ObjectiveTo establish an ultra-performance liquid fingerprint and multi-components determination method for Naomaili granules. To evaluate the quality of different batches by chemometrics， and the anti-neuroinflammatory effects of water extract and main components of Naomaili granules were tested in vitro. MethodsThe similarity and common peaks of 27 batches of Naomaili granules were evaluated by using Ultra performance liquid chromatography （UPLC） fingerprint detection. Ultra-performance liquid chromatography-tandem mass spectrometry （UPLC-MS/MS） technology was used to determine the content of the index components in Naomaili granules and to evaluate the quality of different batches of Naomaili granules by chemometrics. LPS-induced BV-2 cell inflammation model was used to investigate the anti-neuroinflammatory effects of the water extract and main components of Naomaili granules. ResultsThe similarity of fingerprints of 27 batches of samples was > 0.90. A total of 32 common peaks were calibrated， and 23 of them were identified and assigned. In 27 batches of Naomaili granules， the mass fractions of 14 components that were stachydrine hydrochloride， leonurine hydrochloride， calycosin-7-O-glucoside， calycosin，tanshinoneⅠ， cryptotanshinone， tanshinoneⅡ_A， ginsenoside Rb₁， notoginsenoside R₁， ginsenoside Rg₁， paeoniflorin， albiflorin， lactiflorin， and salvianolic acid B were found to be 2.902-3.498， 0.233-0.343， 0.111-0.301， 0.07-0.152， 0.136-0.228， 0.195-0.390， 0.324-0.482， 1.056-1.435， 0.271-0.397， 1.318-1.649， 3.038-4.059， 2.263-3.455， 0.152-0.232， 2.931-3.991 mg∙g^-1， respectively. Multivariate statistical analysis showed that paeoniflorin， ginsenoside Rg₁， ginsenoside Rb₁ and staphylline hydrochloride were quality difference markers to control the stability of the preparation. The results of bioactive experiment showed that the water extract of Naomaili granules and the eight main components with high content in the prescription had a dose-dependent inhibitory effect on the release of NO in the cell supernatant. Among them， salvianolic acid B and ginsenoside Rb₁ had strong anti-inflammatory activity， with IC₅₀ values of （36.11±0.15） mg∙L^-1 and （27.24±0.54） mg∙L^-1， respectively. ConclusionThe quality evaluation method of Naomaili granules established in this study was accurate and reproducible. Four quality difference markers were screened out， and eight key pharmacodynamic substances of Naomaili granules against neuroinflammation were screened out by in vitro cell experiments.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

Objective: To fabricate a hydrogel loaded with inositol hexaphosphate-zinc and preliminarily evaluate its performance in self-mineralization and osteoinduction, thereby providing a theoretical basis for the development of bone regeneration materials. Methods: The hydrogel framework (designated DF0) was formed by copolymerizing methacryloyloxyethyltrimethylammonium chloride and four-armed poly(ethylene glycol) acrylate, followed by sequentially loading inositol hexaphosphate anions via electrostatic interaction and zinc ions via chelation. The hydrogel loaded only with inositol hexaphosphate anions was named DF1, while the co-loaded hydrogel was named DF2. The self-mineralization efficacy of the DF0 , DF1 and DF2 hydrogels was characterized using scanning electron microscopy, transmission electron microscopy (TEM), energy dispersive spectroscopy (EDS), and selected area electron diffraction (SAED). The biocompatibility was assessed via live/dead cell staining and a CCK-8 assay. The osteoinductive capacity of the DF0 , DF1 and DF2 hydrogels on MC3T3-E1 cells was assessed via alkaline phosphatase (ALP) and Alizarin Red S (ARS) staining. In the aforementioned cell experiments, cells cultured in standard medium served as the control group Results: The DF0, DF1, and DF2 hydrogels were successfully synthesized. Notably, DF1 and DF2 exhibited distinct self-mineralization within 6 days. Results from TEM, EDS, and SAED confirmed that the mineralization products were amorphous calcium phosphate in group DF1, and amorphous calciumzinc phosphate in group DF2. Biocompatibility tests revealed that none of the hydrogels (DF0, DF1, and DF2) adversely affected cell viability or proliferation. In osteogenic induction experiments, both ALP and ARS staining were intensified in the DF1 and DF2 groups, with the most profound staining observed in the DF2 group. Conclusion The developed inositol hexaphosphate-zinc hydrogel (DF2) demonstrates the dual capacity to generate calcium-phosphate compounds through self-mineralization while exhibiting excellent osteoinductive properties. This biocompatible, dual-promoting osteogenic hydrogel presents a novel strategy for bone regeneration.

