injury mechanisms, along with the evolution of surgical techniques and rehabilitation methods, have provided more individualized and tailored options for athletes following ACL injuries. However, there is currently no consensus in China regarding surgical and rehabilitation strategies for competitive athletes aiming to return to sports after ACL injuries. To this end, the Sports Medicine Committee of the Chinese Research Hospital Association and the Editorial Board of the Chinese Journal of Trauma jointly formulated the Expert consensus on surgical treatment and rehabilitation for competitive sports athletes returning to sports after anterior cruciate ligament injury ( version 2025), and presented 14 recommendations covering surgical indications, preoperative rehabilitation, surgical timing, surgical strategies and postoperative rehabilitation strategies, aiming to improve the surgical treatment and rehabilitation system for ACL injuries in competitive athletes and facilitate their return to high-level sports performance after injury.
3.The Association between GLP-1 Receptor-Based Agonists and the Incidence of Asthma in Patients with Type 2 Diabetes and/or Obesity:A Meta-Analysis
Zhang MENGQING ; Lin CHU ; Cai XIAOLING ; Jiao RUOYANG ; Bai SHUZHEN ; Li ZONGLIN ; Hu SUIYUAN ; Lyu FANG ; Yang WENJIA ; Ji LINONG
Biomedical and Environmental Sciences 2024;37(6):607-616
Objective Recent studies have indicated potential anti-inflammatory effects of glucagon-like peptide-1 receptor agonists(GLP-1RAs)on asthma,which is often comorbid with type 2 diabetes mellitus(T2DM)and obesity.Therefore,we conducted a meta-analysis to assess the association between the administration of glucagon-like peptide-1(GLP-1)receptor-based agonists and the incidence of asthma in patients with T2DM and/or obesity. Methods PubMed,Web of Science,Embase,the Cochrane Central Register of Controlled Trials,and Clinicaltrial.gov were systematically searched from inception to July 2023.Randomized controlled trials(RCTs)of GLP-1 receptor-based agonists(GLP-1RA,GLP-1 based dual and triple receptor agonist)with reports of asthma events were included.Outcomes were computed as risk ratios(RR)using a fixed-effects model. Results Overall,39 RCTs with a total of 85,755 participants were included.Compared to non-GLP-1 receptor-based agonist users,a trend of reduced risk of asthma was observed in patients with T2DM or obesity using GLP-1 receptor-based agonist treatments,although the difference was not statistically significant[RR=0.91,95%confidence interval(CI):0.68 to 1.24].Further Subgroup analyses indicated that the use of light-molecular-weight GLP-1RAs might be associated with a reduced the risk of asthma when compared with non-users(RR=0.65,95%CI:0.43 to 0.99,P=0.043).We also performed sensitivity analyses for participant characteristics,study design,drug structure,duration of action,and drug subtypes.However,no significant associations were observed. Conclusion Compared with non-users,a modest reduction in the incidence of asthma was observed in patients with T2DM or obesity using GLP-1 receptor-based agonist treatments.Further investigations are warranted to assess the association between GLP-1 receptor-based agonists and the risk of asthma.
4.Prevalence of nonalcoholic fatty liver disease in workers of an automobile enterprise: the role of low-dose heavy metal exposure and related factors of the disease
Ting TANG ; Changqing ZHU ; Congxi QIU ; Yanru LI ; Shuzhen BAI ; Hanqing CHEN ; Huidong SONG
Journal of Environmental and Occupational Medicine 2024;41(10):1124-1129
Background Some studies have found that exposure to heavy metals significantly increases the risk of nonalcoholic fatty liver disease (NAFLD), and welding operators in automobile manufacturing enterprises are exposed to heavy metals in the working environment. Objective To analyze the prevalence and related factors of NAFLD in workers of an automobile company in Guangzhou. Methods From January 1 of 2023 to December 31 of 2023,
5.Bibliometric analysis on research about low-level occupational benzene exposure
Danping DUAN ; Shuzhen BAI ; Yingyin LIU ; Luxi BAI ; Jinmei LIANG ; Ling ZHU ; Lin CHEN ; Huidong SONG ; Xuemei CHEN ; Zhi WANG
China Occupational Medicine 2024;51(2):199-204
ObjectiveTo analyze the research status and trends in low-level occupational benzene exposure. Methods Articles on low-level occupational benzene exposure from Chinese and English journals from January 1st, 2000, to December 31th, 2022 were retrieved using the Web of Science and the China National Knowledge Infrastructure, and a bibliometric analysis was conducted. Results A total of 327 articles were included in the analysis, comprising 216 English articles and 111 Chinese articles. i) The number of articles published in English fluctuates greatly over the years, without a trend of continuous growth or decline. Authors from 359 research institutions in 45 countries and regions have published relevant English articles in 97 kinds of journals, involving 281 grants from 226 foundations. The top three countries in terms of articles amount were the United States, Italy, and China, with 81, 46, and 43 papers, respectively. The English articles mainly focused on mechanistic research at the genetic level, such as hematotoxicity, oxidative stress, and DNA damage. ii) The number of Chinese articles increased gradually after 2012, with the growth peak in 2017. Authors from 127 research institutions in 26 provinces, autonomous regions, and municipalities published Chinese articles in 51 kinds of journals, involving 154 grants from 78 foundations. Chinese articles tended to focus on benzene-induced hematotoxicity and occupational health damage. Conclusion Most studies on low-level occupational benzene exposure were conducted in China, the United States and Italy, focused on hematotoxicity. Monitoring international research topics and hotspots of the field has certain reference value for related research in China.
6.Phenotype and genotype analysis of progressive familial intrahepatic cholestasis type 4
Tingting YANG ; Shuzhen MA ; Ling LYU ; Yuan CHEN ; Ya′nan ZHANG ; Xinli BAI
Chinese Journal of Applied Clinical Pediatrics 2023;38(6):457-460
Objective:To improve the understanding of progressive familial intrahepatic cholestasis type 4 (PFIC4).Methods:Clinical characteristics in a 10-year-old boy with PFIC4 at the Second Hospital of Hebei Medical University in February 2020 were retrospectively analyzed, and the TJP2 gene mutations were analyzed. Results:The proband was a 10-year-old boy with a slow onset of intrahepatic cholestasis[normal γ-glutamyl transpeptidase(GGT)], hepatosplenomegaly and hepatic fibrosis.Laboratory tests showed elevated levels of total bilirubin, especially the direct bilirubin increased.Alanine aminotransferase, aspartate transaminase acid and total bile acid were elevated, while GGT remained in a normal range.Oral medication of ursodeoxycholic acid initially improved liver biochemical parameters, but later fluctuated.Adenosine dehydrogenase, coagulation indicators and hepatic fibrosis indexes were persistently abnormal.The average shear wave velocity of liver was 1.9 times of the upper limit of normal value.Compound heterozygous mutations c. 334G>A(p.A112T)/c.580_639delGACCGGAGCCGTGGCCGGAGCCTGGAGCGGGG-CCTGGACCAAGACCATGCGCGCACCCGA (p.194_213delDRSRGRSLERGLDQDHARTR) were found in the TJP2 gene.The deletion mutation of the TJP2 gene was reported for the first time throughout the world.Both of his parents carried a heterozygous mutation. Conclusions:PFIC should be considered in intrahepatic cholestasis patients with a normal range of GGT.The detection of TJP2 gene mutation is of great value in the clinical diagnosis of PFIC4.The presence of TJP2 gene mutation may be a risk factor for patient developing cirrhosis of liver and primary liver cancer in early childhood.It is necessary for children with PFIC4 to be closely followed up.
7. Chemical constituents of Lomatogonium carinthiacum and Halenia corniculata
Laxinamujila BAI ; Gang BAO ; Gang SUDABILIGE ; Gang CHAOGEBADALAFU ; Chenlin HE ; Chenlin QIRIGEER ; Laxinamujila BAI ; Shuzhen BAI
Chinese Herbal Medicines 2022;14(3):459-463
Objective: To study the chemical constituents from traditional Chinese (Mongolian) medicine, Lomatogonium carinthiacum and Halenia corniculate. Methods: The chemical constituents were isolated and purified by silicagel column, Sephadex LH-20, ODS and high performance liquid chromategramphy. The structures were identified by NMR and MS analysis technics. Results: Twelve compounds were isolated and identified as isovitexin (1), Luteolin-5-O-β-D-glucoside (2), Isosaponarin (3), Luteolin-7-O-β-D-glucoside (4,7), 1,4,8-Trimethoxy-xanthone-6-O-β-D-glucoronyl-(1 → 6)O-β-Dglucoside (5), friginosideD (6), 1-hydroxy-2,3,5-trimethoxyxanthone (8), 1-hydroxy-2,3,4,5-tetramethoxyxanthone (9), 1-hydroxy-2,3,4,7-tetramethoxyxanthone(10), 1-hydroxy-2,3,4,5,7-pentamethoxyxanthone (11) and usnic acid (12). Conclusion: Compounds 6 and 12 are obtained from L. carinthiacum and H. corniculate for the first time.
8.Aristolochic acids exposure was not the main cause of liver tumorigenesis in adulthood.