OBJECTIVE To conduct a clinical rapid evaluation of the marketed proprotein convertase subtilisin/kexin type 9 （PCSK9） inhibitors in China， including evolocumab， tafolecimab， recaticimab， ebronucimab， ongericimab and inclisiran. METHODS Based on the Rapid Guide for Drug Evaluation and Selection in Chinese Medical Institutions （second edition）， drug instructions， clinical diagnosis and treatment guidelines， and literature for six drugs were retrieved from CNKI， Wanfang Data， VIP， PubMed， Embase， Cochrane Library and related official websites. The clinical rapid evaluation was conducted from five aspects： pharmaceutical characteristics， effectiveness， safety， economy， and other attributes. RESULTS The pharmaceutical characteristics， effectiveness， safety， economy， other attributes， and total score of evolocumab scored 24， 27， 15.7， 10， 5.3， and 82 points， respectively. Tafolecimab scored 23.5， 23， 11.5， 9.97， 4.6， and 72.57 points， respectively. Recaticimab scored 20.5， 22， 15.5， 6.37， 3.5， and 67.87 points. Ebronucimab scored 20， 23， 11， 6.48， 3.5， and 63.98 points. Ongericimab scored 20.5， 23， 8.5， 4.83， 3.5， and 60.33 points. Inclisiran scored 25.5， 24， 13， 6.48， 5， and 73.98 points. CONCLUSIONS Evolocumab is the optimal choice for treating hypercholesterolemia and is recommended as the first-line option. Tafolecimab is the second-line option， and recaticimab is suitable for patients who are sensitive to drug adverse reactions. Inclisiran is suitable for patients with poor compliance. Ebronucimab and ongericimab are weakly recommended due to their later market introduction. Clinicians should make individualized drug selections based on factors such as patient risk level and compliance requirements.

OBJECTIVE To evaluate the cost-effectiveness of cefiderocol versus best available therapy （BAT） or standard-of- care （SOC） for the treatment of confirmed or suspected carbapenem-resistant Gram-negative bacterial （CRGNB） serious infections from the perspective of the Chinese healthcare system， and to explore its reasonable pricing. METHODS A decision tree model was constructed based on data from two phase Ⅲ clinical trials （CREDIBLE-CR and GAME CHANGER） to simulate the cost- effectiveness of cefiderocol in two scenarios： salvage therapy for confirmed CRGNB infection （scenario 1） and empirical therapy for suspected CRGNB infection （scenario 2）. The primary outcome measure was the incremental cost-effectiveness ratio （ICER）. The willingness-to-pay （WTP） was set at 1 to 3 times China’s per capita GDP in 2024. To verify the robustness of the results， one- way and probabilistic sensitivity analyses were conducted， and based on these， a reasonable price range for cefiderocol in the Chinese market was explored. RESULTS The results for scenario 1 showed that the clinical cure rate in the cefiderocol group was higher than that in the BAT group （47.50% vs. 34.21%）， but its ICER was 415 065.03 yuan per cured case， exceeding three times China’s GDP per capita. Scenario 2 revealed that the ICER for cefiderocol relative to SOC was as high as 1 362 446.16 yuan per cured case， far exceeding the WTP. Sensitivity analysis indicated that the treatment duration and price of cefiderocol were key factors affecting its cost-effectiveness. In the two scenarios described above， the unit price of cefiderocol must fall below 683.47 and 242.00 yuan/g， respectively， to be considered cost-effective. CONCLUSIONS Based on the current market price， cefiderocol lacks sufficient cost-effectiveness for treating confirmed or suspected CRGNB serious infections within China’s healthcare system. To improve its accessibility， price negotiations or a tiered medical insurance payment strategy are required.