Shuzhen CHEN ; Yaping DONG ; Xinming QI ; Qiqi CAO ; Tao LUO ; Zhaofang BAI ; Huisi HE ; Zhecai FAN ; Lingyan XU ; Guozhen XING ; Chunyu WANG ; Zhichao JIN ; Zhixuan LI ; Lei CHEN ; Yishan ZHONG ; Jiao WANG ; Jia GE ; Xiaohe XIAO ; Xiuwu BIAN ; Wen WEN ; Jin REN ; Hongyang WANG
Acta Pharmaceutica Sinica B 2022;12(5):2252-2267
Aristolochic acids (AAs) have long been considered as a potent carcinogen due to its nephrotoxicity. Aristolochic acid I (AAI) reacts with DNA to form covalent aristolactam (AL)-DNA adducts, leading to subsequent A to T transversion mutation, commonly referred as AA mutational signature. Previous research inferred that AAs were widely implicated in liver cancer throughout Asia. In this study, we explored whether AAs exposure was the main cause of liver cancer in the context of HBV infection in mainland China. Totally 1256 liver cancer samples were randomly retrieved from 3 medical centers and a refined bioanalytical method was used to detect AAI-DNA adducts. 5.10% of these samples could be identified as AAI positive exposure. Whole genome sequencing suggested 8.41% of 107 liver cancer patients exhibited the dominant AA mutational signature, indicating a relatively low overall AAI exposure rate. In animal models, long-term administration of AAI barely increased liver tumorigenesis in adult mice, opposite from its tumor-inducing role when subjected to infant mice. Furthermore, AAI induced dose-dependent accumulation of AA-DNA adduct in target organs in adult mice, with the most detected in kidney instead of liver. Taken together, our data indicate that AA exposure was not the major threat of liver cancer in adulthood.
9.Clinical and DGUOK genetic analysis of a family with hepatocerebral mitochondrial DNA depletion syndrome
Xinli BAI ; Tingting YANG ; Shuzhen MA ; Lihong ZHANG ; Zhenzhong LI ; Yalei PI
Chinese Journal of Applied Clinical Pediatrics 2021;36(8):616-619
Objective:A retrospective analysis was performed on clinical characteristics and deoxyguanosine kinase DGUOK gene mutations in a family with hepatocerebral mitochondrial DNA depletion syndrome (MTDPS). Methods:The clinical data, treatment process and gene detection results of a child with MTDPS in the second hospital of Hebei Medical University in April 2019 were analyzed and summarized.Results:Proband was a girl.From the first week of infantile, she suffered from recurrent hypoglycemia, hyperlactic acid, progressive cholestatic liver dysfunction, coagulopathy, difficult feeding, slow growth of body mass, microcephaly, hypotonia, and gradul intermittent binocular tremors, and eventually failed to thrive.Gene testing identified two compound heterozygous mutations c. 42-c.43insTTCA(p.F15fs129X)/c.808-1(IVS6)G>A in DGUOK gene.The former was a frame-shift mutation resulted in truncated protein and the later was a splicing mutation resulted in abnormal splicing.Each parent was a heterozygous carrier, and there were no mutations in the two sites with her elder sister. Conclusions:Both mutations were first reported worldwide. DGUOK gene mutations with MTDPS are important causes of infant liver failure.When hypoglycemia, hyperlactic acidemia and liver dysfunction occur in newborn and infant, MTDPS related gene DGUOK gene sequencing screening should be considered for early definitive diagnosis, or, when acute liver failure happen in infant and childhood, neuromuscular involvement is insufficient.
10.Analysis of clinical characteristics and gene mutations in children with progressive familial intrahepatic cholestasis type 2
Xinli BAI ; Ling LYU ; Tingting YANG ; Zhenzhong LI ; Shuzhen MA ; Huifeng ZHANG
Chinese Journal of Applied Clinical Pediatrics 2020;35(19):1503-1506
Objective:To investigate clinical characteristics and ABCB11 gene mutations in probands suffering from progressive familial intrahepatic cholestasis type 2(PFIC2). Methods:The clinical data involving manifestations and laboratory examinations of 2 probands with PFIC2 admitted to Pediatric Digestive and liver Clinic in Second Hospital of Hebei Medical University during January 2017 to December 2018 were retrospectively analyzed.Target capture high-throughput sequencing, genome-wide gene copy number variation(CNV) detection and validation were performed on probands and their parental DNA.Results:The age of onset for the 2 probands ranged from 2 to 5 months, and they had hepatosplenomegaly, severe cholestasis, pruritus, and binding bilirubin/ total bilirubin (proband 1: 51.8%-77.5%, proband 2: 47.1%-66.5%). Bile acid and aminotransferase[mainly aspartate transaminase (AST)] increased, but γ-glutamyltransferase(GGT) remained normal.Compound heterozygous mutations of ABCBll gene were discovered in proband 1: single strand deletion/c.3213+ 5G>A splicing mutation, and deletion mutation were spontaneous mutation.A total of 2.256 Mb(chr2 2q24.3q31.1)was missing, whereas splicing mutation was originated from her father.Polymorphisms with Val444Ala(T1331C)and Ala1028Ala(A3084G)were proved in proband 1.Compound heterozygous mutations of ABCB11 gene were revealed in proband 2: c.1483A>G(p.R495G)/c.2594C>T(p.A865V), and both parents were heterozygous carriers.Single-strand 2.256 Mb deletion in proband 1 and 2 mutations in proband 2 were unreported new mutations worldwide. Conclusions:In clinical work, children with cholestasis, elevated bile acid and transaminase(mainly AST), but normal GGT, should be detected for PFIC genes as soon as possible.

Result Analysis
Print
Save
E-mail