ObjectiveTo analyze the characteristics of 150 patients with spinal cord injury complicated with spasticity. MethodsA cross-sectional survey was conducted on 150 patients with spinal cord injury accompanied by spasticity from September, 2019 to December, 2024. Their age, gender, cause of injury, injury site, severity of injury, spasticity severity and other indicators were recorded. The relationships between different characteristics were analyzed, and a correlation analysis of disease duration, spasticity grade, injury level, injury severity and age were conducted. ResultsThere was no significant difference in age distribution between patients with tetraplegia and paraplegia (Z = 0.806, P = 0.420). The proportions of trauma (χ² = 3.982, P = 0.046) and tetraplegia (χ² = 10.559, P = 0.010) were higher in males than in females. Trauma was the main cause of injury in both tetraplegia and paraplegia patients; the proportion of tetraplegia was higher than paraplegia in trauma patients, while paraplegia was higher than tetraplegia in non-trauma patients (χ² = 11.885, P < 0.001). Patients with tetraplegia was dominated by incomplete injury, whereas patients with paraplegia was dominated by complete injury (χ² = 10.885, P = 0.012). Grade A injury was predominant in trauma patients (P = 0.003). Spasticity grade showed a very weak positive correlation with disease duration (r = 0.175, P = 0.032) and age (r = 0.168, P = 0.040). Injury severity showed a very weak positive correlation with age (r = 0.183, P = 0.025). ConclusionCharacteristics of patients with spinal cord injury complicated with spasticity is different with gender, cause of injury, injury level, injury severity.

ObjectivePost-ischemic acute inflammation and the subsequent persistent dysregulation of the immune microenvironment represent major pathological drivers that aggravate neuronal injury and severely restrict functional recovery following ischemic stroke. Although current reperfusion therapies partially restore blood flow, they fail to effectively modulate the secondary inflammatory cascade and oxidative stress, which remain critical barriers to neurological restoration. To address this challenge, this study aimed to engineer and systematically evaluate a biomimetic nanosystem composed of transforming growth factor-β1 (TGF-β1)-loaded platelet membrane-camouflaged lipid nanoparticles (PLP). This nanosystem was designed to achieve dual lesion-targeted delivery and immune microenvironment remodeling. By verifying its spatiotemporal accumulation, anti-inflammatory activity, and neuroprotective efficacy, we sought to establish an integrated therapeutic strategy that simultaneously enables lesion targeting, immune regulation, and functional recovery after ischemic injury. MethodsThe physicochemical properties of PLP, including hydrodynamic particle size, zeta potential, structural stability, and morphology, were characterized using dynamic light scattering, zeta potential analysis, and transmission electron microscopy. The preservation of platelet membrane-derived adhesion and immunoregulatory proteins was confirmed by SDS-PAGE through comparative analysis of protein band profiles between PLP and native platelet membranes. The in vitro biological activities of PLP were evaluated using two complementary cellular models. LPS-induced M1-polarized RAW264.7 macrophages were employed to assess inflammatory modulation, while oxygen glucose deprivation/reperfusion (OGD/R)-induced BV2 microglial cells and SH-SY5Y neuronal cells were utilized to investigate neuroinflammatory regulation and neuronal protection. For in vivo validation, a transient middle cerebral artery occlusion (tMCAO) mouse model was established to mimic ischemia-reperfusion injury. The spatiotemporal biodistribution and lesion-targeting capability of the PLP were monitored through live fluorescence imaging. Therapeutic efficacy was comprehensively evaluated by triphenyltetrazolium chloride (TTC) staining, glial fibrillary acidic protein (GFAP) immunofluorescence analysis, body weight monitoring, and neurological severity score (NSS) assessment. ResultsPLP nanoparticles displayed a uniform spherical morphology, nanoscale particle size distribution, and stable negative surface charge, indicating favorable colloidal stability and circulation potential. SDS-PAGE results confirmed the effective retention of key platelet membrane proteins associated with endothelial adhesion, immune evasion, and inflammatory regulation, demonstrating the successful biomimetic construction. Optimal therapeutic concentrations were determined in OGD/R-induced BV2 cells, where PLP exhibited excellent cytocompatibility and anti-inflammatory activity.In vitro experiments demonstrated that PLP significantly inhibited the polarization of RAW264.7 macrophages toward the pro-inflammatory M1 phenotype and markedly reduced neuronal apoptosis under ischemia-reperfusion conditions. In vivo fluorescence imaging revealed that PLP rapidly accumulated in the ischemic brain hemisphere and maintained prolonged retention for up to 7 d, suggesting enhanced lesion-specific targeting and sustained drug release. Compared with control group, PLP treatment significantly reduced cerebral infarct volume, attenuated reactive astrogliosis, improved weight recovery, and accelerated neurological functional restoration, as reflected by significantly improved NSS scores. ConclusionThis study establishes a multifunctional biomimetic nanoplatform that integrates platelet membrane-mediated active targeting with the anti-inflammatory, antioxidative, and neuroprotective properties of TGF-β1. The PLP system enables rapid lesion homing and long-term retention while synergistically regulating the post-stroke inflammatory microenvironment by suppressing pro-inflammatory immune activation, reducing neuronal apoptosis, and limiting excessive astrocyte reactivity. Importantly, this study proposes a conceptually therapeutic paradigm that combines targeted delivery with immune microenvironment remodeling to achieve comprehensive neurovascular protection. These findings provide strong experimental evidence supporting the translational potential of biomimetic nanotherapeutics as next-generation precision interventions for ischemic stroke.

ObjectiveDonkey hide is the sole legally designated raw material for the preparation of the traditional Chinese medicine Ejiao. The quality stability of donkey hide during preservation directly determines the efficacy and safety of Ejiao. This study focuses on the dynamic succession of microbial communities during the preservation of donkey hides from different origins, aiming to clarify the correlation between microbial biodiversity difference and the degradation profiles of hide collagen and critical biochemical components, thereby providing a theoretical foundation for developing targeted preservation strategies based on microbial regulation. MethodsDonkey hides originating from four different regions were subjected to an accelerated microbial aging assay to simulate the spoilage process. The microbial community succession was analyzed using high-throughput sequencing. Microstructure changes and pore structure characteristics were assessed by scanning electron microscopy and mercury intrusion porosimetry, respectively. Additionally, the content of major components, including lipids, proteins, and sugars were determined by biochemical methods. ResultsAfter 96 h of aging, the collagen fiber structure in Africa donkey hides (ADH) exhibited significant degradation and collapse, followed by Xinjiang donkey hides (XDH). Instead, the microstructure of Dong’e black donkey hides (DDH) and Peru donkey hides (PDH) remained relatively intact. The porosities of DDH, XDH, PDH, and ADH increased from 27.9%, 15.7%, 30.3%, and 46.2% to 36.5%, 52.6%, 42.8%, and 57.7%, respectively, during the aging process, which suggested that the originally compact fiber structure was disrupted by microbial aging. Fourier transform infrared spectrometer analysis revealed the amide bands in XDH exhibited relatively weak intensity, and no collagen amide I band was observed in ADH. Meanwhile, the lipid and protein contents decreased in all four types of donkey hides, indicating that these components served as the primary nutrient sources for the growth of microorganism. Notably, the most severe collagen degradation was observed in XDH and ADH. A substantial increase was detected in the total soluble sugar in PDH aging solution and hydroxyproline in the ADH aging solution, respectively. These results indicated that donkey hides exhibit distinct patterns of structural degradation and nutrient utilization. Furthermore, the viable cells number of donkey hides increased sharply after 48 h of aging. Metagenomic analysis revealed that the relative abundance of Euryarchaeota in ADH, PDH and XDH declining from initial 93.19%, 97.73% and 30.08% to 0.79%, 1.43% and 0.02% after 96 h, respectively. Conversely, a significantly increase was observed in the abundance of Bacillota, with a marked increase in ADH, peaking at 92.75%. Additionally, the abundance of Pseudomonadota in PDH increased from 0.10% to 87.84%, suggesting that Bacillota and Pseudomonadota may be key factors exacerbating donkey hide spoilage. Unlike the other three types of donkey hides, the dominant bacterial phylum in DDH shifted from Pseudomonadota to Bacteroidota, characterized by a substantial abundance increase of Bacteroidota from 0.13% to 44.22%. ConclusionRegional variation in origin significantly influence the microbial aging of donkey hides, leading to distinct patterns of structural deterioration and differential nutrient utilization. Therefore, implementing origin-specific preservation strategies, through the precisely controlling environmental factors to suppress harmful phyla such as Bacillota and Pseudomonadota, is crucial for enhancing the storage quality of donkey hides.

BACKGROUND:Macrophage polarization plays a key role in chronic inflammatory joint diseases such as rheumatoid arthritis.Cerium dioxide(CeO2)nanoparticles have a wide range of biomedical applications such as modulating the local inflammatory microenvironment of tissues.OBJECTIVE:To investigate the role of CeO2 nanoparticles on macrophage polarization and inflammatory factor expression,as well as inflammatory modulation in a co-culture system of macrophages and fibroblasts.METHODS:(1)CeO2 nanoparticles were dispersed and observed morphologically by transmission electron microscopy.(2)Human leukemia monocytes(THP-1)were induced to differentiate and establish the M1 macrophage pro-inflammatory cell model of rheumatoid arthritis.The cells were divided into M0 group(undifferentiated macrophages),M1 group(successful macrophage modeling),CeO2 nanoparticle treatment group(M1 group with CeO2 nanoparticle treatment),and dexamethasone control group(M1 group with dexamethasone treatment)and incubated for 48 hours.The effects of CeO2 nanoparticles on the expression of inflammatory factors(endogenous nitric oxide synthase,CD86,CD80)in M1 macrophages and M1 macrophage phenotype(CD80,CD206)were detected by RT-qPCR,western blot assay,and flow cytometry.(3)A co-culture system of macrophages and fibroblasts was established,and CeO2 nanoparticles acted on the upper macrophages.The regulation of CeO2 nanoparticles on the expression of inflammatory factors(interleukin-6,tumor necrosis factor-α,cyclooxygenase-2,and endogenous nitric oxide synthase)of fibroblasts in the co-culture system was observed at the mRNA and protein levels.RESULTS AND CONCLUSION:(1)Transmission electron microscopy showed that the diameter of CeO2 nanoparticles was(19.5±2.0)nm.(2)Compared with the M0 group,the mRNA of endogenous nitric oxide synthase and CD86,and the protein expression of endogenous nitric oxide synthase and CD80 in the M1 group were upregulated.Compared with the M1 group,the mRNA expression of endogenous nitric oxide synthase and CD86,and the protein expression of endogenous nitric oxide synthase and CD80 in the CeO2 nanoparticle treatment group were downregulated.Flow cytometry showed that 20 nm CeO2 nanoparticles downregulated the number of M1 macrophages.(3)Compared with the M1 group,20 nm CeO2 nanoparticles downregulated the mRNA and protein expression of inflammatory factors(tumor necrosis factor α,interleukin 6,cyclooxygenase 2,and endogenous nitric oxide synthase)in the co-culture system HFL1 cells.(4)The results showed that 20 nm CeO2 nanoparticles can alleviate inflammation in the co-culture system by inhibiting the expression of pro-inflammatory factors in M1 macrophages,providing a new idea for the treatment of inflammatory diseases such as rheumatoid arthritis.

BACKGROUND:Osteoarthritis is pathologically characterized by progressive degeneration of the articular cartilage and abnormal deformation of the subchondral bone.In recent years,with the deepening of medical research,it has been found that the mitogen-activated protein kinases(MAPK)signaling pathway has a regulatory role in inflammatory cell infiltration,inflammatory factor release,and chondrocyte proliferation,which is particularly important for the treatment of osteoarthritis.OBJECTIVE:To briefly review the main research progress in the mechanism of MAPK signaling pathway regulating osteoarthritis in recent years,aiming to provide new ideas for the treatment of osteoarthritis.METHODS:CNKI,WanFang and PubMed databases were searched for relevant literature using the search terms of"mitogen-activated protein kinases,osteoarthritis,extracellular signal-regulated MAP kinases,p38 mitogen-activated protein kinases,JNK mitogen-activated protein kinase"in Chinese and English.Relevant literature published from January 2019 to November 2024 was searched,and 108 articles were finally included for summary analysis.RESULTS AND CONCLUSION:(1)Various stimuli inside and outside the cells activate the MAPK signaling pathway,regulate gene transcription and protein synthesis,and promote the release of inflammatory factors,such as tumor necrosis factor-α,interleukin-1β,and interleukin-6.The release of these inflammatory factors aggravates the progression of osteoarthritis.(2)The active ingredients of traditional Chinese medicine,mainly saponins and flavonoids,as well as Chinese herbal formulas and preparations with the main effects of activating blood circulation and removing blood stasis,tonifying the liver and kidney,can play a therapeutic role in osteoarthritis by inhibiting the MAPK signaling pathway,regulating the release of matrix metalloproteinases,balancing the homeostatic state of osteogenesis and osteoblastogenesis,attenuating the synovial inflammation,decreasing the release of inflammatory factors and inflammatory vesicles,decreasing cellular pyroptosis,promoting autophagy,and ameliorating oxidative stress.(3)Although traditional Chinese medicine has become popular in the treatment of osteoarthritis by virtue of its own advantages of multi-components,multi-targets,multi-pathways,and low side effects,the use of MAPK signaling pathway to guide the treatment of individual osteoarthritis is the difficulty of the technology,which needs to be continuously researched and explored.(4)Therefore,further development of relevant herbal inhibitors that can modulate the MAPK signaling pathway may be a potential drug strategy for the treatment of osteoarthritis in the future.